Cell line capable of stably expressing porcine PIGR SC fragment and J chain as well as construction method and application of cell line

Abstract

The invention discloses a cell line capable of stably expressing a porcine PIGR SC fragment and a J chain as well as a construction method and application of the cell line, and belongs to the technical field of gene engineering. The construction method comprises the following steps: inserting coding sequences of an SC fragment gene and a J-chain gene of the porcine PIgR into lentiviral vector plasmids to obtain an SC fragment and J-chain overexpressed lentiviral vector plasmid of the PIgR; carrying out co-transfection on the lentivirus vector plasmid, PPSAX2 and PMD2. G plasmids, so as to obtain a recombinant lentivirus; and infecting cells with the recombinant lentivirus to obtain positive cells, and carrying out enlarged culture to obtain the SC fragment and J chain cell line for stably expressing the swine PIGR. According to the invention, a cell line for stably expressing the SC fragment and the J chain of the porcine PIgR is constructed, so that the SIgA antibody can be rapidly and efficiently prepared by a gene engineering technology.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and in particular to a cell line stably expressing a porcine PIgR SC fragment and a J chain, and a construction method and application thereof. Background Art

[0002] The mucosa is the first line of defense for the body against pathogen invasion. SIgA antibodies are effector antibodies of mucosal immune response. Monomeric IgA antibodies are composed of heavy and light chains, and two monomeric IgA are connected by immunoglobulin J chains to form dimers. During the process of dimeric IgA being transported from the basal side to the mucosal surface, it binds to the secretory component (SC) released by the cleavage of the polymeric immunoglobulin receptor (pIgR) to form SIgA antibodies. The immunoglobulin J chain is produced by mature B plasma cells and was first isolated and identified in SIgA and SIgM antibodies in 1971. The immunoglobulin J chain gene shows a high degree of conservation in phylogeny, and there are 8 conserved cysteine ​​sites in the species that have been discovered. In addition to the high conservation of the amino acid sequence, the J chain also shows a considerable degree of consistency in function.

[0003] The immunoglobulin J chain contains only one Ig-like domain, and the protein size is about 18kD. Different from the functions of the immunoglobulin heavy chain and light chain, the J chain does not have the ability to recognize specific antigens. The main function of this chain is to connect two or more Ig monomers through covalent bonds to form a dimer or multimer structure. The hairpin-like structure at the C-terminus of the J chain can bind to the Fc region of IgA or IgM through hydrophobic interaction, allowing two monomers of IgA to be connected through the J chain to form a dimer, and five monomers of IgM to form a pentamer.

[0004] The J chain not only plays a key role in the formation of polymers from Ig monomers, but is also crucial to the secretion of secretory antibodies. It forms a receptor-ligand complex (sIgA precursor) by binding to the polymeric immunoglobulin receptor (PIgR) expressed in the lower layer of epithelial cells. The complex then enters the cell through endocytosis to form vesicles, and is eventually transported to mucosal-related tissues for release through these vesicles. In this process, PIgR is degraded into secretory fragments (SC) by thiol-dependent proteases. SC binds to IgA dimers through non-covalent bonds to form secretory IgA antibodies. Only dimers bound to the J chain can bind to PIgR and then be transported to the mucosal surface to perform immune functions. Studies have found that some pre-B cells and cells that secrete IgG antibodies can also express the J chain, indicating that the J chain may be involved in a wider range of immune response processes.

[0005] As a specific receptor for dimeric immunoglobulin A (pIgA), polymeric immunoglobulin receptor (pIgR) plays an important role in the body's mucosal immune response. In mammals, dimeric IgA in the mucosal lamina propria needs to cross epithelial cells to reach the mucosal surface under the action of pIgR. This process is called transcytosis. pIgR is mainly expressed on the basal side of mucosal epithelial cells, binds to dimeric IgA formed in the lamina propria, and reaches the apical side of mucosal epithelial cells through transcytosis. Under the action of thiol-dependent proteases, the complex of the secretory fragment of pIgR and dimeric IgA is released into the exocrine fluid or the surface of the mucosal tissue, and plays a role in resisting pathogen invasion and maintaining microenvironmental homeostasis in the form of secretory IgA. pIgR plays a key role in the formation of SIgA. Its secretory fragment, as a part of SIgA, makes SIgA more stable and less susceptible to the influence of the microenvironment, thereby better playing a defensive function. SIgA has strong resistance to acid, alkali and protease hydrolysis, and can maintain its antibody activity in the digestive tract. Luton et al. showed that after SIgA in milk enters the digestive tract of piglets, it adheres to the surface of the digestive tract mucosa, which can prevent the adhesion of pathogenic microorganisms to the intestinal mucosal epithelium, promote the excretion of pathogenic microorganisms, and reduce the occurrence of intestinal diseases. Compared with IgG, SIgA has a longer half-life on the mucosal surface, and its multivalent structure makes it have a higher affinity with antigens, and it may have more effective biological activity. The above research results all show that SIgA has great application potential in the field of mucosal anti-infection. For example, PEDV, PDCOV, PRRSV, CSFV, TGEV, etc., which are more harmful to pigs, all invade the body through the mucosa. The antibodies produced by monoclonal antibody technology are almost all IgG, and IgG antibodies cannot enter the mucosal layer to prevent virus invasion. If pathogen-specific SIgA antibodies can be directly produced, the harm of these viruses will be greatly reduced. Therefore, the present invention constructs a cell line that stably expresses the SC fragment and J chain of pig PIgR, so that the genetic engineering technology can prepare SIgA antibodies quickly and efficiently. Summary of the invention

[0006] The purpose of the present invention is to provide a cell line stably expressing porcine PIgR SC fragment and J chain and a construction method and application thereof, so as to solve the problems existing in the above-mentioned prior art.

[0007] To achieve the above object, the present invention provides the following solutions:

[0008] Technical solution 1: A method for constructing a cell line that stably expresses the SC segment and J chain of porcine PIgR, comprising the following steps: inserting the coding sequences of the SC segment gene and the J chain gene of porcine PIgR into a lentiviral vector plasmid to obtain a lentiviral vector plasmid that overexpresses the SC segment and J chain of PIgR; co-transfecting the lentiviral vector plasmid with PSPAX2 and PMD2.G plasmids to obtain a recombinant lentivirus; infecting cells with the recombinant lentivirus, and expanding and culturing the positive cells to obtain the cell line that stably expresses the SC segment and J chain of porcine PIgR.

[0009] Furthermore, the gene sequence of the SC fragment of the porcine PIgR is shown in SEQ ID NO.1.

[0010] Furthermore, the coding sequence of the J chain gene is shown in SEQ ID NO.2.

[0011] Furthermore, the cells are 293T cells.

[0012] Technical Solution 2: A cell line capable of stably expressing the SC fragment and J chain of porcine PIgR, which is constructed using the construction method described above.

[0013] Technical solution three: Use of the cell line in the preparation of porcine epidemic diarrhea virus secretory IgA antibodies.

[0014] The present invention discloses the following technical effects:

[0015] The present invention relates to a 293T cell line with high expression of SC fragment and J chain gene of PIgR and a construction method and application thereof. The present invention inserts the coding sequence of SC fragment and J chain gene of porcine PIgR into a lentiviral vector plasmid to obtain SC fragment and J chain overexpression lentiviral vector plasmid of PIgR; co-transfects SC fragment and J chain overexpression lentiviral vector plasmid of PIgR with PSPAX2 and PMD2.G plasmids into 293T cells by liposome method to obtain recombinant lentivirus; infects 293T cells with recombinant lentivirus, and screens with puromycin to obtain positive cells; and expands and cultures the screened positive cells to obtain 293T cell line with high expression of SC fragment and J chain of PIgR. The present invention constructs a cell line stably expressing SC fragment and J chain of porcine PIgR, so that SIgA antibody can be prepared quickly and efficiently by genetic engineering technology. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0017] Figure 1 Results of PCR amplification of J chain (A) and PCR amplification of SC (B);

[0018] Figure 2 Results of bacterial solution PCR verification of pLV4ltr-SC-T2A-J (A) and restriction enzyme digestion verification of pLV4ltr-SC-T2A-J (B);

[0019] Figure 3 The cell survival under different puromycin concentrations;

[0020] Figure 4 The fluorescence image (A) and the white light image (B) in the same field of view obtained by infecting cells at an MOI value of 40;

[0021] Figure 5 The growth of cells into a single clone;

[0022] Figure 6 To determine the stability of 293T-SC-J at multiple generations based on the J chain mRNA expression level;

[0023] Figure 7 To determine the stability of 293T-SC-J at multiple generations based on SC mRNA expression levels;

[0024] Figure 8 Protein expression of 293T cells and 293T-SC-J cells when rabbit anti-J chain antibody was used as the primary antibody;

[0025] Fig. 9 Protein expression of 293T cells and 293T-SC-J cells when rabbit anti-SC antibody was used as the primary antibody;

[0026] Fig.10 The fluorescence expression of 293T cells and 293T-SC-J cells in anti-J chain serum and negative serum, the ratio is 150um;

[0027] Fig.11 The fluorescence expression of 293T cells and 293T-SC-J cells in anti-SC serum and negative serum, the ratio is 150um;

[0028] Fig.12 This is the expression of the target protein in Example 2. DETAILED DESCRIPTION

[0029] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0030] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0031] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0032] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0033] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0034] Example 1 Construction of a 293T cell line stably expressing the SC fragment and J chain of porcine PIgR

[0035] 1. Preparation of overexpression vector

[0036] The coding sequences of the SC segment and J chain gene of porcine PIgR are inserted into the lentiviral vector plasmid to obtain the SC segment and J chain overexpression lentiviral vector plasmid of porcine PIgR.

[0037] Gene sequence of the SC fragment of porcine PIgR:

[0038]

[0039] Coding sequence of the J chain gene:

[0040] ATGAAGAACTCTTTGCTCTTCTGGGGAGTCCTGGTCATTTTTGTTGAGGCTGTTTTTGTGACAGCCCAAGATGAAGAAGAAAGTACCGTCCTTGTTGATAACAAATGTAAGTGTGCCCGGATTACTTCCAGGATCATCCGCTCTGCTGAAGACCCTAGTCAAGACATTGTGGAGAGAAACATCAGAATTATTGTTCCTCTGAACAACAGGGAGAATATCTCTGATCCCACCTCACCACT GAGAACCAATTTTGTGTACCATTTGTCTGACCTCTGTAAGAAATGTGATCTTACAGAAGTGGAGCTGGATAATCAAATCGTTACTGCCACCCAGAGCAATTTATGTGATGACGACATTGAGACCTGCTATGCTTATGACAGAAACAACGGTCCCATTTACCTATGATGGACAGACCAAAATGGTGCAAACAGCCTTGACCCCGGATTCCTGCTATCCTGAC(SEQ ID NO.2).

[0041] The J chain was synthesized by Qingke Biotechnology Co., Ltd. and the target gene was amplified by PCR (the system and procedure of PCR amplification were: using Vazyme P515-01 Max Master Mix kit was used to amplify J chain gene. The amplification system was 50 μL, including 25 μL PCR high-fidelity enzyme, 1 μL upstream and downstream primers (concentration: 10 pm / μL), 22 μL enzyme-free water, 1 μL cDNA, and the program was 95°C pre-denaturation for 3 min, 95°C denaturation for 15 s, 56°C annealing for 15 s, 72°C extension for 2 min, 30 cycles, and complete extension for 5 min). The results are shown in the table. Figure 1 , Figure 1For PCR amplification, the target gene and vector (the vector is pLV4ltr-PGK-ZsGreen (2A) PURO-CMV (P202210AA)) were connected by homologous recombination (the homologous recombination system is: 2 μL of linearized vector, 3 μL of J chain gene fragment, 2 μL of SC gene fragment, and 5 μL of homologous recombination enzyme). The prepared homologous recombination system was placed at 50°C for 30 minutes and then transformed into DH5α competent cells. 1 mL of LB liquid culture medium was added to the transformation product. After the bacteria recovered to normal growth state, they were spread on LB solid culture medium. The next day, a single clone was picked and placed in LB liquid culture medium containing Amp resistance for 4-6 hours. After that, PCR identification and enzyme digestion verification of the bacterial liquid were performed (the enzyme digestion system is: 10× enzyme digestion buffer 5 μL, SmaI restriction endonuclease 1 μL, XhoI restriction endonuclease 5 μL, vector 1 ug, fragment 1 ug, ddH2O filled up to 50 μL, and enzyme digestion was performed at 37°C for 2 hours. The results are shown in the table. Figure 2 , Figure 2 It is for bacterial liquid PCR identification and enzyme digestion identification.

[0042] 2. Endotoxin-free plasmid extraction

[0043] The bacterial suspension of the positive clone was inoculated into 15 mL of LB medium containing 50 mg / L Amp, and cultured at 37°C, 200 rpm, with shaking for about 18 hours. The bacterial cells were collected and the plasmid was extracted using an endotoxin-free plasmid miniprep kit (Tian Gen: DP118).

[0044] 3. Cytological Preliminary Experiment

[0045] 3.1 Puromycin drug killing exploration

[0046] HEK-293T cells were seeded in 48-well plates at 3 × 10 4 Add 200 μL of complete medium to each well and culture overnight. Replace the medium with puromycin at concentrations of 0, 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10 μg / mL, with two replicates per group. Replace the medium containing the corresponding puromycin 24 hours after drug addition; observe cell survival after 48 hours, and replace with 200 μL of medium without puromycin; the puromycin concentration of the experimental group with no cell survival after 72 hours is the screening concentration. The results showed that the optimal screening concentration was 1 μg / mL (see Figure 3 ). Figure 3 To explore the drug-killing concentration of puromycin.

[0047] 3.2 MOI exploration

[0048] HEK-293T cells were seeded in a 24-well plate, approximately 5 × 10 4Each well. The control virus carrying the reporter gene GFP was used to infect the cells at different MOI values ​​(10, 20, 40, 100, 200). The culture medium was replaced after 24 hours. After 48 hours, the expression intensity of green fluorescence, the proportion of cells expressing green fluorescence, and the overall state of the cells were observed. The results showed that the optimal MOI was 40 (see Figure 4 ), Figure 4 Explore for the best MOI.

[0049] 3.3 Monoclonal growth ability test

[0050] After counting the overexpression pool cells, the cell concentration was controlled at 1-1.5 cells per 100 μL by limiting dilution. The cell suspension was inoculated into a 96-well plate. Cultured for 10-15 days to see if the cells can survive and form a monoclonal clone. The results showed that the overexpression cells were able to form a monoclonal clone (see Figure 5 ), Figure 5 Test for monoclonal growth ability.

[0051] 4. Lentiviral packaging

[0052] 4.1 Cell culture

[0053] One day before transfection, subculture the grown HEK-293T cells into T75 culture flasks at a ratio of 1:3. When the cells grow to about 80%, prepare for transfection.

[0054] 4.2 Plasmid transfection

[0055] When the total amount of vector remains unchanged, the ratio of shuttle vector to auxiliary vector is adjusted according to the size of shuttle vector. TM (Biyuntian: C0521) transfection reagent requirements, mix the plasmid and transfection reagent, and perform cell transfection.

[0056] 4.3 Replacement of culture medium

[0057] 18-24 hours after transfection, remove the cell culture medium and discard it in a triangular flask, then seal it and sterilize it with high temperature and high pressure. The culture medium is replaced here to provide a medium with sufficient nutrition for virus production, and the transfection reagent, plasmid, etc. can be removed at the same time.

[0058] 4.4 Culture medium collection

[0059] 24 hours after the medium change, aspirate the cell culture supernatant into a 50 mL centrifuge tube and add fresh culture medium. At 48 hours, aspirate the cell culture supernatant into a 50 mL centrifuge tube and discard the cells. Filter the supernatant with a 0.45 μm sterile filter and transfer to a new centrifuge tube.

[0060] 4.5 Virus Concentration

[0061] The lentivirus was concentrated and purified using PEG lentivirus purification reagent (Innovent Biologics: P1201). Finally, the lentivirus precipitate was dissolved in DMEM, aliquoted at 200uL / tube, and stored at -80°C.

[0062] 5. Cytological Experiments

[0063] 5.1 Cell Infection

[0064] One day before infection, 3 × 10 5 The cells were plated in 12-well plates, and the corresponding viruses were used to infect the cells at an MOI of 40.

[0065] 5.2 Drug killing

[0066] After 24 hours of infection, the cells were killed with a culture medium containing puromycin at a final concentration of 1 μg / mL for 2 days, and then cultured with a culture medium without puromycin.

[0067] 5.3Pool cell qPCR detection

[0068] Expand the drug-killed Pool cells to 2×10 6 At the same time, half of the cells were sent for precipitation for qPCR detection, and the remaining half of the cells were expanded and kept as seeds.

[0069] 5.4 Single clone

[0070] After the pooled cells have overexpression results from qPCR, they are counted and the cell concentration is controlled to 1-1.5 cells per 100 μL by limiting dilution. The cell suspension is inoculated into a 96-well plate.

[0071] 5.5 Picking single clones

[0072] After culturing for about 15 days, observe the monoclonal clones growing in the 96-well plate under a microscope and mark the wells where the monoclonal clones are located. After digestion, discard the digestion solution and take 200uL of culture medium to resuspend the cells for passaging. When the cells expand to about 2×10 6 When the number of cells was 1, half of the cells were sent for precipitation for qPCR detection, and the remaining half of the cells were expanded for seedling.

[0073] 6.qPCR detection

[0074] The constructed stable expression cell line 293T-SC-J was plated in a 6-well plate. After culturing for 48 hours, RNA samples of the stable expression cell line were collected and tested by qPCR. The stability level of 293T-SC-J for multiple generations was determined at the gene level. The results are as follows Figure 6 and Figure 7 The expression levels of SC and J chain in this cell line were significantly higher than those in the control group, and their expression was stable during the passage process.

[0075] 7.WB experiment

[0076] 293T-SC-J chain cell line was plated in 6-well plates. After the cells were grown, the cells were processed and protein samples were prepared after 48 hours. After gel electrophoresis, the separated proteins were transferred to a 0.45 μm PVDF membrane. The PVDF membrane was blocked with 5% skim milk at room temperature for 2 hours. A 2000-fold diluted rabbit anti-J chain antibody was used as the primary antibody and incubated overnight at 4°C. A 5,000-fold diluted horseradish peroxidase-labeled goat anti-rabbit IgG antibody was used as the secondary antibody and incubated at room temperature for 2 hours. Finally, the expression of the target protein was detected using ECL colorimetric solution. Results are shown in Figure 8 .

[0077] 293T-SC-J chain cell line was plated in 6-well plates. After the cells were grown, the cells were processed and protein samples were prepared after 48 hours. After gel electrophoresis, the separated proteins were transferred to a 0.45μm PVDF membrane. The PVDF membrane was blocked with 5% skim milk at room temperature for 2 hours. A 2000-fold diluted rabbit anti-SC antibody was used as the primary antibody and incubated at 4°C overnight. A 5,000-fold diluted horseradish peroxidase-labeled goat anti-rabbit IgG antibody was used as the secondary antibody and incubated at room temperature for 2 hours. Finally, the expression of the target protein was detected using ECL colorimetric solution. Results are shown in Fig. 9 .

[0078] 8.IFA Experiment

[0079] IFA verifies the J chain protein expressed in the cell line. 293T-SC-J chain cell line was plated into 6-well plates. After the cells were confluent, the cells were fixed with 4% paraformaldehyde for 1 hour, permeabilized with 1% Triton X-100 for 10 minutes, blocked with 2.5% BSA for 1 hour, and 500-fold diluted rabbit anti-J chain antibody was used as the primary antibody. The cells were incubated at 4°C overnight. 1,000-fold diluted AlexaFlour 488-labeled goat anti-rabbit IgG antibody was incubated at room temperature for 1 hour. DAPI was used to stain the nucleus in the dark for 10 minutes. The expression of the target protein was detected using a Leica fluorescence microscope, see Fig.10 .

[0080] IFA verifies the SC protein expressed by the cell line. 293T-SC-J chain cell line was plated into 6-well plates. After the cells were confluent, the cells were fixed with 4% paraformaldehyde for 1 hour, permeabilized with 1% Triton X-100 for 10 minutes, blocked with 2.5% BSA for 1 hour, and 500-fold diluted rabbit anti-SC antibody was used as the primary antibody. The cells were incubated at 4°C overnight. 1,000-fold diluted Alexa Flour 488-labeled goat anti-rabbit IgG antibody was incubated at room temperature for 1 hour. DAPI was used to stain the nucleus in the dark for 10 minutes. The expression of the target protein was detected using a Leica fluorescence microscope. The results are shown in Fig.11 .

[0081] Example 2

[0082] The SC fragment of PIgR and the J chain gene highly expressed 293T cell line constructed in Example 1 were used to construct the SIgA antibody expressing pigs (the heavy chain and light chain vectors expressing IgA were transfected into the cell line to obtain SIgA antibodies). 293T-SC-J chain1 cells were inoculated into 6-well plates. When the cell density reached 70%, the transfection solution was prepared at a ratio of 3 μL of transfection reagent PEI per 1 μg DNA. The recombinant plasmid pcDNA3.1-H-T2A-L was transfected into 293T-SC-J chain1 cells. After 48 hours, the cells were processed and protein samples were prepared. After gel electrophoresis, the separated proteins were transferred to a 0.45 μm PVDF membrane. The PVDF membrane was blocked with 5% skim milk at room temperature for 2 hours. 3,000-fold diluted goat anti-pig IgA was incubated at room temperature for 2 hours. The expression of the target protein was detected using ECL colorimetric solution. The results are shown in Fig.12 .

[0083] The embodiments described above are only descriptions of the preferred embodiments of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A method for constructing a cell line stably expressing the SC fragment and J chain of porcine PIgR, characterized in that: The following steps are involved: The coding sequences of the SC segment gene and the J chain gene of the porcine PIgR are inserted into a lentiviral vector plasmid to obtain a lentiviral vector plasmid that overexpresses the SC segment and the J chain of the PIgR; the lentiviral vector plasmid is co-transfected with PSPAX2 and PMD2.G plasmids to obtain a recombinant lentivirus; the recombinant lentivirus is used to infect cells, and positive cells are obtained and then expanded and cultured to obtain the cell line that stably expresses the SC segment and the J chain of the porcine PIgR.

2. The construction method according to claim 1, characterized in that: The gene sequence of the SC fragment of the porcine PIgR is shown in SEQ ID NO.

1.

3. The construction method according to claim 1, characterized in that: The coding sequence of the J chain gene is shown in SEQ ID NO.

2.

4. The construction method according to claim 1, characterized in that: The cells are 293T cells.

5. A cell line capable of stably expressing the SC fragment and J chain of porcine PIgR, characterized in that: It is constructed using the construction method described in any one of claims 1 to 4.

6. Use of the cell line according to claim 5 in the preparation of secretory IgA antibodies against porcine epidemic diarrhea virus.

Images