Compositions and methods for purifying adenovirus

Peptide ligands targeting adenovirus hexons offer a solution for high-capacity, high-yield purification of adenovirus by binding and eluting at mild pH, addressing the limitations of current methods and ensuring purity and safety for large-scale production.

WO2026039746A1PCT designated stage Publication Date: 2026-02-19NORTH CAROLINA STATE UNIV

Patent Information

Application Number
PCT/US2025/042199
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-08-15
Filing Date
2025-08-15
Publication Date
2026-02-19

AI Technical Summary

Technical Problem

Current purification methods for adenovirus (AdV) are inadequate for large-scale production, struggling to achieve high purity and yield while effectively reducing host cell proteins (HCPs) and host cell DNA (hcDNA), and existing affinity ligands require harsh elution conditions, limiting the safety and availability of AdV-based therapies.

Method used

Development of peptide ligands that target the hexons of adenovirus serotype 5, which are conjugated to solid supports, enabling efficient binding and elution at mild pH conditions, achieving high binding capacity and significant reductions in HCPs and hcDNA.

Benefits of technology

The peptide ligands provide a high binding capacity of at least 10^9 viral particles per mL of resin, with yields exceeding 50% and up to 100-fold reductions in HCPs and 60-fold reductions in hcDNA, suitable for large-scale adenovirus manufacturing.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000016_0001
    Figure IMGF000016_0001
  • Figure IMGF000017_0001
    Figure IMGF000017_0001
  • Figure IMGF000034_0001
    Figure IMGF000034_0001
Patent Text Reader

Abstract

The present disclosure provides materials and methods related to the purification of viral vectors. In particular, the present disclosure provides peptides, compositions, adsorbents, and related methods, capable of removing process-related impurities (e.g., host cell proteins, nucleic acids, and media components) and product-related impurities (e.g., product fragments, product aggregates, and inactive forms derived from product degradation by or association with other species in the cell culture harvest) from samples during the production and purification of adenovirus.
Need to check novelty before this filing date? Find Prior Art

Description

NCSU-2024-218-02NCSU-43528.601COMPOSITIONS AND METHODS FOR PURIFYING ADENOVIRUSFIELD

[0001] The present disclosure provides materials and methods related to the purification of viral vectors. In particular, the present disclosure provides peptide ligands, compositions, adsorbents, and related methods, capable of removing process-related impurities and product- related impurities from samples during the production and purification of adenovirus.CROSS REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of U.S. Provisional Application No. 63 / 683,560, filed August 1 , 2024, the content of which is herein incorporated by reference in its entirety.SEQUENCE LISTING STATEMENT

[0003] The content of the electronic sequence listing titled NCSU_43528_601_SequenceListing.xml (Size: 33,972 bytes; and Date of Creation: August 11, 2025) is herein incorporated by reference in its entirety.STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0004] This invention was made with government support under R01 FD007481 awarded by the U.S. Food and Drug Administration, and CBET1653590 and CBET1743404 awarded by the National Science Foundation. The government has certain rights in the invention.BACKGROUND

[0005] Adenovirus (AdV), a virus historically associated with acute respiratory, ocular, and intestinal infections, is one of a set of engineered viral vectors utilized to deliver novel therapeutic options against genetic diseases and cancer as well as and vaccines against global pandemics. AdV accommodates a gene of interest that is larger than other vectors such as AAV and Lentivirus (e.g., a double-stranded DNA segment of up to 37 kb), and its many serotypes, more than 60 human AdVs are known to date, can rapidly infect various human cells, achieving high transfection efficiency and transgene expression. The combination of efficient transduction, inherent immunogenicity of the capsid, and facile engineering of the encapsidated transgene have led toNCSU-2024-218-02NCSU-43528.601AdVs becoming a vector of choice in oncolytic and prophylactic applications. Its use as vaccines has been popularized by the adoption of AdV serotype 26 as mRNA vectors to curb the Sars-CoV- 2 pandemic. Furthermore, in 2022 FDA approved Adstiladrin as the first adenoviral-based gene therapy forbladder cancer (high-risk Bacillus Calmette-Guerin unresponsive non-muscle invasive bladder cancer).

[0006] AdV administrations typically entail high dosages, ranging from 1012and 1013vp per patient. Additionally, the purity guidelines recommend less than 100 ng of host cell proteins (HCPs) and less than 10 ng of host cell DNA (hcDNA) per treatment. When considered in combination with the low product titer (< 1011vp per mL of cell lysate) and the abundance of HCPs and nucleic acid contaminants in cell lysates, these requirements pose major challenges to AdV isolation. Furthermore, having secured their place in the arena of therapeutic vectors long after adeno-associated viruses and lentiviruses (AAVs and LVVs), AdVs do not yet benefit from a mature purification technology.

[0007] Current purification methods include cesium chloride density gradient ultracentrifugation, which delivers high purity and yield above 50% but is not suitable to large- scale industrial productions; and ion-exchange chromatography, typically articulated in a cation exchange step for product capture followed by anion exchange for polishing, which is a scalable technology and delivers yields of up to 80%, but struggles to clear HCPs and hcDNA. The design of AdV-targeting affinity ligands has been inspired by those introduced a decade ago for AAVs. Like AAVs, AdVs feature an icosahedral capsid, formed mostly by hex on proteins (60% of the virus’s surface), while the fiber proteins and their penton bases determine tissue tropism and cell entry. Accordingly, a camelid antibody fragment ligand was introduced to target the hexons of Adenovirus serotype 5, now commercialized as POROS™ CaptureSelect™ AdV5 affinity matrix, for the purification of free hexons and viral particles. While providing high binding capacity (-1011vp per mL resin) and yield ranging between 11 and 55%, CaptureSelect™ AdV5 is expensive and mandates product elution at pH < 3.0. Harsh elution conditions are common among antibody- derived ligands and have been reported for similar binders targeting AdV and AAVs. Thus, the lack of an AdV-dedicated purification platform limits the availability, quality, and safety of these products.NCSU-2024-218-02NCSU-43528.601SUMMARY

[0008] Embodiments of the present disclosure include peptides for purifying adenovirus from a sample. In some embodiments, the peptides include an amino acid sequence having at least 80% sequence identity with one of SEQ ID NOs: 1-25. In some embodiments, the peptides include an amino acid sequence having one of SEQ ID NOs: 1-25. In some embodiments, the peptides include an amino acid sequence having one of SEQ ID NOs: 1-5.

[0009] In some embodiments, the peptides include an amino acid sequence having 1, 2, 3, 4, or 5 substitutions as compared with one of SEQ ID NOs: 1-25. In some embodiments, the peptide includes an amino acid sequence having 1, 2, 3, 4, or 5 substitutions as compared with one of SEQ ID NOs: 1-5.

[0010] In some embodiments, the peptides further have a linker. In some embodiments, the linker is bound to the C-terminus of the peptide, and wherein the linker comprises alanine, glycine, or serine.[OH] Embodiments of the present disclosure also include compositions for purifying an adenovirus from a sample (e.g., a cell lysate) using at least one peptide as described herein. In some embodiments, the at least one peptide is bound to a solid support. In some embodiments, the solid support comprises a non-porous or porous particle, a membrane, a plastic surface, a fiber or a woven or non-woven fibermat, a hydrogel, a microplate, a monolith, and / or a microfluidic device. In some embodiments, the solid support comprises polymethacrylate, polyacrylamide, polyolefin, polyester (e g., polystyrene, polystyrene-divinylbenzene), polyether (e.g., polyvinyl ether, polyethersulfone), polysaccharide (e.g., agarose, cellulose, dextran), silica, iron oxide, silica, titania, agarose, and / or zirconia.

[0012] Embodiments of the present disclosure also include an adsorbent comprising at least one peptide or a composition as described herein.

[0013] In some embodiments, the adsorbent has a binding capacity of at least 109viral particles per m of adsorbent (vp / mL). In some embodiments, the adsorbent has a binding capacity of at least 1010vp / mL.

[0014] In some embodiments, the adsorbent has a binding capacity of at least 109encapsi dated transgenes per mL of adsorbent (vg / mL). In some embodiments, the adsorbent has a binding capacity of at least 1010vg / mL. In some embodiments, the adsorbent has a binding capacity of at least about 1010cell-transducing units per mL of adsorbent (TU / mL).NCSU-2024-218-02NCSU-43528.601

[0015] Embodiments of the present disclosure also include methods for purifying an adenovirus from a sample. In some embodiments, the methods comprise contacting at least one peptide, a composition, or an adsorbent as disclosed herein with a sample comprising the adenovirus, wherein the at least one peptide binds the adenovirus; and eluting the adenovirus from the at least one peptide.

[0016] In some embodiments, the sample is a biological fluid. In some embodiments, the biological fluid is a cell culture fluid. In some embodiments, the biological fluid comprises a supernatant and / or a cellular lysate. In some embodiments, the biological fluid is derived from a virus production cell line. In some embodiments, the virus production cell line comprises one or more of MDCK-S cells, MDCK-A cells, Vero cells, LLC-MK2D cells, PER.C6 cells, EB66 cells, AGE1.CR cells, HT1080 cells, and HeLa cells, or any derivatives or variants thereof. In some embodiments, the virus production cell line is a HEK293 cell or a Vero cell.

[0017] In some embodiments, the elution is performed at pH from about 5.0 to about 9.0. In some embodiments, the elution is performed at pH of about 8.0.

[0018] In some embodiments, the methods further comprise a washing step before eluting the adenovirus.

[0019] In some embodiments, the methods produce at least a 50-fold reduction in host cell proteins as compared to the sample. In some embodiments, the methods produce at least a 100- fold reduction in host cell proteins as compared to the sample. In some embodiments, the methods produce at least a 7-fold reduction in host cell DNA as compared to the sample. In some embodiments, the methods produce at least a 60-fold reduction in host cell DNA as compared to the sample.

[0020] In some embodiments, the methods result in at least a 20% yield for encapsidated transgene. In some embodiments, the methods result in at least a 35% yield for encapsidated transgene. In some embodiments, the method results in at least a 30% yield for cell-transducing units. In some embodiments, the method results in at least a 40% yield for cell-transducing units.

[0021] In some embodiments, the adenovirus is of serotype 5 (AdV5).BRIEF DESCRIPTION OF THE DRAWINGS

[0022] FIGS. 1A-1H: Process of identification of Ad V5 -targeting peptide ligands: (A) the screening feedstock formulated with AF594-AdV5 at the titer of 1010vp / mL and AF488-NCSU-2024-218-02NCSU-43528.601HEK293 / Vero HCPs at the titer of 0.3 mg / mL is (B) incubated with a library of 8-mer peptide- ChemMatrix beads; (C) the library beads are individually fed to the micro-fluidic bead sorting device; (D) the beads displaying a strong red-only fluorescence are retained and (E) exposed to a flow of elution buffer; (F) the beads that show either no, green-only, or red-and-green fluorescence or do not lose their red fluorescence upon exposure to the elution buffer are discarded, while (G) those that lose their red fluorescence are selected; (H) the selected beads are stripped of all bound biomolecules and analyzed via Edman degradation for (I) sequencing the peptide carried thereon.

[0023] FIGS. 2A-2J: Complexes formed by in silico-designed peptides (FIG. 2A) ASQSVTND (SEQ ID NO: 9), (FIG. 2B) DYKDDDDKDIVMT (SEQ ID NO: 18), (FIG. 2C) IWRGGTTDYNAKFQ (SEQ ID NO: 13), (FIG. 2D) QGSNFPGDYSSPLT (SEQ ID NO: 1), (FIG. 2E) SLGRYGPWRG (SEQ ID NO: 10), (FIG. 2F) TNDGPDYSSPLT (SEQ ID NO: 2), (FIG 2G) VTNDGPGDY (SEQ ID NO: 14), and (FIG. 2H) YGVHPGIWRGGTTD (SEQ ID NO: 6) and peptides discovered via library screening (FIG. 21) AEFFIWNA (SEQ ID NO: 3), and (FIG. 2J) FWKWSFWE (SEQ ID NO: 4) with the AdV5 hexon (PDB: 5LDN and 5OGI) obtained via molecular docking and dynamics simulations at pH 7.4. The peptides docked on site 1, site 2, and site 3 (Table 1) are in green, blue, and red cartoon respectively. The AdV5 hexon-targeting monoclonal antibodies TRIM21 and 9C12 are presented as light green and light blue cartoons, respectively. The AdV5 hexon cluster is presented in wheat and grey cartoon.

[0024] FIGS. 3A and 3B: Values of AdV5 yield and logic reduction of host cell proteins (HCP LRV) obtained by loading HEK293 cell lysate on Toyopearl resins functionalized with peptides identified via (FIG. 3A) combinatorial selection or (FIG. 3B) in silico design, and the reference CaptureSelect™ AdV5 resin to a ratio of ~1O10encapsidated transgenes per mL of resin. The detailed binding and elution conditions are listed in Table 6. The values of virus titer were measured via qPCR utilizing primers designed for the eGFP transgene, while the values of HCP titer were measured via HEK293 HCP ELISA. FIG. 3A: HHFAAFAW (SEQ ID NO: 25); WWAWFAFK (SEQ ID NO: 24); FFIANWFN (SEQ ID NO: 23); WFFSNHWE (SEQ ID NO: 22); AIHFINWW (SEQ ID NO: 21); WHANFIHW (SEQ ID NO: 20); KHWWIANH (SEQ ID NO: 19); IWWINIAN (SEQ ID NO: 16); FSKWIFNE (SEQ ID NO: 17); HIHKKFHE (SEQ ID NO: 15); SFWFHKFA (SEQ ID NO: 7); AEHFINWW (SEQ ID NO: 12); FHKHSHFE (SEQ ID NO: 11); INWWAWEH (SEQ ID NO: 8); HAHKKWFN (SEQ ID NO: 5); FWKWSFWE (SEQ ID NO: 4); AEFFIWNA (SEQ ID NO: 3). FIG 3B: DYKDDDDKDIVMTGG (SEQ ID NO: 37);NCSU-2024-218-02NCSU-43528.601VTNDGPGDYGSG (SEQ ID NO: 32); IWRGGTTDYNAKFQGSG (SEQ ID NO: 30); SLGRYGPWRGGSG (SEQ ID NO: 31); ASQSVTNDAA (SEQ ID NO: 29); YGVHPGIWRGGTTDGSG (SEQ ID NO: 33); TNDGPDYSSPLTGSG (SEQ ID NO: 26); QGSNFPGDYSSPLTG (SEQ ID NO: 38).

[0025] FIGS. 4A and 4B: SDS-PAGE (non-reducing conditions (FIG. 4A); Lane 1: molecular weight marker; lane 2: Load; lane 3: 1st flow-through fraction (5 CVs); lane 4: 2nd flow-through fraction (5 CVs): lane 5: 1st wash fraction (5 CVs); lane 6: 2nd wash fraction (15 CVs); lane 7: 1st elution fraction (5 CVs); lane 8: 2nd elution fraction (5 CVs); and lane 9: 3rd elution fraction (10 CVs)) and (FIG. 4B) SEC-HPLC analyses of the clarified HEK293 cell lysate and the resulting flow-through and elution fractions generated by purifying AdV5 using AEFFIWNA (SEQ ID NO: 3)-functionalized resin.

[0026] FIG. 5: Breakthrough curves of AdV5 obtained by loading a clarified HEK293 cell lysate on adsorbents AEFFIWNA (SEQ ID NO: 3)-Toyopearl, TNDGPDYSSPLTGSG (SEQ ID NO: 26)-Toy opearl, and Thermo AdV5-POROS resins at residence time (RT) of 3.5 min.

[0027] FIGS. 6A-6C: SPR sensorgrams obtained by contacting solutions of either AdV5 hexon protein at different titer in PBS buffer at pH 7.4 with (FIG. 6A) AEFFIWNA (SEQ ID NO: 3)- functionalized and (FIG. 6B) TNDGPDYSSPLTGSG (SEQ ID NO: 26)-functionalized sensors; or (FIG. 6C) a clarified HEK293 lysate at the HCP titer of 0.02 mg / mL with AEFFIWNA (SEQ ID NO: 3)- or TNDGPDYSSPLTGSG (SEQ ID NO: 26)-functionalized sensors or sensors coated with hydroxyl-terminated SAM.

[0028] FIG. 7 : Bulk effect of hexon binding, SPR curves of hexon with an hydroxyl-terminated SAM.

[0029] FIG. 8: Performance of AdV5 purification from clarified HEK293 and Vero cell lysates (AdV5 titer ~109vg / mL; HCP titer -0.08 - 0.35 mg / mL) using AEFFIWNA (SEQ ID NO: 3)- Toyopearl and TNDGPDYSSPLTGSG (SEQ ID NO: 26)-Toyopearl resins. The values of AdV5 yield were measured via RT-qPCR (encapsidated transgenes) and TCID50 assays (celltransducing units); the reduction of HCPs and hcDNA were measured by analyzing the eluates and corresponding feedstocks using ELISA and PicoGreen dsDNA assay kits.

[0030] FIGS. 9A and 9B: Dependence of yield of AdV5 purified from a clarified HEK293 cell lysate (AdV5 titer -109vg / mL; HCP titer -0.15 mg / mL) using AEFFIWNA (SEQ ID NO: 3)- Toy opearl and TNDGPDYSSPLTGSG (SEQ ID NO: 26)-Toy opearl resins upon the (FIG. 9A)NCSU-2024-218-02NCSU-43528.601 pH and (FIG. 9B) NaCl concentration of the elution buffer. The values of AdV5 yield were measured via RT-qPCR (encapsidated transgenes) analysis of the eluates and corresponding feedstocks.

[0031] FIG. 10: Performance of AdV5 purification from a clarified HEK293 cell lysate (AdV5 titer -109vg / mL; HCP titer -0.15 mg / mL) using peptide ligands AEFFIWNA (SEQ ID NO: 3) and TNDGPDYSSPLTGSG (SEQ ID NO: 26) conjugated to Poros, Toyopearl, or SulfoLink resins. The values of AdV5 yield were measured via RT-qPCR (encapsidated transgenes) and TCID50 assays (cell -transducing units); the reduction of HCPs and hcDNA were measured by analyzing the eluates and corresponding feedstocks using ELISA and PicoGreen dsDNA assay kits.

[0032] FIGS. 11 A and 1 IB: SDS-PAGE (non-reducing conditions, FIG. 11 A) analysis of the chromatographic fractions produced by purifying AdV5 from a clarified HEK293 cell lysate (AdV5 titer -9 ■ 109vg / mL; HCP titer -0.15 mg / mL) using AEFFIWNA (SEQ ID NO: 3)-Sulfolink resin; lane 1 : molecular weight marker; lane 2: feedstock; lane 3: flow-through (5 CVs); lane 4: 1stwash step at 2% elution buffer mixing with loading buffer (5 CVs); lane 5: 2ndwash step at 4% elution buffer mixing with loading buffer (5 CVs); lane 6: 3rdwash step at 6% elution buffer mixing with loading buffer (5 CVs); lane 7: 4thwash step at 8% elution buffer mixing with loading buffer (5 CVs); lane 8: 5thwash step at 10% elution buffer mixing with loading buffer (5 CVs); lane 9: 6thwash step at 12% elution buffer mixing with loading buffer (5 CVs); lane 10: elution (10 CVs); (FIG. 1 IB) values of AdV5 recovery in the wash fractions and in the eluate measured via RT qPCR (encapsidated transgenes).

[0033] FIGS. 12A and 12B: Breakthrough curves of AdV5 encapsidated transgenes obtained by loading clarified HEK293 cell lysates at normal or low AdV5 titers (Table 3) on AEFFIWNA (SEQ ID NO: 3)- and TNDGPDYSSPLTGSG (SEQ ID NO: 26)-Toyopearl resins loaded with a clarified HEK293 cell lysates at different loads and at the RT of either 2 or 3.5 min. The solid lines are included to facilitate visual comparison across the datasets.

[0034] FIGS. 13A-13D: Optimization of AdV5 purification process using AEFFIWNA (SEQ ID NO: 3)-SulfoLink resins loaded with either 10 CVs of low AdV5 titer (-5 - 109vg / mL) or 5 CVs of high AdV5 titer (-2- 1010vg / mL) clarified HEK293 cell lysate at the RT of either 2 or 3.5 min, and washed in two steps prior to elution (FIG. 13 A). The values of AdV5 yield were measured via RT-qPCR (encapsidated transgenes) and TCID50 assays (cell-transducing units); the reduction ofNCSU-2024-218-02NCSU-43528.601HCPs and hcDNA were measured by analyzing the eluates and corresponding feedstocks using ELISA and PicoGreen dsDNA assay kits. (FIG. 13B) SDS-PAGE (non-reducing conditions) analysis of the chromatographic fractions produced by purifying AdV5 from a clarified HEK293 cell lysate using AEFFIWNA (SEQ ID NO: 3)-SulfoLink resin; lane 1 : molecular weight marker; lane 2: feedstock; lane 3 : flow-through (5 CVs); lane 4: 1stwash step at 0.15 M NaCl (PBS, 5 CVs); lane 5: 2ndwash step at 0.25 M NaCl (5 CVs); lane 6: elution (5 CVs). SEC-HPLC analysis of the clarified HEK293 cell lysate and the flow-through, wash and elution fractions obtained by purifying AdV5 using AEFFIWNA (SEQ ID NO: 3)-SulfoLink resin and analyzed using (FIG. 13C) a BioResolve SEC mAb HPLC column (200A, 2.5 pm, 4.6 x 300 mm) and (FIG. 13D) a Bio SEC-5 HPLC column (2000 A, 5 pm, 4.6 x 300 mm).

[0035] FIGS. 14A-14C: AdV purification process comprising lysis of HEK293F cells, clarification via microfiltration, affinity-based capture using AEFFIWNA (SEQ ID NO: 3)- functionalized resins in bind-and-elute mode (FIG. 14A), polishing with Capto Core 700 resin in flow-through mode. Performance of 10 cycles of AdV5 purification from a clarified HEK293 cell lysate (AdV5 titer ~2 109vg / mL; HCP titer -0.15 mg / mL) using (FIG. 14B) AEFFIWNA (SEQ ID NO: 3)-Toyopearl and (FIG. 14C) AEFFIWNA (SEQ ID NO: 3)-SulfoLink resins with intermediate CIP using 10% v / v phosphoric acid. The values of AdV5 yield were measured via RT-qPCR (encapsidated transgenes).

[0036] FIGS. 15A and 15B: TCID50 control well (FIG. 15A); cells displaying cytopathic effects after transfection by AdV5 purified from a clarified HEK293 cell lysate using AEFFIWNA (SEQ ID NO: 3)-Toy opearl® resin (FIG. 15B).

[0037] FIGS. 16A and 16B: Breakthrough curves of AdV5 encapsidated transgenes obtained by loading clarified HEK293 cell lysate (AdV5 titer -6.3 - 108or -1.0- 1010vg / mL; HCP titer -0.15 mg / mL) on AEFFIWNA (SEQ ID NO: 3)-SulfoLink™ resin loaded at the RT of 3.5 min (FIG. 16 A) or 2 min (FIG. 16B).

[0038] FIGS. 17A-17F: Chromatograms of AdV5 purification from a clarified HEK293 cell lysate (AdV5 titer -109vg / mL; HCP titer -0.15 mg / mL) using (FIG. 17A) AEFFIWNA (SEQ ID NO: 3)-Toyopearl® resin, (FIG. 17B) AEFFIWNA (SEQ ID NO: 3)-Poros™ resin, (FIG. 17C) AEFFIWNA (SEQ ID NO: 3)-SulfoLink™ resin, (FIG. 17D) TNDGPDYSSPLTGSG (SEQ ID NO: 26)-Toyopearl® resin, (FIG. 17E) TNDGPDYSSPLTGSG (SEQ ID NO: 26)-Poros™ resin, and (FIG. 17F) TNDGPDYSSPLTGSG (SEQ ID NO: 26)-SulfoLink™ resin.NCSU-2024-218-02NCSU-43528.601

[0039] FIGS. 18A-18E: Chromatograms of AdV5 purification using AEFFIWNA (SEQ ID NO: 3)- SulfoLink™ resin loaded with 10 CVs of low AdV5 titer (-5 109vg / mL) at the RT of (FIG. 18A) 3.5 min or (FIG. 18B) 2 min. Chromatograms of AdV5 purification using AEFFIWNA (SEQ ID NO: 3)-SulfoLink1Mresin loaded with 5 CVs of high AdV5 titer (-2 1O10vg / mL) clarified HEK293 cell lysate and eluted with (FIG. 18C) 10 CVs or (FIG. 18D) 5 CVs. (FIG. 18E) Chromatogram of AdV5 purification using AEFFIWNA (SEQ ID NO: 3)-SulfoLink™ resin loaded with 5 CVs of high AdV5 titer (-2TO10vg / mL) clarified HEK293 cell lysate, exposed to two wash steps, and eluted with 5 CVs.

[0040] FIG. 19: Performance of 10 cycles of AdV5 purification from a clarified HEK293 cell lysate (AdV5 titer -2.0 108vg / mL; HCP titer -0.15 mg / mL) using TNDGPDYSSPLTGSG (SEQ ID NO: 26)-Toy opearl® resin with intermediate CIP using 10% v / v phosphoric acid. The values of AdV5 yield were measured via RT-qPCR (encapsidated transgenes); the reduction of HCPs was measured by analyzing the eluates and corresponding feedstocks using ELISA kits.

[0041] FIGS. 20A-20F: Chromatogram of (FIG. 20A) five cycles of AdV5 purification from a clarified HEK293 cell lysate (AdV5 titer ~2 109vg / mL; HCP titer -0.15 mg / mL) using AEFFIWNA (SEQ ID NO: 3)-Toyopearl® resin and (FIG. 20B) five cycles of blank loading on AEFFIWNA (SEQ ID NO: 3)-Toyopearl® resin. Chromatogram of (FIG. 20C) five cycles of AdV5 purification from a clarified HEK293 cell lysate (AdV5 titer -2- 109vg / mL; HCP titer -0.15 mg / mL) using AEFFIWNA (SEQ ID NO: 3)-SulfoLink™ resin and (FIG. 20D) five cycles of blank loading on AEFFIWNA (SEQ ID NO: 3)-SulfoLink™ resin. Chromatogram of (FIG. 20E) five cycles of AdV5 purification from a clarified HEK293 cell lysate (AdV5 titer -2- 109vg / mL; HCP titer -0.15 mg / mL) using TNDGPDYSSPLTGSG (SEQ ID NO: 26)-Toyopearl® resin and (FIG. 20F) five cycles of blank loading on TNDGPDYSSPLTGSG (SEQ ID NO: 26)-Toyopearl® resin.DETAILED DESCRIPTION

[0042] Adenovirus (AdVs) is the viral vector of choice in vaccines and oncolytic applications owing to its high transduction efficiency and inherent immunogenicity. High dosages and stringent purity requirements, combined with the complexity and low product titer (< 1011vp per mL) of recombinant feedstocks, make AdV purification challenging. As for many viruses, AdV isolation has relied for decades on ultracentrifugation and ion-exchange chromatography, which are notNCSU-2024-218-02NCSU-43528.601 suitable to large-scale production and struggle to deliver sufficient purity. Recently, affinity chromatographic resins have become available, which afford higher productivity and purity, but mandate harsh elution conditions (pH 3.0) and afford low yield (< 20%). These issues stem from the use of antibody-derived ligands, whose high binding strength, while promoting selective capture, limits product release and can compromise its safety.

[0043] Seeking a more efficient and affordable alternative, this study introduces the first peptide affinity ligands for AdV purification. The peptides were identified via combinatorial selection and in silica design to target hexons, the most abundant proteins in the adenoviral capsid. The bespoke hexon-binding activity of the ligands, confirmed by surface plasmon resonance, ensures high binding capacity (> IO10vp per mL of resin) and provides high yield (>50%) and up to 100-fold reduction of host cell proteins and DNA. The selected ligands proved effective in purifying AdV serotype 5 from HEK293 and Vero cell lysates, demonstrating strong promise for large-scale adenovirus manufacturing.1. Definitions

[0044] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In case of conflict, the present document, including definitions, will control. Preferred methods and materials are described below, although methods and materials similar or equivalent to those described herein can be used in practice or testing of the present disclosure. The phrase “in one embodiment” as used herein does not necessarily refer to the same embodiment, though it may. Furthermore, the phrase “in another embodiment” as used herein does not necessarily refer to a different embodiment, although it may. Thus, as described below, various embodiments of the invention may be readily combined, without departing from the scope or spirit of the invention. All publications, patent applications, patents and other references mentioned herein are incorporated by reference in their entirety. The materials, methods, and examples disclosed herein are illustrative only and not intended to be limiting.

[0045] The terms “comprise(s),” “include(s),” “having,” “has,” “can,” “contain(s),” and variants thereof, as used herein, are intended to be open-ended transitional phrases, terms, or words that do not preclude the possibility of additional acts or structures. The singular forms “a,” “and” and “the” include plural references unless the context clearly dictates otherwise. The presentNCSU-2024-218-02NCSU-43528.601 disclosure also contemplates other embodiments “comprising,” “consisting of’ and “consisting essentially of,” the embodiments or elements presented herein, whether explicitly set forth or not. [0461 For the recitation of numeric ranges herein, each intervening number therebetween with the same degree of precision is explicitly contemplated. For example, for the range of 6-9, the numbers 7 and 8 are contemplated in addition to 6 and 9, and for the range 6.0-7.0, the number 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are explicitly contemplated.

[0047] Correlated to” as used herein refers to compared to.

[0048] As used herein, “peptide” and “polypeptide,” unless otherwise specified, generally refer to polymer compounds of two or more amino acids joined through the main chain by peptide amide bonds (— C(0)NH— ). The term “peptide” typically refers to short amino acid polymers (e.g., chains having fewer than 25 amino acids), whereas the term “polypeptide” typically refers to longer amino acid polymers (e.g., chains having more than 25 amino acids).

[0049] As used herein, “sequence identity” generally refers to the degree two polymer sequences (e.g., peptide, polypeptide, nucleic acid, etc.) have the same sequential composition of monomer subunits. The “percent sequence identity” (or “percent sequence similarity”) is calculated by: (1) comparing two optimally aligned sequences over a window of comparison (e.g., the length of the longer sequence, the length of the shorter sequence, a specified window), (2) determining the number of positions containing identical (or similar) monomers (e.g., same amino acids occurs in both sequences, similar amino acid occurs in both sequences) to yield the number of matched positions, (3) dividing the number of matched positions by the total number of positions in the comparison window (e.g., the length of the longer sequence, the length of the shorter sequence, a specified window), and (4) multiplying the result by 100 to yield the percent sequence identity or percent sequence similarity. For example, if peptides A and B are both 20 amino acids in length and have identical amino acids at all but 1 position, then peptide A and peptide B have 95% sequence identity. If the amino acids at the non-identical position shared the same biophysical characteristics (e.g., both were acidic), then peptide A and peptide B would have 100% sequence similarity. As another example, if peptide C is 20 amino acids in length and peptide D is 15 amino acids in length, and 14 out of 15 amino acids in peptide D are identical to those of a portion of peptide C, then peptides C and D have 70% sequence identity, but peptide D has 93.3% sequence identity to an optimal comparison window of peptide C. For the purpose of calculatingNCSU-2024-218-02NCSU-43528.601“percent sequence identity” (or “percent sequence similarity”) herein, any gaps in aligned sequences are treated as mismatches at that position.[0501 The term “sequence similarity” refers to the degree with which two polymer sequences (e.g., peptide, polypeptide, nucleic acid, etc.) have similar polymer sequences. For example, similar amino acids are those that share the same biophysical characteristics and can be grouped into the families, e.g., acidic (e.g., aspartate (Asp, D), glutamate (Glu, E)); basic (e.g., lysine (Lys, K), arginine (Arg, R), histidine (His, H)); non-polar (e.g., alanine (Ala, A), valine (Vai, V), leucine (Leu, L), isoleucine (He, I), proline (Pro, P), phenylalanine (Phe, F), methionine (Met, M), tryptophan (Trp, W)); uncharged polar (e.g., glycine (Gly, G), asparagine (Asn, N), glutamine (Gin, Q), cysteine (Cys, C), serine (Ser, S), threonine (Thr, T), tyrosine (Tyr, Y)); aliphatic (e.g., alanine (Ala, A), valine (Vai, V), leucine (Leu, L), isoleucine (He, I), glycine (Gly, G), and in some cases, methionine (Met, M)); and aromatic (histidine (H or His), phenylalanine (F or Phe), tyrosine (Y or Tyr), and tryptophan (W or Trp)).

[0051] As used herein, the term “purified” or “to purify” refers to the removal of components (e.g., contaminants) from a sample. For example, viruses are purified by removal of contaminating process-related impurities and product-related impurities. Process-related impurities comprise proteins and nucleic acids produced by the host that expresses the virus; they also comprise viruses other than the target virus. Product-related impurities comprise fragments of the target virus; they also comprise viral genomes or transgenes that are not encapsidated or are incorrectly encapsidated; they also comprise aggregates of the target virus and other proteins and nucleic acids. The removal of these contaminants results in an increase in the percentage of active viruses in the sample.

[0052] As used herein, the term “sample” refers to any composition or feedstock that contains a target biologic. Samples may be derived from biological or other sources. Biological sources include eukaryotic and prokaryotic sources, such as bacterial, fungal, plant and animal cells, and human tissues and organs. The sample may also include diluents, buffers, detergents, and contaminating species, debris and the like that are found mixed with the target biologic. The sample may be “partially purified” (e.g., having been subjected to one or more purification steps, such as filtration steps) or may be obtained directly from a host cell or organism producing the target molecule (e.g., the sample may comprise harvested cell culture fluid).NCSU-2024-218-02NCSU-43528.601

[0053] As used herein, the term “target” or “target biologic” generally refers to a target protein, peptide, polypeptide, nucleic acid, ribonucleoprotein complex, nucleic acid construct, supramolecular construct, virus, viral construct, viral capsid, viral capsomer, virus-like particle, cell, organelle, small molecule, and any combinations thereof, which may be present in a sample (e.g., biological fluid) comprising one or more process-related impurities and / or product-related impurities. In some embodiments, the target or target biologic is a viral vector (e.g., adenovirus) or a virus-like particle.

[0054] As used herein, the term “host cell” refers to any cell line utilized to produce the target biologic.

[0055] As used herein, the term “host cell protein” or “HCP” refers to any protein produced or encoded by the host cell and unrelated to the intended target biologic. HCPs are generally undesirable in the final drug substance.

[0056] As used herein, the term “host cell DNA” refers to any nucleic acid produced by the host cell and unrelated to the target biologic. Host cell DNA is generally undesirable in the final drug substance.

[0057] As used herein, the term “plasmid DNA” or “pDNA” refers to any nucleic acid utilized to transfect the host cell for producing the target biologic. pDNA is generally undesirable in the final drug substance.

[0058] As used herein, the term “virion” or “viral particle” refers to the complete form of the virus, comprising a capsid and an encapsidated transgene.

[0059] As used herein, the term “capsid” refers to the protein shell surrounding the encapsidated transgene.

[0060] As used herein, the term “encapsidated transgene” refers to any DNA sequence that encodes for one or multiple proteins and is contained within the capsid.

[0061] As used herein, a “feedstock” comprises a target biologic of interest (for which purification is desired) and one or more contaminant or impurity. In some embodiments, the feedstock is produced from a host cell or organism that expresses the target biologic (either naturally or recombinantly). Such feedstock includes, for example, cell cultures, cell lysates, and clarified bulk (e.g., clarified cell culture supernatant). For example, and as described further herein, the peptide ligands of the present disclosure can be used to purify adenoviruses from a sample or feedstock containing the adenoviruses. In some embodiments, the level or degree of purificationNCSU-2024-218-02NCSU-43528.601 of the adenovirus from the feedstock can be measured or quantified. For example, as would be understood by one of ordinary skill in the art, the level or degree of purification can be measured with respect to the fold reduction of host cell proteins from the eluate as compared to the feedstock after the feedstock is subject to purification using the peptide ligands of the present disclosure. In some embodiments, “X-fold reduction” can be expressed as the ratio (e.g., titer) of HCP to adenovirus in the eluate being “X” times smaller than the corresponding ratio in the feedstock. The “X-fold reduction” is the measure of purification produced by the peptide ligand(s) of the present disclosure.

[0062] As used herein, the term “adsorbent” or “adsorbents” generally refers to materials used to selectively purify a substance from a sample via surface attachment. As described further herein, “adsorbent” or “adsorbents” generally include one or more types of support to which one or more of the peptide ligands of the present disclosure can be conjugated. In some embodiments, the adsorbent comprises one or more types of peptide ligands of the present disclosure bound to one or more types of support and is contained within a composition. In other embodiment, one or more types of peptide ligands of the present disclosure are contained within a composition that does not include an adsorbent. In some embodiments, the composition or adsorbent may comprise one or more different types of peptides, each conjugated to the single type of support made from the single type of support material. In other embodiments, the composition or adsorbent comprises a plurality of types of support. Each type of support may be made of the same type of support material or different types of support materials. In these embodiments, the composition or adsorbent may comprise one or more different types of peptides, as described further herein, each conjugated to a different type of support. In still other embodiments, the peptides of the composition can be conjugated to a soluble compound, for example stimuli-responsive polymer chains to remove adenoviruses by affinity precipitation.2. Peptides and Compositions for Purifying Adenovirus a. Peptides

[0063] In seeking robust affinity ligands for adenovirus purification, experimental and in silica methods were used to develop a selection of peptides utilizing two steps: the primary selection focused on identifying peptides with high affinity and selectivity in binding conditions, while a secondary selection isolated the peptide binders that release effectively under conditions prescribed to safeguard product’s stability. The resulting peptide ligands ensure high bindingNCSU-2024-218-02NCSU-43528.601 capacity and afford highly pure and bioactive products. The disclosed peptides may be used for the purification of any adenovirus.[0641 Insome embodiments, the disclosed peptides may be used to purify a target engineered or recombinant adenovirus. The target adenoviruses may belong to different serotypes, each with its corresponding cell or tissue tropism (See, for example, Havenga MJ, et al., J Virol. 2002 May;76(9):4612-20, incorporated herein by reference). In some embodiments, the adenovirus is of serotype 5 (AdV5).

[0065] The peptides may target any binding site found on the external (convex) surface of the adenovirus’ capsid. In some embodiments, the peptides bind to the hexon proteins. The capsid of adenoviruses comprises 20 faces, each formed by a mosaic of 36 hexons proteins, and 12 vertices, each comprising 2 penton proteins from which the fiber proteins extend. Hexons are the most abundant and conserved proteins among adenovirus serotypes.

[0066] In accordance with these embodiments, the present disclosure provides peptides having an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 95%) sequence identity with one of SEQ ID NOs: 1-25. In some embodiments, the peptide has an amino acid sequence having one of SEQ ID NOs: 1-25.

[0067] In accordance with these embodiments, the present disclosure provides peptides having an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 95%) sequence identity with one of SEQ ID NOs: 1-25. In some embodiments, the peptide has an amino acid sequence having one of SEQ ID NOs: 1-25, as provided below.NCSU-2024-218-02NCSU-43528.601

[0068] An amino acid “substitution” or “replacement” refers to the replacement of one amino acid at a given position or residue by another amino acid at the same position or residue within a polypeptide sequence. The amino acid replacement or substitution can be conservative, semiconservative, or non-conservative. The phrase “conservative amino acid substitution” or “conservative mutation” refers to the replacement of one amino acid by another amino acid with a common property (e.g., aromaticity, charge, polarity, etc.). A functional way to define common properties between individual amino acids is to analyze the normalized frequencies of amino acid changes between corresponding proteins of homologous organisms (Schulz and Schirmer, Principles of Protein Structure, Springer-Verlag, New York (1979)). According to such analyses, groups of amino acids may be defined where amino acids within a group exchange preferentially with each other and therefore resemble each other most in their impact on the overall protein structure (Schulz and Schirmer, supra). Examples of conservative amino acid substitutions include substitutions of amino acids with common properties, for example, lysine for arginine and vice versa such that a positive charge may be maintained, glutamic acid for aspartic acid and vice versa such that a negative charge may be maintained, serine for threonine such that a free -OH can be maintained, and glutamine for asparagine such that a free -NH2 can be maintained. “Semiconservative mutations” include amino acid substitutions of amino acids within the same broad group (e g., aliphatic), but not within the same sub-group (e.g., polar or non-polar). For example, the substitution of aspartic acid for asparagine, or asparagine for lysine. “Non-conservative mutations” involve amino acid substitutions between different groups, for example, lysine for tryptophan, or phenylalanine for serine, etc.NCSU-2024-218-02NCSU-43528.601

[0069] In some embodiments, the peptide has an amino acid sequence having 1, 2, 3, 4, or 5 substitutions as compared with the amino acid sequence of at least one of SEQ ID NOs: 1-25. In some embodiments, the peptide has an amino acid sequence having 1, 2, 3, 4, or 5 substitutions as compared with the amino acid sequence of at least one of SEQ ID NOs: 1-25. In some embodiments, the peptide has an amino acid having 1, 2, 3, 4, or 5 substitutions as compared with the amino acid sequence of at least one of SEQ ID NOs: 1-5.

[0070] The peptides may be any length that confers specificity for the target adenovirus. In some embodiments, the peptide is 5 to 20 amino acids in length. In some embodiments, the peptide is 5 to 10 amino acids in length. In some embodiments, the peptide is 5 to 15 amino acids in length. In some embodiments, the peptide is 8 to 10 amino acids in length. In some embodiments, the peptide is 8 to 15 amino acids in length. In some embodiments, the peptide is 8 to 20 amino acids in length. In some embodiments, the peptide is 10 to 15 amino acids in length. In some embodiments, the peptide is 10 to 20 amino acids in length. In some embodiments, the peptide is 12 to 20 amino acids in length. The peptide may be 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 amino acids in length. In certain embodiments, the peptide is 8 to 14 amino acids in length. In certain embodiments, the peptide is 8 amino acids in length.

[0071] As would be recognized by one of ordinary skill in the art based on the present disclosure, the peptides provided herein can be conjugated to a linker. In some embodiments, the linker can facilitate the display of a peptide onto a solid support, which allows for better capture of a target adenovirus. In other embodiments, the peptides provided herein are not conjugated to a linker but can still be bind to target adenoviruses and be purified from a cell culture fluid through other means. In some embodiments, the one or more peptides comprise a linker on the C-terminus of the peptide. The linking peptides may have virtually any amino acid sequence, bearing in mind that the preferred linkers will have a sequence that results in a generally flexible linkage. Small amino acids, such as glycine, alanine, and serine are generally used in creating a flexible linker. A variety of different linkers are commercially available and are considered suitable for use, including but not limited to, glycine-serine polymers, glycine-alanine polymers, and alanine-serine polymers. In certain embodiments, the linker one or more glycine residues. In select embodiments, the linker comprises Gly-Ser-Gly repeat. In certain embodiments, the linker includes GSG and GGG. In certain embodiments, the linker includes one or more alanine residues.NCSU-2024-218-02NCSU-43528.601 b. Compositions and Adsorbents

[0072] Also described herein are compositions and adsorbents comprising one or more of the disclosed peptides. In some embodiments, each peptide of the composition or adsorbent is conjugated to a support. Supports may comprise, but are not limited to, particles, beads, plastic surfaces, resins, fibers, and / or membranes. In some embodiments, the solid support comprises a non-porous or porous particle, a membrane, a plastic surface, a fiber or a woven or non-woven fibermat, a hydrogel, a microplate, a monolith, and / or a microfluidic device. In some embodiments, the solid support includes microparticles and / or nanoparticles. In some embodiments, the solid support comprises a hydrogel. In some embodiments, the solid support comprises a membrane.

[0073] In some embodiments, the solid support comprises polymethacrylate, polyolefin, polyester, polystyrene, polysaccharide, polyvinyl ether, iron oxide, silica, titania, agarose, and / or zirconia. Each support may be made of any suitable material including, but not limited to, synthetic or natural polymers, metals, and metal oxides. Some supports may be magnetic, such as a magnetic bead, microparticle and / or nanoparticle. Suitable synthetic polymers include, but are not limited to, polymethacrylate, poly sulfone, poly ethersulfone, polyvinyl ether, and polyethyleneglycol. Suitable natural polymers include, but are not limited to, cellulose, agarose, and chitosan. Suitable metal oxides include, but are not limited to, iron oxide, silica, titania, and zirconia.

[0074] In certain embodiments, the solid support comprises particles or beads. In some embodiments, the particles or beads have a diameter of about 50 pm, about 60 pm, about 70 pm, about 80 pm, about 90 pm, or about 100 pm. In select embodiments, the solid support comprises porous particles. In some embodiments, the porous particle comprises pores having pore diameters of at least about 50 nm, at least about 60 nm, at least about 70 nm, at least about 80 nm, at least about 90 nm, at least about 100 nm, or more. The ligand density on the solid support may vary. In some embodiments, the composition or adsorbent has a high ligand density (e.g., greater than 0.1 mmol / mL). In some embodiments, composition or adsorbent has a lower ligand density (e.g., less than 0.05 mmol / mL).

[0075] In some embodiments, the composition or adsorbent comprises a single type of support made from a single type of support material, where all the peptides are conjugated to supports formed of the single type of support material. In these embodiments, the composition or adsorbent may comprise one or more different types of peptides, each conjugated to the single type of support made from the single type of support material. In other embodiments, the composition or adsorbentNCSU-2024-218-02NCSU-43528.601 comprises a plurality of types of support. Each type of support may be made of the same type of support material or different types of support materials. In these embodiments, the composition or adsorbent may comprise one or more different types of peptides, as described further herein, each conjugated to a different type of support. In still other embodiments, the peptides of the composition can be conjugated to a soluble compound, for example stimuli-responsive polymer chains to remove adenoviruses by affinity precipitation.

[0076] In some embodiments, an adsorbent from the present disclosure exhibits a binding capacity for an adenovirus that is at least about 107viral particles per m of adsorbent (vp / mL). In some embodiments, an adsorbent from the present disclosure exhibits a binding capacity for an adenovirus that is at least about 108viral particles per mL of adsorbent (vp / mL). In some embodiments, an adsorbent from the present disclosure exhibits a binding capacity for an adenovirus that is at least about 109viral particles per mL of adsorbent (vp / mL). In some embodiments, an adsorbent from the present disclosure exhibits a binding capacity for an adenovirus that is at least about IO10viral particles per mL of adsorbent (vp / mL). In some embodiments, an adsorbent from the present disclosure exhibits a binding capacity for an adenovirus that is at least about 1011viral particles per mL of adsorbent (vp / mL).

[0077] In some embodiments, an adsorbent from the present disclosure exhibits a dynamic binding capacity, binding capacity at 10% breakthrough (DBCw%) that is at least about 108viral transgenes per mL of adsorbent (vg / mL). In some embodiments, an adsorbent from the present disclosure exhibits a DBCio% that is at least about 109vg / mL. In some embodiments, an adsorbent from the present disclosure exhibits a DBCio% that is at least about IO10vg / mL.

[0078] In select embodiments, an adsorbent from the present disclosure exhibits a binding capacity for an adenovirus that is about 108to IO10cell-transducing units per mL of adsorbent (TU / mL). In some embodiments, an adsorbent from the present disclosure exhibits a dynamic binding capacity, binding capacity at 10% breakthrough (DBCio%) that is at least about 108celltransducing units per mL of adsorbent (TU / mL). In some embodiments, an adsorbent from the present disclosure exhibits a dynamic binding capacity, binding capacity at 10% breakthrough (DBCio%) that is at least about 109cell-transducing units per mL of adsorbent (TU / mL). In some embodiments, an adsorbent from the present disclosure exhibits a dynamic binding capacity, binding capacity at 10% breakthrough (DBCio%) that is at least about 1010cell-transducing units per mL of adsorbent (TU / mL).NCSU-2024-218-02NCSU-43528.6013. Methods of Use

[0079] As described further herein, the present disclosure also provides methods for purifying an adenovirus from a sample. In some embodiments, the sample is a biological fluid. Thus, the present disclosure provides methods from purifying an adenovirus from one or more product- and / or process-related impurities or contaminants.

[0080] In some embodiments, the methods include contacting at least one peptide, a composition, or an adsorbent as described herein with a sample comprising the target adenovirus, wherein the at least one peptide ligand binds the target adenovirus. In accordance with these embodiments, the method includes eluting the target adenovirus from the at least one peptide, thereby purifying the target adenovirus. The methods of the present disclosure can further comprise washing the composition or adsorbent to remove one or more product- and / or process- related impurities or contaminants from the target adenoviruses bound to the peptide ligands. In some embodiments, the method can be performed under any binding conditions suitable for use with the peptides, composition or adsorbent, including both static binding conditions and dynamic binding conditions.

[0081] As described further herein, the peptides of the present disclosure exhibit advantages over the compositions and methods currently available to purify adenoviruses. For example, currently available ligands that are used to purify adenoviruses use elution conditions that damage the adenovirus products being eluted. In contrast, the peptide ligands of the present disclosure release bound target adenoviruses under gentler conditions, which do not damage the product.

[0082] The binding affinity of the peptides, compositions and / or adsorbent for the adenoviruses, as compared to one or more product- and / or process-related impurities or contaminants, can be altered by changes in the following: properties and concentration of the one or more product- and / or process-related impurities or contaminants; the properties and concentration of the host cell proteins; the composition, concentration, and pH of the solution in contact with the peptides; and / or the loading conditions and residence time of the load and washing steps. Any of these variables can be changed to variables that are suitable according to the methods of the present disclosure and result in increased or decreased binding affinity as required for the present disclosure.

[0083] In some embodiments, the contacting step can comprise a buffer of between pH 5-9. In some embodiments, the contacting step can comprise a buffer of between pH 5-8. In someNCSU-2024-218-02NCSU-43528.601 embodiments, the contacting step can comprise a buffer of between pH 5-7. In some embodiments, the contacting step can comprise a buffer of between pH 6-9. In some embodiments, the contacting step can comprise a buffer of between pH 6-8. In some embodiments, the contacting step can comprise a buffer of between pH 6-7. In some embodiments, the contacting step can comprise a buffer of between pH 7-9. In some embodiments, the contacting step can comprise a buffer of between pH 7-8.

[0084] In some embodiments, the elution is performed at a pH from about 5.0 to about 9.0. In some embodiments, the elution is performed at a pH from about 5.0 to about 8.0. In some embodiments, the elution is performed at a pH from about 6.0 to about 9.0. In some embodiments, the elution is performed at a pH from about 6.0 to about 8.0. In some embodiments, the elution is performed at a pH of about 5.0. In some embodiments, the elution is performed at a pH of about 5.5. In some embodiments, the elution is performed at a pH of about 6.0. In some embodiments, the elution is performed at a pH of about 6.5. In some embodiments, the elution is performed at a pH of about 7.0. In some embodiments, the elution is performed at a pH of about 7.5. In some embodiments, the elution is performed at a pH of about 8.0. In some embodiments, the elution is performed at a pH of about 8.5. In some embodiments, the elution is performed at a pH of about 9.0.

[0085] In some embodiments, the methods of the present disclosure result in at least a 20% yield for the encapsi dated transgene. In some embodiments, the methods of the present disclosure result in at least a 25% yield for the encapsidated transgene. In some embodiments, the methods of the present disclosure result in at least a 30% yield for the encapsidated transgene. In some embodiments, the methods of the present disclosure result in at least a 35% yield for the encapsidated transgene. In some embodiments, the methods of the present disclosure result in at least a 40% yield for the encapsidated transgene. In some embodiments, the methods of the present disclosure result in at least a 45% yield for the encapsidated transgene. In some embodiments, the methods of the present disclosure result in at least a 50% yield for the encapsidated transgene. In some embodiments, the methods of the present disclosure result in at least a 55% yield for the encapsidated transgene. In some embodiments, the methods of the present disclosure result in at least a 60% yield for the encapsidated transgene. In some embodiments, the methods of the present disclosure result in at least a 70% yield for the encapsidated transgene. In some embodiments, the methods of the present disclosure result in at least an 80% yield for the encapsidated transgene.NCSU-2024-218-02NCSU-43528.601

[0086] In some embodiments, yield can be measured in terms of cell-transducing units (e.g., TU) or viral particles. In some embodiments, the methods of the present disclosure result in at least a 20% yield for the cell-transducing units. In some embodiments, the methods of the present disclosure result in at least a 25% yield for the cell-transducing units. In some embodiments, the methods of the present disclosure result in at least a 30% yield for the cell-transducing units. In some embodiments, the methods of the present disclosure result in at least a 35% yield for the celltransducing units. In some embodiments, the methods of the present disclosure result in at least a 40% yield for the cell-transducing units. In some embodiments, the methods of the present disclosure result in at least a 45% yield for the cell-transducing units. In some embodiments, the methods of the present disclosure result in at least a 50% yield for the cell-transducing units. In some embodiments, the methods of the present disclosure result in at least a 55% yield for the celltransducing units. In some embodiments, the methods of the present disclosure result in at least a 60% yield for the cell-transducing units. In some embodiments, the methods of the present disclosure result in at least a 70% yield for the cell-transducing units. In some embodiments, the methods of the present disclosure result in at least an 80% yield for the cell-transducing units.

[0087] In some embodiments, the methods of the present disclosure produce at least a 60-fold, at least a 65-fold, at least a 70-fold, at least a 75-fold, at least a 80-fold, at least a 85-fold, at least a 90-fold, at least a 95-fold, at least a 100-fold, at least a 105-fold, at least a 110-fold, at least a 115-fold, at least a 120-fold, reduction in host cell proteins as compared to the sample (i.e., feedstock) when purifying an adenovirus. In some embodiments, the methods of the present disclosure produce at least a 60-fold reduction in host cell proteins as compared to the sample. In some embodiments, the methods of the present disclosure produce at least a 100-fold reduction in host cell proteins as compared to the sample. In some embodiments, the methods of the present disclosure produce at least a 120-fold reduction in host cell proteins as compared to the sample.

[0088] In some embodiments, the methods of the present disclosure produce at least a 7-fold at least a 10-fold, at least a 15-fold, at least a 20-fold, at least a 25-fold, at least a 30-fold, at least a 35-fold, at least a 40-fold, at least a 45-fold, at least a 50-fold, at least a 55-fold, at least a 60- fold, at least a 65-fold, at least a 70-fold, at least a 75-fold, at least an 80-fold, at least a 85-fold, at least a 90-fold, at least a 95-fold, at least a 100-fold, reduction in host cell DNA as compared to the sample (i.e., the feedstock) when purifying an adenovirus. In some embodiments, the methods of the present disclosure produce at least a 10-fold reduction in host cell DNA as compared to theNCSU-2024-218-02NCSU-43528.601 sample (i.e., feedstock) when purifying an adenovirus. In some embodiments, the methods of the present disclosure produce at least a 60-fold reduction in host cell DNA as compared to the sample. [0891 Embodiments of the present disclosure also include an adenovirus purified using any of the methods described herein.

[0090] In some embodiments, the biological fluid is a cell culture fluid. In some embodiments, the cell culture fluid comprises a supernatant and / or a cellular lysate. In some embodiments, the cell culture fluid is derived from mammalian cell culture. In some embodiments, the cell culture fluid is derived from HEK cells. In some embodiments, the HEK cells are selected from the group consisting of: HEK293S cells, HEK293T cells, HEK293F cells, HEK293FT cells, HEK293FTM cells, HEK293SG cells, HEK293SGGD cells, HEK293H cells, HEK293E cells, HEK293MSR cells, and HEK293A cells, or any derivatives or variants thereof. In some embodiments, the cell culture fluid is derived from yeast cells. In some embodiments, the cell culture fluid is derived from a virus production cell line. Exemplary virus production cell lines include, but are not limited to, wherein the virus production cell line comprises one or more of MDCK-S cells, MDCK-A cells, Vero cells, LLC-MK2D cells, PER.C6 cells, EB66 cells, AGE1.CR cells, HT1080 cells, and HeLa cells, or any derivatives or variants thereof.4. Materials and Methods

[0091] Materials. Aminomethyl ChemMatrix (particle size: 100 - 200 mesh; primary amine density: 0.5 - 0.7 mmol per g) resin was sourced from PCAS Biomatrix, Inc. (Saint-Jean-sur- Richelieu, Quebec, Canada). The Toy opearl AF-Amino-650M resin (pore size: 100 nm; particle size: 65 pm; ligand density: 100 pmol per mL resin) was obtained from Tosoh Corporation (Tokyo, Japan). All types of Fluorenylmethoxycarbonyl- (Fmoc-) protected amino acids, Hexafluorophosphate Azabenzotri azole Tetramethyl Uronium (HATU), piperidine, diisopropylethylamine (DIPEA), and trifluoroacetic acid (TFA) were obtained from Chemlmpex International (Wood Dale, IL, USA). Triisopropylsilane (TIPS), 1,2-ethanedithiol (EDT), polybrene, and phosphate buffered saline (PBS) at pH 7.4 were obtained from MilliporeSigma (St. Louis, MA, USA). N-methyl-2-pyrrolidone (NMP), N,N’ -dimethylformamide (DMF), dichloromethane (DCM), methanol, and Bis-Tris HC1 were obtained from Fisher Chemical (Hampton, NH, USA). Hydrochloric acid (HC1), sodium hydroxide (NaOH), sodium chloride (NaCl), and sodium citrate monohydrate were obtained from Sigma-Aldrich (Burlington, MA, USA). POROS™ CaptureSelect™ AdV5 Affinity Matrix, NHS-Alexa Fluor 594 (NHS-AF594)NCSU-2024-218-02NCSU-43528.601 and NHS-Alexa Fluor 488 (NHS-AF488), Dulbecco’s Modified Eagle Medium (DMEM), fetal bovine serum (FBS), TaqMan™ Fast Advanced Master Mix, Custom Taqman™ assay GFP probe, Proteinase K, Turbo DNase, DNase Ibuffer, Gibco Viral Production cells HEK293F, Picogreen DNA testing kit were sourced from ThermoFisher Scientific (Waltham, MA, USA). Standard Adenovirus serotype 5 (AdV5) loaded with a transgene encoding for green fluorescence protein was purchased from Vector Biolabs (Malvern, PA). BalanCD HEK293 cell culture medium was obtained from Irvine Scientific (Santa Ana, CA). African Green Monkey Kidney (Vero) cells were obtained from ATCC (Manassas, VA). All chromatographic experiments were performed using an AKTA Avant system (Cytiva, Marlborough, MA). HPLC Columns (L / ID: 30 / 2.1 mm; volume: 0.1 mL) were obtained from Microslov Technology Corporation (Leland, NC, USA). Alltech chromatography columns (L / ID: 50 / 3.6 mm; volume: 0.5 mL), and 10 pm polyethylene frits were obtained from VWR International (Radnor, PA, USA). The HEK293 ELISA kits and Vero Cell ELISA kits were purchased from Cygnus (Southport, NC, USA). The Hexon protein was purchase from Abeam (Waltham, MA). Unfixed short peptide AEFFIWNAC (SEQ ID NO: 27) and TNDGPDYSSPLTGSG-C (SEQ ID NO: 28) were purchased from GenScript (Piscataway, NJ). Pure gold (Au) chips were acquired from Bionavis company (Tampere, Finland).

[0092] Preparation and dual-fluorescence screening of a peptide library. A solid-phase 8- mer One-Bead-One-Peptide (OBOP) library comprising ~98 sequences was produced following the “split-couple-recombine” method on a Syro I automated peptide synthesizer (Biotage, Uppsala, Sweden) using 9 Fmoc protected amino acids: Alanine (A), Glutamic acid (E), Phenylalanine (F), Histidine (H), Isoleucine (I), Lysine (K), Asparagine (N), Serine (S), Tryptophan (W). A glycine spacer was synthesized at the C-terminus of all library sequences to link with the substrate resin. Each amino acid coupling reaction was performed for 15 min at 45°C using a solution of 3 equivalents (3 eq.) of Fmoc-protected amino acid at 0.5 M in dry DMF, HATU (3 eq.) at 0.5 M in dry DMF, and DIPEA (6 eq.) at 0.5 M in dry NMP. After coupling, the Fmoc protecting group was removed by incubating the resin with 20% v / v piperidine in DMF for 20 min at room temperature. The peptides in the library were finally deprotected using cleavage cocktail (95% v / v TFA, 2.5% v / v TIPS, 2.5% v / v MilliQ water) for 2.5 hrs at room temperature under continuous end-over-end mixing. The resin was then washed with DCM and DMF, dried under nitrogen, and stored in 20% v / v methanol at 4°C.NCSU-2024-218-02NCSU-43528.601

[0093] HEK293 and Vero host cell proteins (HCPs) were labeled using the fluorescent dye Alexa Fluor 488 (AF488, green), while AdV5 was labeled using Alexa Fluor 594 (AF594, red) as described in prior work (See, Chu, W., et al., Journal of Chromatography A 1679 (2022), 463363, Barbieri, E., et al., Biotechnology and Bioengineering, 2023, 1-22, and Raphael Prodromou, B.M., et al., Advanced Functional Materials (2023) 202213881R1). Feed materials for library screening were prepared by formulating AF594-AdV5 and AF488-HCPs at the titers of IO10vp / mL and 0.3 mg / mL, respectively. Aliquots of 15 pL of library beads were washed in PBS at pH 7.4 and incubated with 35 pL of screening feed fluid for 1 hr at room temperature. The beads were thoroughly washed with PBS at pH 7.4 with 0.1% v / v Tween 20 and sorted automatically using the microfluidic bead selection device developed in prior work (See, Chu, W., et al., Journal of Chromatography A 1679 (2022), 463363, Kilgore R, et al. Journal of Chromatography A, 2023, 1687: 463701, and Raphael Prodromou, B.M., et al., Advanced Functional Materials (2023) 202213881R1). The beads presenting strong red fluorescence and no green fluorescence - indicating high AdV-binding affinity and selectivity - were exposed to a flow of 0.1 M citrate buffer with 0.5 M NaCl at pH 5.0 (elution buffer) at 0.5 mL / min for 4 min. The beads losing >15% of their initial red fluorescence emission intensity - assumed to indicate efficient product elution - were selected. All other beads were discarded. The isolated beads were washed with 0.1 M glycine buffer at pH 2.5, MilliQ water, and 37% v / v acetonitrile to remove all bound proteins and individually analyzed with a PPSQ-33A protein sequencer (Shimadzu, Kyoto, Japan) to identify the peptide sequences carried thereon.

[0094] In silica design of hexon-targeting peptides. The crystal structures of human AdV5 hexon in complex with antibodies (PDB IDs: 5LDn and 5OGI) were analyzed to identify the hexon’s residues capable of forming affinity interactions and calculate the reference values of hexon: antibody free energy of binding (AGB). The candidate hexon-binding peptides ASQSVTNDAA (SEQ ID NO: 29), DYKDDDDKDIVMT (SEQ ID NO: 18), IWRGGTTDYNAKFQ-GSG (SEQ ID NO: 30), QGSNFPGDYSSPLT (SEQ ID NO: 1), SLGRYGPWRG-GSG (SEQ ID NO: 31), TNDGPDYSSPLT-GSG (SEQ ID NO: 26), VTNDGPGDY-GSG (SEQ ID NO: 32), and YGVHPGIWRGGTTD-GSG (SEQ ID NO: 33) were built in the format XiX2[...]Xn-GSG using the molecular editor Avogadro and their secondary structures were modeled in GROMACS using the force field GROMOS 54A7. The structure of human AdV5 hexon was prepared for docking using the Protein Prep Wizard (PPW, Schrodinger,NCSU-2024-218-02NCSU-43528.601New York, NY) by correcting missing atoms, adding explicit hydrogens, removing small ligands, and optimizing the ionization states and hydrogen-bonding network of the solvent-accessible residues to the pH of 7.4 (binding) and 5.0 (elution) using PROPKA. The above-listed peptides were docked in silica against the hexon’s candidate binding sites using the docking software HADDOCK (High Ambiguity Driven Protein-Protein Docking) v.2.4. The antibody-binding residues on the hexon protein and residues X1X2 . .]Xnon the peptides were marked as “active”, whereas the surrounding residues were marked as “passive”. Clusters of up to 10 docked hexompeptide structures selected based on CaRMSD < 5 A were ranked using the scoring function dMM-PBSA to estimate their AGB at pH 5.0 and 7.4. The hexompeptide complexes showing |AGB| ~ 5.9 - 6.5 kcal / mol at pH 7.4 and a loss of binding energy AAGB > 2 kcal / mol when switching to pH 5.0 were refined via 200-ns MD simulations to obtain accurate estimates of AGB at pH 5.0 and 7.4.

[0095] AdV5 culturing and clarification. The HEK293F suspension cells were cultured in BalanCD HEK293 medium to reach a cell density of 4- 106or 6- 106cells / mL, as measured using an Invitrogen Countess 3 Automated Cell Counter (ThermoFisher Scientific, Waltham, MA). The cells were diluted in BalanCD HEK293 medium to a concentration of 106cells / mL, incubated with AdV5 at a multiplicity of infection (MOI) of 6.7, and cultured in a thermostatted shaking incubator at 37°C and 8% CO2 for 40 or 72 hrs. Infected cells were centrifuged 15 mins at 1940 ref and the supernatant was removed. The pelleted cells were resuspended in 2 mL of 10 mM Tris-HCl at pH 8.0. Cells were then lysed using 3 cycles of freezing at -80°C and thawing at 37°C. The cell debris were removed by centrifugation at 1940 ref or 4000 ref and 4°C for 15 or 30 mins, respectively. The crude product was fdtered by 0.2 pm Fisherbrand Disposable PES Filter Units. The supernatant was concentrated 10-fold using a Microcon® 100 kDa MWCO centrifugal filter (Millipore Sigma, MA). To prevent aggregation, NaCl and Pluronic F68 were added to final concentrations of 0.15 M and 0.1% v / v, respectively.

[0096] Vero-CCL-81 (ATCC, Manassas, VA) adherent cells were cultured in VP-SFM medium (ThermoFisher Scientific, Waltham, MA) in a thermostatted shaking incubator at 37 °C and 5% CO2 for 40 hrs. Upon achieving 90% cel confluency, Gibco Trypsin-EDTA (0.25%) was added and incubated for 8 min to detach the Vero cells. The detached cells were centrifuged at 200g for 5 mins, resuspended in fresh VP-SFM medium, and lysed using three cycles of freezing at -80 °C and thawing at 37 °C. The cell debris were removed by centrifugation at 4000 ref for 15NCSU-2024-218-02NCSU-43528.601 mins at 4 °C, after which the supernatant was filtered using 0.2 pm Fisherbrand disposable PES Filter Units. The Vero cell feedstock containing AdV5 was prepared by spiking pre-purified AdV5 (Vector Biolabs) in a clarified Vero cell lysate (note: Vero cells do not possess the El gene, which encodes for proteins that are essential for adenoviral replication).

[0097] Peptide conjugation on different matrices. The hydroxyl groups on Poros 50 OH resin were initially converted to primary amines as follows: a volume of 10 mL of resin was initially dried using a stream of nitrogen, washed in DMF, and resuspended in 50 mL of a solution of CDI at 100 mg / mL in DMF; after 5 hours, the resin was copiously washed with DMF and dried with a stream of nitrogen; the imidazole ester-activated resin was then mixed with 100 mL of 5% v / v ethylenediamine in DMF and incubated at 45°C under shaking at 100 rpm; after 12 hours, the resin was washed with DMF and DCM, dried with nitrogen, and stored at 4°C. The peptide sequences AEFFIWNA (SEQ ID NO: 3) and TNDGPDYSSPLTGSG (SEQ ID NO: 26) were then conjugated on Toyopearl AF-Amino-650M resin and aminated Poros 50 via Fmoc / tBu chemistry using an Initiator-i- Alstra (Biotage, Uppsala, Sweden). Peptide ligands AEFFIWNAC (SEQ ID NO: 27) and TNDGPDYSSPLTGSG-C (SEQ ID NO: 28) were conjugated on SulfoLink coupling resin following the manufacturer’s instructions. The resins were individually packed in Alltech chromatography columns (L / ID: 50 / 3.6 mm; volume: 0.5 mL), washed with 20% v / v ethanol, and equilibrated with PBS at pH 7.4.

[0098] Purification of AdV5 from HEK293 and Vero cell lysates using peptide- functionalized resins. A volume of 5 mL (10 column volumes, CVs) of cell lysate (AdV titer ~109vp / mL; HEK293 or Vero HCP titer ~ 0.1 mg / mL) was loaded on the column in down-flow at the flow rate of 0.143 mL / min (residence time (RT) of 3.5 min). Following a washing step with 10 CVs of equilibration buffer at the RT of 3.5 min, the bound AdVs were eluted in up-flow using 20 CVs of 1 M NaCl in 20 mM Tris HC1 buffer at pH 8.0 at the RT of 3.5 min. Finally, the column was regenerated with 10 CVs of either 10% v / v phosphoric acid at the RT of 3.5 min or 0.1 M glycine buffer at pH 2.0 at the RT of 2 min.

[0099] The selected peptide sequences were conjugated on Toyopearl AF-Amino-650M resin via Fmoc / tBu chemistry used an Initiator-!- Alstra (Biotage, Uppsala, Sweden) following the method detailed above. The resins were individually packed into 0.1 mL columns (30 x 2.1 mm), washed with 20% v / v ethanol, and equilibrated with PBS at pH 7.4. A volume of 1 mL (10 column volumes, CVs) of cell lysate (AdV titer of ~109vp / mL; HEK293 or Vero HCP titer ~ 0.2 mg / mL)NCSU-2024-218-02NCSU-43528.601 was loaded on the column at the flow rate of 0.029 mL / min (3.5 min residence time, RT). Following a washing step with 20 CVs of equilibration buffer (RT : 3.5 min), the bound AdVs were eluted using different buffers depending on the amino acid sequence of the peptide ligands: 1 M NaCl in 0.1 M glycine buffer at pH 3.0 was used for cationic sequences (e.g., those comprising H and K residues); 1 M NaCl in 0.05 M citrate buffer at pH 5.0 was used with neutral sequences; and 1 M NaCl in 20 mM Tris HC1 buffer at pH 8.0 was used for anionic sequences (e.g., those comprising E residues). The elution step was always conducted in up-flow using 20 CVs of buffer at the RT of 3.5 min; for some candidate ligands, two elution buffers were used in sequence (10 CVs each) as detailed in Table 6. Finally, the columns were regenerated with 10 CVs of 1 M NaCl in 0.1 M glycine buffer at pH 2.0 at the RT of 3.5 min. The encapsidated transgene titer was measured in the collected fractions via real time polymerase chain reaction (qPCR) to rank the peptide ligands based on product yield. The top performing ligands AEFFIWNA (SEQ ID NO: 3) and TNDGPDYSSPLTGSG (SEQ ID NO: 26) were selected for further testing in 0.5 m Alltech columns. Following equilibration in PBS, the cell lysates were loaded at the ratio of ~109vp per m of resin, the resin was washed, and the bound AdVs finally eluted in 20 CVs of 1 M NaCl in 20 mM Tris HC1 buffer at pH 8.0 at the RT of 3.5 min. The collected chromatographic fractions were analyzed as described in detail elsewhere herein to evaluate the AdV yield and purity afforded by the peptide ligands.

[0100] Dynamic AdV5 binding capacity of affinity resins. The peptide-functionalized resins and Capture Select™ AdV5 affinity matrix were individually packed into 0.5 mb Alltech columns, washed with 20% v / v ethanol, and equilibrated with PBS at pH 7.4. A volume of 80 CVs of HEK293 cell lysate featuring an AdV titer of ~108or 109vp / mL (corresponding to a total load of 109vp per mL of resin; HCP titer ~ 0.15 mg / mL) was loaded at the RT of 2 min or 3.5 min. The effluents were continuously monitored via UV spectroscopy at 260 and 280 nm and apportioned in fractions of 2 CVs. The encapsidated transgene in the collected fractions was measured via qPCR and utilized to calculate the dynamic (transgene-loaded) AdV5 binding capacity at 10% breakthrough (DBCio%).

[0101] Quantification of HEK293 and Vero HCPs and hcDNA. The titer of HEK293 HCPs in the feedstocks and chromatographic fractions was measured using HEK293 and Vero HCP ELISA kits (Cygnus Technologies, Southport, NC) following the manufacturer’s protocol. The quantification of host cell DNA (hcDNA) was performed using Quant-iT™ PicoGreen™ dsDNANCSU-2024-218-02NCSU-43528.601Assay Kits (ThermoFisher Scientific, Waltham, MA) following the manufacture’s protocol. The values of HCP and hcDNA logarithmic reduction values (LRV) were calculated via mass balance.

[0102] Quantification of the encapsidated transgenes. The titer of AdV5 in the feedstocks and chromatographic fractions was measured via qPCR (note: ELISA kits for the quantification of AdV particles are not commercially available). The samples were initially treated with DNase to remove free viral and host cell DNA: briefly, 20 pL of sample were mixed with 2 pL Turbo DNase buffer and 1 pL DNase and incubated at 60°C for 60 mins and then 95 °C for 20 mins. Thereafter, 1 pL of Proteinase K was added to each sample, followed by incubation at 37°C for 60 mins and then at 95°C for 10 mins. qPCR was then conducted in a CFX Duet real time PCR system (Biorad, Hercules, CA) using TaqMan probes (forward primer sequence: AGCAAAGACCCCAACGAGAA (SEQ ID NO: 34); reverse primer sequence: GGCGGCGGTCACGAA (SEQ ID NO: 35); GFP probe sequence: CGCGATCACATGGTCCTGCTGG (SEQ ID NO: 36)) to quantify the GFP gene.

[0103] Measurement of AdV5 hexon:peptide and HEK lysate:peptide binding via surface plasmon resonance (SPR). A gold SPR chip (Bionavis, Finland) was coated with a self-assembled monolayer of dithiobissuccinimide propionate (DSP) and functionalized with cystine-derivatized peptide ligands. Briefly, 2 mL of dithiobis(succinimidyl propionate) (DSP) solution at 0.1 mM in ethanol was incubated with the gold electrode for 24 hrs in the dark and at room temperature. After washing with ethanol and MilliQ water, the sensor was incubated in a solution of cysteine- derivatized peptide ligands AEFFIWNA-C (SEQ ID NO: 27) or TNDGPDYSSPLTGSG-C (SEQ ID NO: 28; the GSG spacer was added to improve ligand display) at 1 pg / mL in 50 mM sodium borate buffer at pH 8.5 for 4 hrs in the dark at room temperature. After washing with MilliQ water, the sensor was incubated in a solution of PEG -thiol at 0.5 mM in 50 mM sodium borate buffer at pH 8.5 for 4 hrs in the dark at room temperature to block any unreacted sites on the chip surface. An SPR chip coated with a self-assembled monolayer of DSP and functionalized with PEGs-thiol was prepared for use as control. Feed solutions of AdV5 hex on were prepared in PBS at pH 7.4 at the concentration of either 25, 40, 50, 100, 175, 250, or 500 nM. In parallel, a null HEK293 cell lysate was incubated with dextran-coated charcoal at a 95:5% weight ratio for 5 min at room temperature to remove small components that can affect the SPR signal (e.g., phenol red). After removing the charcoal by centrifugation at 10,000 rpm, the HEK293 cell lysate was diafiltered against PBS at pH 7.4 using a Microcon® centrifugal filter (MWCO: 10 kDa at 10,000 rpm for 5NCSU-2024-218-02NCSU-43528.601 min to ensure that matching the background buffer composition of the feedstock and the SPR operating buffer. All SPR experiments were conducted on a Bionavis MP-SPR Navi™ 220A NAALI (Tampere, Finland). Briefly, 290 pL of the feed solution were loaded into the electrode chamber at the flow rate of 20 pL / min while continuously recording the refractive index change at the incident light wavelength of 670 nm. After loading, PBS was flown at 20 pL / min until reaching a stable baseline. Data were exported and analyzed using MP-SPR Navi Data Viewer and Tracedrawer, using the bulk effect model (one-to-two-BI) to fit all curves and derive the values of kinetic parameters (konand koff) and resulting dissociation constant (KD).

[0104] Quantification of adenovirus recovery by median tissue culture infectious dose (TC D50). Aliquots of 100 pL of a suspension of HEK293 at the cell density of 105cells / mL in DMEM-2 were dispensed in 96-well plates. A 12-fold serial dilution of an AdV5 feedstock was prepared encompassing the titer range of 109to 1010vg / mL. Aliquots of 100 pL of each dilution were added to the 96 well plate, with 9 replicates per titer, while 100 pL of DMEM-2 medium were used as controls. The 96 well plates were incubated at 37°C for 10 days and then analyzed to detect cytopathic effects (CPE, any morphological change detected in a well was logged as positive, FIG. 15). The CPE ratio was calculated for every one of the 10 values of dilution (10‘3, 10‘4, .. ., 10-11) as the number of cells in which CPE was detected divided by the total number of cells (herein, 9). The resulting 10 values of CPE ratios were added to obtain the score “S”. The final TCID50 value was calculated according to the formula T = 10 (3+S).

[0105] Electrophoretic analysis of the chromatographic fractions. SDS-PAGE analysis of the HEK293 cell lysate and the fraction obtained by purifying AdV5 using AEFFIWNA (SEQ ID NO: 3)-functionalized resins was conducted using 4-12% SurePage™ gels (Genscript, NJ) and IX Tris-MOPS-SDS Running Buffer (Genscript, NJ) as running buffer. The gel was run on a Mini- PROTEIN Tetra cell system (Bio Rad, CA). A volume of 30 pL of sample was combined with 10 pL of 4x Laemmli Sample Buffer and loaded to the wells of SDS-PAGE gels. The gel was run at 100 V for about 10 min and 200 V for about 30 minutes. The gels were then stained using a SilverQuest™ Silver Staining Kit (ThermoFisher, Waltham, MA) and finally imagined by Gel Doc2000 imaging system (Bio Rad) and extracted with ImageJ vl.54.

[0106] Analysis of the chromatographic fractions size-exclusion chromatography (SEC). The feedstock, and the collected flow-through and elution fractions were analyzed by analytical SEC using a BioResolve SEC mAb Column ((200 A, 2.5 pm, 4.6 x 300 mm; Waters, Milford,NCSU-2024-218-02NCSU-43528.601MA) operated with a 40-min isocratic method using 200 mM KC1 in 50 mM sodium phosphate at pH 7.0 (0.05% v / v sodium azide) as mobile phase, and at the flow rate of 0.5 mL / min for 40 min or a Bio SEC-5 HPLC column (2000 A, 5 pm, 4.6 x 300 mm; Agilent Santa Clara, CA) operated in isocratic mode using the same mobile phase at 0.4 mL / min for 30 min.. A volume of 20 pL of sample was injected and the effluent was continuously monitored via UV (abs: 260 nm and 280 nm) fluorescence spectroscopy (ex / em: 280 / 350 nm).5. Examples

[0107] The accompanying Examples are offered as illustrative as a partial scope and particular embodiments of the disclosure and are not meant to be limiting of the scope of the disclosure.Example 1

[0108] Design and selection of AdV-targeting peptide ligands. As a perfect icosahedron, the capsid of AdVs comprises 20 faces, each formed by a mosaic of 36 hexons proteins, and 12 vertices, each comprising 2 penton proteins from which the fiber proteins extend. Two parallel approaches were pursued for the identification of AdV-targeting peptides, combinatorial selection and in silica design. The former leverages a solid-phase library of peptides produced on translucent beads and screened using a dual-fluorescence selection workflow that enables the selection of peptides with tailored affinity and binding strength. The latter relies on the rational design of sequences whose spatial display of key residues reproduces that of the binding site of reference binders, such as the complementarity-determining regions of antibodies.

[0109] The combinatorial selection begins with the design of a library of peptides whose amino acid composition and sequence length promote the identification of peptides with selective binding for a target, herein adenoviral hexon proteins. The chemoinformatic analysis of the ectodomain of the AdV5 hexon and its complex with antibodies (PDB IDs: 5LDN and 5OGI) offers insightful guidance to library design. Specifically, three candidate sites were identified, whose structure and properties are reported in FIG. 7 and Table 1 : Sites 1 and 2 overlap with the epitope targeted by the two antibodies, while Site 3 is distinct in geometry and amino acid composition. Given the diversity of topological and biophysical properties of the druggable sites, a library was built using a selection of amino acid building blocks that encompass a diverse range of interactions. Specifically, glutamic acid (E), histidine (H), and lysine (K) were adopted for coulombic interactions; asparagine (N) and serine (S) were adopted for hydrogen bonding; isoleucine (I),NCSU-2024-218-02NCSU-43528.601 phenylalanine (F), and tryptophan (W) were adopted for hydrophobic and 7r-7t interactions; and alanine (A) were adopted as a semi-rigid amino acid spacer between residues. A length of 8 residues, whose average hydrodynamic radius and solvent-accessible surface (7.5 - 10 A and 350 - 500 A2) fit the corresponding parameters of the candidate binding sites, was also adopted.

[0110] The library of 8-mer peptides was synthesized on ChemMatrix beads, whose hydrophilicity and pore morphology are ideal for selecting protein-binding ligands, and screened utilizing the bead-sorting device (FIG. 1). The device leverages the orthogonal fluorescent labeling of the target and the contaminant species (host cell proteins and nucleic acids) to rapidly identify beads that carry candidate peptide ligands. Specifically, a screening feedstock was formulated using red-labeled AdV5 at the titer of 1010vp / mL and green-labeled HEK293 or Vero intracellular components at the titer of 0.3 mg / mL to mimic the composition of feed materials processed in the industry for AdV purification.[0U1] Monomeric hexon proteins were not used in the screening to avoid the selection of peptides targeting regions of the hexon’ s surface that are not displayed on the capsid; most of the hexon’ s surface is involved in the complexation of three hexons into the hexagonal cell, as shown in FIG. 7, or the assembly of the cells in the capsid. Accordingly, the full AdV5 capsid was labeled with NHS-activated Alexa Fluor 594 at the ratio of -15-18 dyes per capsid. The intracellular components of HEK293 or Vero cells, mostly comprising proteins and nucleic acids, were collectively labeled with NHS-activated Alexa Fluor 488. Prior screening studies suggested maintaining the titer of contaminants at 0.3 mg / mL (higher than that of AdV feedstocks obtained by lysing cells at the density of -3 106cells / mL) to promote the identification of selective leads. The beads selected for their strong red-only fluorescence emission, denoting selective and high- capacity binding of AdV5, were withheld in the device and exposed to an elution buffer at pH 5.0. The importance of mild elution conditions to ensure the therapeutic efficacy and safety of purified viral vectors inspired the selection of a buffer with slight acidity instead of those (pH 2 - 3) mandated by commercial adsorbents for the affinity purification of AAVs and AdVs. The beads capable of efficient AdV5 release, as denoted by the loss of red fluorescence, were analyzed via Edman degradation, returning sequences IWWINIAN (SEQ ID NO: 16), KHWWIANH (SEQ ID NO: 19), FFIANWFN (SEQ ID NO: 23), SFWFHKFA (SEQ ID NO: 7), WHANFIHW (SEQ ID NO: 20), AIHFINWW (SEQ ID NO: 21), FSKWIFNE (SEQ ID No: 17), HAHKKWFN (SEQ ID NO: 5), HIHKKFHE (SEQ ID NO: 15), AEFFIWNA (SEQ ID NO: 3), INWWAWEH (SEQ IDNCSU-2024-218-02NCSU-43528.601NO: 8), FWKWSFWE (SEQ ID NO: 4), FHKHSHFE (SEQ ID NO: 11), WFFSNHWE (SEQ ID NO: 22), HHFAAFAW (SEQ ID NO: 25), and WWAWFAFK (SEQ ID NO: 24).

[0112] In parallel with the combinatorial selection, a virtual ensemble of short peptide mimetics of anti-hexon antibodies were designed in the format XiX2[...]Xn-GSG, with length (n) ranging from 8 to 14 residues. The peptides were individually docked against the homology model of the AdV5 hexon protein derived from published structures (PDB IDs: 5LDN and 5OGI). The GSG spacer, marked as “inactive” during docking, was utilized to maintain the peptide’s C-terminus in an outward orientation from the binding surface, simulating its conjugation on the solid support. This artifice ensures that peptides designed in silico, where they have a higher degree of orientational freedom, function successfully when tethered on the surface of chromatographic resins. Furthermore, every peptide was docked at two values of pH, representing respectively the binding (pH 7.4) and the prospective elution conditions (pH 5.0; note: the ionization status of both proteins and ligands was optimized before docking). The peptides targeting the solvent-accessible regions of the surface of hexon proteins in the context of the hexagonal trimer (FIG. 7) were maintained, while the others were discarded, being predicted to be unable to bind the assemble capsid. The peptides whose hexon-binding free energy aligns with characteristic affinity values (|AGB| ~ 5.9 - 6.5 kcal / mol) at pH 7.4 and decreases substantially (AAGB > 2 kcal / mol) when switching to pH 5.0 were selected as candidate ligands, namely ASQSVTND (SEQ ID NO: 9), DYKDDDDKDIVMT (SEQ ID NO: 18), IWRGGTTDYNAKFQ (SEQ ID NO: 13), QGSNFPGDYSSPLT (SEQ ID NO: 1), SLGRYGPWRG (SEQ ID NO: 10), TNDGPDYSSPLT (SEQ ID NO: 2), VTNDGPGDY (SEQ ID NO: 14), and YGVHPGIWRGGTTD (SEQ ID NO: 6) (FIG. 2).

[0113] Table 1 : Structural and biophysical properties of target sites on AdV5 hexon. The properties of the putative binding sites identified on the convex side of hexon trimer of AdV5 (PDB ID: 5LDN and 5OGI); the binding sites are labeled in FIG. 7.Example 2NCSU-2024-218-02NCSU-43528.601

[0114] Evaluation of candidate peptide ligands. The molecular docking and dynamics simulations of the peptides identified via combinatorial selection and rational design provide valuable insight into the biorecognition mechanisms determining affinity capture and elution. Particularly illuminating is the analysis of the pairwise interactions, which highlight key residues in the peptide ligands and their counterparts on the AdV5 hexon and provide a decomposition of the binding energy in its electrostatic, Van Der Waals, hydrogen bonding, hydrophobic, and 7t-n interactions. A common pattern in the hexon-binding mechanism of AEFFIWNA (SEQ ID NO: 3), FWKWSFWE (SEQ ID NO: 4), TNDGPDYSSPLT (SEQ ID NO: 2), QGSNFPGDYSSPLT (SEQ ID NO: 1), and YGVHPGIWRGGTTD (SEQ ID NO: 6) is the primary role played by hydrogen-bonding residues (e.g., the hydroxyl group of S and T, the carbamoyl group of N and Q, and the indole’s -NH group in W) and the ancillary role of aromatic (F and W) and cationic (K and H) residues towards binding at pH 7.4. An additional similarity is represented by the anionic residues (D or E) acting as triggers of elution by electrostatic repulsion. This capture mechanism (i) synergizes the modest affinity of a single peptide into the virus-binding avidity of the peptide- functionalized surface, leading to high binding capacity; (ii) allows nonetheless to release the product by implementing elution conditions that are substantially milder than those required by high-affinity protein ligands. Accordingly, a set of three elution buffers were devised that leverage mild and strong kosmotropes (e.g., chloride v.s. citrate) to disrupt hydrogen bonding and different values of pH to recruit electrostatic repulsion to improve elution: 0.05 M citrate buffer at pH 5, 1 M NaCl in 20 mM Tris HC1 buffer at pH 8, and 0.1 M glycine buffer at pH 3.0 (control elution buffer, recommended for the Capture Select™ AdV5 affinity resin). At pH 5, the net charge of hexon proteins, whose isoelectric point is 4.84, approaches neutrality, allowing kosmotropes to outcompete the peptide ligands in forming hydrogen bonds with the AdV capsid. At pH 8, the contribution of K and H residues towards binding is attenuated, while the repulsive effect of D or E residues is strengthened, thus promoting elution. Conversely, the control elution buffer, features glycine, also a kosmotrope, and low pH, which recruits cationic residues to trigger AdV elution by electrostratic repulsion.

[0115] The peptide ligands were conjugated on Toyopearl resin, a polymethacrylate-based matrix with large pore size (> 100 nm), high specific surface, and low non-specific adsorption. The peptide-Toyopearl resins were loaded with a HEK293 cell lysate to a ratio of ~1010adenoviral particles per mb of resin at the residence time of 3.5 min to compare their purification performanceNCSU-2024-218-02NCSU-43528.601 with the reference CaptureSelect™ AdV5 resin. FIG. 3 summarizes the resulting values of product yield and purity (logio reduction of host cell proteins) obtained by implementing the above-listed elution conditions.

[0116] The candidate peptide ligands performed consistently in terms of HCP reduction but varied widely in product yield. While in fact a negligible loss of AdV5 and a robust clearance of impurities were recorded in the flow-through and wash fractions (< 1%), confirming the biorecognition activity of the peptides identified by combinatorial and rational selection, the recovery of bound virions ranged from 2% to 65%. Notably, the values of yield obtained by eluting AdV5 from candidate ligands comprising anionic residues (D and E) using Tris buffer pH 8.0 from were consistently above 40%, the highest obtained in the whole cohort. In particular, AEFFIWNA (SEQ ID NO: 3) and FWKWSFWE (SEQ ID NO: 4) respectively afforded yields of 46.3% and 45.4%, while TNDGPDYSSPLTGSG (SEQ ID NO: 26) provided a 53.5% yield, corroborating that the combination of kosmotropic disruption of AdV:peptide bonds and electrostatic repulsion between anionic residues proves the most effective elution trigger. For reference, the yield of CaptureSelect™ AdV5 affinity resin was limited to 17.3%. 15% of the sequences identified via combinatorial selection afforded product yield above 40% against 37.5% of the sequences designed in silico, confirming the criteria adopted for molecular docking and dynamics. On the other hand, the values of HCP LRV were found to be consistently high, confirming the binding selectivity of all sequences. Most of loaded HCPs were indeed found in the flow-through and wash fractions, while the residual HCP titer in the eluates was between 60- and 120-fold lower. These values are in line with those obtained with protein ligands (LRV ~ 1.7 - 2.0) and are significantly higher than the levels of HCP clearance obtained with anion exchange (85-90%), which currently represents the mainstream AdV purification technology in the literature. The level of contaminant clearance provided by the top performing peptides warrants their application as affinity ligands in a platform downstream process affording high-quality products.

[0117] The SDS-PAGE and SEC-HPLC analysis of the chromatographic fractions obtained by purifying AdV5 from HEK293 cell lysates using AEFFIWNA (SEQ ID NO: 3)-functionalized resins, collated in FIG. 4, provide an at-a-glance representation of the purity of the eluted virus. In particular, the electrophoretic analysis of the eluate shows the main proteins forming the adenoviral capsids, namely the monomeric and trimeric hexons, the pentons, and proteins VI, VII, and IX, while the HEK293 HCPs are undetectable. Most notably, the pentons were not shed byNCSU-2024-218-02NCSU-43528.601 the adenoviral particles during elution, reinforcing the choice of an elution buffer with pH 8.0. Similarly, the SEC analysis of the flow-through fraction indicated the effective capture and elution of the AdV capsids (retention time - 9 - 10 min) and the removal of the contaminants released during the lysis of the HEK293 cells. Based on these results (see summary in Table 6), 1 M NaCl in 20 mM Tris HC1 buffer at pH 8 was adopted as elution buffer. Having tested AEFFIWNA (SEQ ID NO: 3) and TNDGPDYSSPLTGSG (SEQ ID NO: 26) in purifying AdV5 from HEK293 cell lysates, their performance was evaluated by purifying AdV5 from Vero cell lysates. The values of product yield (53.2% and 55.5%, respectively) and HCP LRV (1.77 and 1.67) confirmed the adoption of these peptides as the leading candidate ligands.

[0118] Finally, the dynamic binding capacity (DBCio%) of the peptide-functionalized resins was measured at different values of residence time (e.g., 3.5 and 2.0 min). The value of DBCio% and its dependence on flow rate are process-relevant parameters of the utmost importance as they determine the column volume and loading time, and therefore process cost and productivity. The breakthrough curves, plotting the titer of encapsidated genomes in the column effluent vs. resin loading are collated FIG. 5 (ELISA kits are not available for AdV5 capsids; tracking the titer of encapsidated genomes in the effluent, rather than the capsids among which empty or incorrectly filled particles may be present, represents a more rigorous means of evaluating the virion purification performance of affinity adsorbents). As shown in Table 2, the DBCio% values varied within a narrow range: CaptureSelect™ AdV5 affinity resin ranked first with 2.7- 1010vg per mL of resin, followed by TNDGPDYSSPLTGSG (SEQ ID NO: 26) with 2.3 -IO10vg / mL and AEFFIWNA (SEQ ID NO: 3) with 4.6- 1010vg / mL.

[0119] Table 2: Values of dynamic AdV5 binding capacity (DBCw%) obtained by loading a clarified HEK293 cell lysate on adsorbents AEFFIWNA(SEQ ID NO: 3)-Toyopearl, TNDGPDYSSPLTGSG (SEQ ID NO: 26)-Toyopearl, and Thermo AdV5-POROS resins at different values of load ratio and residence time (RT).NCSU-2024-218-02NCSU-43528.601Example 3

[0120] Measurement of peptide binding kinetics and affinity via surface plasmon resonance. Surface plasmon resonance (SPR) was used to confirm the peptide: AdV5 affinity and selectivity by measuring the kinetic and equilibrium parameters of peptide binding to adenoviral hexon proteins vs. HEK293 HCPs. The adsorption and desorption constants, kads and kj^, are in fact determining factors, together with mass transfer phenomena, of the productivity of a chromatographic process. Furthermore, the resulting dissociation constant KD.SPR (kdeslkads enables validating the corresponding value of ' ^n-siUco derived from the binding free energy calculated via molecular dynamic simulations. The SPR chips coated with a self-assembled monolayer (SAM) were functionalized with peptides AEFFIWNA (SEQ ID NO: 3) and TNDGPDYSSPLTGSG (SEQ ID NO: 26) at the density of ~1.2 105peptides per pm2(measured via ellipsometry). SPR sensors coated with hydroxyl-terminated monolayers were utilized as negative controls. Solutions of AdV5 hexon at titers ranging from 25 to 250 nM in PBS buffer at pH 7.4 and HEK293 HCPs at titer of 0.2 mg / mL were contacted with the peptide-functionalized sensors at the flow rate of 0.02 mL / min, corresponding to a residence time in the SPR cell of 10 min.

[0121] The hexompeptide binding sensorgrams in FIGS. 6A and 6B were processed using the MP-SPR Navi TraceDrawer to derive the values of kads, k e , and KA,SPR, which are reported in Table 5 together with the corresponding KDJM&O. The data interpolation suggested the adoption of the l-to-2 BI model, which indicates the presence of two similar peptide-binding sites on the hexon protein. Notably, (i) the molecular docking simulations in FIG. 2 indicate the presence of two contiguous sites with high ligand-ability and overlapping with the epitopes of anti-AdV5 antibodies; and (ii) the in silica and experimental KD align, and are similar to the values recorded for AAV- and LVV-binding peptides. As commented above, the hexon-binding strength of the peptide ligands is sufficiently high to grant efficient AdV5 capture and binding capacity, especially when synergized in multi-site interactions, and yet sufficiently mild to enable facile elution.

[0122] The binding of HEK293 HCPs was stronger on sensors coated with the hydroxyl- terminated SAM than on peptide-functionalized sensors (FIG. 6C). The level of HCP binding recorded on all sensors can be reasonably attributed to the high HCP titer (e.g., 0.02 mg / mL, lOxNCSU-2024-218-02NCSU-43528.601 diluted from the 0.2 mg / ml HEK HCP concentration) characteristic of cell lysate feedstocks, leading to non-specific adsorption on the hydroxyl-terminated SAM. Assuming an average protein molecular weight of 20 kDa, the HCP titer corresponds in fact to 1 pM, which is between 4- and 40-fold higher than the hexon titer. Notably, after washing the surface one or two times with 290 pL Tris-HCl buffer with 1 M NaCl at pH 8.0, the sensorgrams recovered the base line, indicating that the HCPs could be easily removed from the SAM-coated surface.Example 4

[0123] Purification of AdV5 from HEK293 and Vero cell lysates using peptide- functionalized resins under optimal elution conditions As described above, introducing peptide ligands AEFFIWNA (SEQ ID NO: 3) and TNDGPDYSSPLTGSG (SEQ ID NO: 26) presented the purification of Adenovirus serotype 5 (AdV5) from HEK293 cell lysates as a demonstrative case study. This initial evaluation focused on quantifying the yield of encapsulated transgenes (e.g., reporter gene encoding green fluorescent protein, GFP) and the removal of host cell proteins (HCPs). The characterization of these ligands was broadened by adding the measurement of yield of cell-transducing AdV5 particles and the clearance of host cell DNA (hcDNA) under optimized elution conditions. Clarified cell lysates featuring an AdV5 titer approximately 109vg / mL and HCP titers ranging from -0.08-0.35 (HEK293F cells) to -0.1 mg / mL (Vero cells) as shown in Table 7 were used. The feedstocks were loaded on columns packed with 0.5 mL of AEFFIWNA(SEQ ID NO: 3)-Toyopearl and TNDGPDYSSPLTGSG (SEQ ID NO: 26)- Toy opearl resins at ratios of 109— 1010vg per mL of resin and a residence time (RT) of 3.5 min. The resulting values of yield of encapsidated transgenes and infectious units (IFU), and the corresponding logarithmic removal values of host cell proteins and nucleic acids (HCPs and hcDNA LRVs) are presented in FIG. 8 and Table 7.

[0124] AEFFIWNA(SEQ ID NO: 3)-Toyopearl resin achieved AdV5 transgene yields of 40.5% and 53.2% from the HEK293 and the Vero cell lysates, respectively, along with average reduction values of -100-fold for HCPs and 60-fold for hcDNA; TNDGPDYSSPLTGSG (SEQ ID NO: 26)-Toyopearl resin afforded slightly higher yields, respectively 50.3% and 55.5%, but lower clearance of HCPs (50-fold) and hcDNA (30-fold). It is noted, however, that the different reduction values stem from the differences in the titers of impurities in the HEK293 vs. Vero cell lysates, whereas the residual titers of HCPs and hcDNA in the eluates were similar, namely 0.9 toNCSU-2024-218-02NCSU-43528.6011.5 pg / mL and 120 to 150 ng / mL. Of note, the removal of hcDNA could be further improved by a DNase treatment after cell lysis. For reference, AdV purification by anion exchange offers higher recoveries (up to 80%) but significantly lower removal of host cell impurities. Furthermore, the use of anion exchange requires conducting a UF / DF step prior to product capture to increase the AdV titer and reduce the conductivity and the level of biomolecular impurities in the clarified cell lysate that could interfere with virus-ligand binding.

[0125] When operated with the elution conditions identified above (1 M NaCl in 20 mM Tris buffer at pH 8.0), the peptide ligands provided high yields of encapsidated transgenes and celltransducing virus particles from both cell lysates, showing negligible product loss despite the high loading of approximately 2- 1010vg per mL of resin (<1% of loaded AdV5 was lost during the loading and washing steps), and efficient removal of host cell proteins and nucleic acids. However, since the individual roles of conductivity and pH on the AdV5:peptide interaction were unknown, the dependence of product yield on the formulation of the elution buffer was investigated. A stepwise increase in NaCl concentration from 0.2 M to 1.2 M (e.g., four 0.2 M NaCl increments of 5 CVs each) was implemented while maintaining a constant pH 8.0. The results in FIG. 9A show that ligand AEFFIWNA (SEQ ID NO: 3) released small amounts (< 3%) of AdV5 at low conductivity, whereas satisfactory product recovery could be achieved only at high conductivity (step yields of -10% and -30% were recorded at 0.8 M and 1 M NaCl, respectively). Conversely, the release of AdV5 from ligand TNDGPDYSSPLTGSG (SEQ ID NO: 26) increased linearly with conductivity, starting from a step yield of 4% at 0.2 M NaCl and reaching 14% at 1 M NaCl. The sum of the step yields reported in FIG. 9A match the values (40 to 55%) presented in FIG. 8, suggesting the need to identify orthogonal triggers that dissociate the AdV5:peptide complex and increase product yield.

[0126] The optimization of the elution pH was conducted within the range 6.0 to 8.5, while fixing the NaCl concentration at 1 M. At pH above 8.5, AdV capsids undergo structural changes that lead to a loss of viral infectivity. Similarly, lowering the pH to below 6 triggers a premature disassembly of the capsid, specifically release of vertex proteins. Although it has been reported that activity losses can be partially reverted when the lower pH is returned to physiological values, the lower and upper limits of the elution pH gradient were set to 6.0 and 8.5. As shown in FIG. 9B, the pH dependency of AdV5 release from AEFFIWNA (SEQ ID NO: 3) followed the same profile observed with conductivity, where only a small amount (2 - 5%) of virus was releasedNCSU-2024-218-02NCSU-43528.601 between pH 6.0 and 7.0, followed by an uptick to ~10 to 15% at pH 7.5 and 8.0. Conversely, the step yield of AdV5 from TNDGPDYSSPLTGSG (SEQ ID NO: 26) featured a bi-modal profile, with peaks of 3% and 5% at pH 7.0 and 8.5, while being near null at all other values.

[0127] These results match the outcomes of the molecular docking and dynamics simulations showing that the AdV5:AEFFIWNA (SEQ ID NO: 3) interaction at pH 7.4 is dominated by hydrogen bonds, while hydrophobic and coulombic interactions only play an ancillary role. Accordingly, the addition of NaCl, a mild kosmotrope, is expected to disrupt the hydrogen bonding network and promote the formation of a water shell around the capsid, thereby inducing the dissociation of the AdV:peptide complexes. Additionally, as the pH increases to 8.0 to 8.5, the repulsive effect of the ligands’ anionic residues Asp (D) and Glu (E) to their counterparts on the capsid furthers the release of AdV5. Accordingly, PBS at pH 7.4 and 1 M NaCl in 20 mM Tris buffer at pH 8.0 were maintained respectively as binding and elution buffers. These formulations are already utilized for adenovirus purification via anion exchange chromatography and enable seamless integration of the peptide-functionalized adsorbents in current bioprocesses.Example 5

[0128] Matrix selection of target sequences. The design of chromatographic adsorbents, e.g., the composition of the beads, their particle and pore diameters, and the ligand density, plays a role in binding capacity, selectivity, and product yield. While extensive research exists on the composition and morphology of affinity and ion-exchange resins for the purification of proteins (< 10 nm), much less is known on their role in purifying complex biologies. Viral vectors in particular are challenging due to their larger size (20 - 100 nm), biomolecular complexity of their surface, and diverse product-related impurities (e.g., capsid proteins and capsomers, and full vs. empty capsids). Driven by the growing importance of gene therapies, bioseparation researchers have begun to prioritize the development of chromatographic substrates tailored to gene therapies, focusing primarily on adeno-associated viral vectors (AAVs) and plasmids / mRNA. However, similar efforts on lentiviral and adenoviral vectors (LVVs and AdVs -80-100 nm) are lagging.

[0129] The roles of chromatographic substrate composition and morphology on AdV affinity purification were studied by comparing (i) polystyrene-based beads with large pores (Poros, particle size: 50 pm, pore size: 100-1000 nm), the same matrix utilized in the commercial CaptureSelect AdV5 affinity resin; (ii) poly(methyl methacrylate)-based beads with medium poresNCSU-2024-218-02NCSU-43528.601(ToyoPearl, 65 pm, 100 nm), selected for its rigid backbone that enables operating at high flow rates; and (iii) crosslinked agarose resins, selected for its high hydrophilicity that grants minimal non-selective adsorption. The purification performance of the resulting affinity adsorbents functionalized with peptides AEFFIWNA (SEQ ID NO: 3) and TNDGPDYSSPLTGSG (SEQ ID NO: 26) is presented in Table 8 and summarized in FIG. 10 (the corresponding chromatograms are collated in FIG. 17).

[0130] The AdV5 capture and release recorded on AEFFIWNA (SEQ ID NO: 3)- functionalized resins were comparable for Toyopearl and Poros beads, which eluted 6.2- 109and 4.0- 109vg per mL of resin (corresponding to yields of 40.8% and 43.2%, respectively). Conversely, the SulfoLink resin loaded and released up to 5.6- 1010and 8.0- 109vg / mL, corresponding to a remarkable productivity of 2.74- 1013vg per liter of resin per hour. In comparison, the productivities of AdV5 purification by CaptureSelect AdV5 affinity resin and Sepharose Q anion exchange resin are known to be 9.11 1012and 1.16 1014vg per liter of resin per hour. The larger pore diameter of polymer resin, especially Poros beads, translates in a lower specific surface and hence a lower binding capacity. Additionally, larger pores facilitate a deeper penetration of virus particles towards the bead’s core during the loading step (residence time, RT: 3.5 min), which may affect elution as the particles may not have adequate time to diffuse out from the beads. AEFFIWNA(SEQ ID NO: 3)-Toyopearl beads afforded the highest reduction values of HCPs (117-fold) and hcDNA (65-fold). Conversely, AEFFIWNA(SEQ ID NO: 3)-SulfoLink resin afforded a lower clearance of host cell proteins and nucleic acids. This may be due to the SulfoLink resin having pores whose size is comparable to the hydrodynamic diameter of the AdV particles (-100 nm) but being more tortuous than those of Toyopearl resins.

[0131] Ligand TNDGPDYSSPLTGSG (SEQ ID NO: 26) demonstrated an effective purification performance only on Toyopearl resin, achieving a yield of 50.3% and a 50-fold removal of host cell proteins. Conversely, Poros and SulfoLink resins offered insufficient product yield (21.8% and 7%, respectively).Example 6

[0132] Optimizing the AdV5 purification protocol using peptide-functionalized agarose resin Despite the significant number of active AdV5 particles eluted from AEFFIWNA(SEQ ID NO: 3)-SulfoLink resin, the value of yield, as the ratio of product recovered relative to the amountNCSU-2024-218-02NCSU-43528.601 loaded, was relatively low (-27%). Additionally, the poor removal of impurities was at odds with the inherent hydrophilicity of agarose and the weakly anionic character of its surface. These issues were attributed to the occlusion of resin pores by the AdV5 particles during loading, which resulted in low yield and the concomitant release of entrapped impurities alongside virions. Despite this, the binding capacity of the adsorbent was remarkable, and the inherent binding selectivity of the ligand can be leveraged to increase product quality. AEFFIWNA(SEQ ID NO: 3)-Toy opearl resin, while providing higher purity, afforded a significantly lower binding capacity than anion-exchange resins for AdV purification.

[0133] To improve the performance of AEFFIWNA(SEQ ID NO: 3)-Sulfolink, the chromatographic protocol prior to the elution step was modified by incorporating a secondary wash step and optimizing the residence time during the loading step. After loading the adsorbent with the HEK293F cell lysate (AdV titer of 1.6 • 109vg / mL) and conducting an initial wash with PB S at pH 7.4, a step-wise gradient of NaCl from 0.15 to 0.25 M in 50 mM phosphate buffer at pH 7.4 was applied prior to elution with 1 M NaCl in 20 mM Tris buffer at pH 8.0. The analysis of the wash and elution fractions in FIG. 11 indicated that an additional amount of host cell proteins was removed during the wash step and that monomeric hexon proteins (-116 kDa) were released as the salt concentration increased up 0.25 M NaCl, yet without suffering huge loss of AdV virions. The analysis of the chromatographic effluents by RT-qPCR (FIG. 11B) indicated only a small fraction of the encapsidated transgenes loaded on the resin was lost throughout the six wash fractions (5.4% and 3.2% in W1 and W6, respectively). Accordingly, the bands identified in the electrophoretic analysis in FIG. 11A can be reliably attributed to monomeric capsid proteins or capsomers, rather than full virions. Notably, the analysis of the eluted fraction indicated that the product yield rose to 56.1% and the HCP LRV reached 1.76. Notably, the removal of product- related impurities (e.g., empty capsids and capsid proteins) by the additional wash step significantly improved product safety by reducing immunogenic species without affecting the integrity of the eluted product.

[0134] The results reported above were obtained by loading the feedstock on the columns at the RT of 3.5 min. During the load step, it was observed that the AdV5 titer in the effluent (CFT) fluctuated significantly (FIG. 16). The capture of a large virus using a small linear peptide ligand may lead to a “supersaturated” binding state when the adsorbent is loaded at higher residence time: during the first phase of loading, the virus saturates the binding sites on the resin; as the loadNCSU-2024-218-02 NCSU-43528.601 progresses, virus adsorption reaches a supersaturated state; additional virus particles (or capsomers and monomeric capsid proteins) disrupt the supersaturated state, releasing a wave of virus in the effluent (recorded spike in CFT) that frees binding sites on the resin’s surface; additional loading allows reaching a second supersaturated state, creating cycles of unstable adsorption and desorption that translate in a fluctuating temporal profile of CFT. TO test this, the loading flow rate was increased, a lower residence time, from 3.5 to 2 min, may postpone the formation of a supersaturated state. The breakthrough curves obtained with AEFFIWNA(SEQ ID NO: 3)- Toyopearl, and TNDGPDYSSPLTGSG (SEQ ID NO: 26)-Toyopearl resins at the RT of 2 min showed a conventional profile (FIG. 12), with CFT rapidly reaching the feedstock titer after saturation. The resultant values of dynamic binding capacities (DBCio%), summarized in Table 3, consistently indicated that higher binding was achieved at lower residence time, which conducive to higher productivity. Notably, the binding capacity of AEFFIWNA(SEQ ID NO: 3)- functionalized resin is higher than that of its commercial counterpart CaptureSelect AdV5 affinity resin when operated at higher flow rate, demonstrating the potential of peptide AEFFIWNA (SEQ ID NO: 3) as an affinity ligand for the purification of AdV-based therapies.

[0135] Table 3 : Values of dynamic AdV5 binding capacity (DBCio%) of AEFFIWNA(SEQ ID NO: 3)- and TNDGPDYSSPLTGSG (SEQ ID NO: 26)-functionalized resins loaded with a clarified HEK293 cell lysates at different loads and at the RT of either 2 or 3.5 min. The AdV5 titer of 2 min and 3.5 min is the average of two loadings, and there are differences in virus loading concentrations.NCSU-2024-218-02NCSU-43528.601

[0136] To evaluate the purification performance of AEFFIWNA(SEQ ID NO: 3)-Sulfolink resin, the loading RT was reduced to 2 min and the wash and elution steps were modified (e.g., first wash with PBS at pH 7.4; second wash with 0.25 M in 50 mM phosphate buffer at pH 7.4; elution with 1 M NaCl in 20 mM Tris buffer at pH 8.0). The chromatograms are collated in FIG. 18. The results in FIG. 13A indicate that product yield grew from 43.2% to 51.2%, in line with the values characteristics of anion exchange chromatography, while the reduction of HCPs and hcDNA rose to 144-fold and 20-fold, respectively. This protocol was implemented on the AEFFIWNA(SEQ ID NO: 3)-SulfoLink resin. Clarified lysates with AdV5 titers of ~5 109and ~2.0- 1010vg / mL were produced, which allowed evaluation of the combined effects of loading titer and flow rate on product yield and quality. The combination of higher feedstock concentration and flow rate shortened the loading phase, thus increasing productivity. Furthermore, loading 10 CVs of feedstock at 5.2- 109vg / mL and 5 CVs of feedstock at -2.0- 1010vg / mL increased product yield to 51.2% and 61.8%, respectively. In particular, the amount of AdV present in the first 5 CVs of elution increased from 30.7% to 54.8%, indicating that increasing the product titer in the load and reducing the loading time are conducive to increasing both yield and productivity. In sum, the AdV purification protocol using AEFFIWNA(SEQ ID NO: 3)-functionalized resins include conducting (i) a shorter column loading at high product titer; (ii) two wash steps, respectively with PBS at pH 7.4 (5 CVs) and 0.25 M NaCl at pH 7.4; and (iii) elution with 1 M NaCl at pH 8.0. This process delivered yield of encapsi dated genomes and cell -transducing virions respectively of 51.2% and 50.1% (corresponding to an eluate titer of 3.3 107IFU / mL), along with an HCP LRV -2.2 and hcDNA LRV -1.3.

[0137] Selected chromatographic fractions were analyzed by SDS-PAGE and analytical size exclusion chromatography (SEC-HPLC), which provide an at-a-glance rendition of product concentration and impurity removal. The electrophoretic analysis of the eluates in FIG. 13B shows the presence of AdV capsid proteins, namely the monomeric and trimeric hexons (117 and 350 kDa; these bands have been attributed to the AdV transgene), pentons and fibers (75 and 70 kDa, respectively), and proteins V, VI, and VII (48 kDa, -24 kDa, and -18 kDa, respectively). The analytical chromatograms of the load and elution fractions obtained using two SEC columns with different exclusion limits provide further insight into the clearance of impurities in the flow-NCSU-2024-218-02NCSU-43528.601 through and wash fractions (exclusion limit of 200 A in FIG. 13C) and the purity of the eluted AdVs (2000 A in FIG. 13D). The chromatograms of the load and flow through fractions in FIG. 13C present a large amount of host cell proteins (retention time ~11 - 24 min); conversely, the eluate features two main peaks, corresponding to the whole AdV5 (-9 min) and the hexon trimer (-10 min). The AdV-associated peaks observed in the flow-through fraction suggest a slight overloading of the column, but they may also be caused by large, product-related impurities (e.g., empty capsids and capsomers) whose size is above the exclusion limit of the SEC column. A second SEC column, with larger exclusion limit, was adopted to better visualize the purity of eluted AdV5. The analytical chromatogram of the eluate in FIG. 13D presents the peaks corresponding to the whole AdV5 (- 7 - 7.5 min) and the hexon trimer (-8 min), and almost no residual impurities (> 8.5 min); conversely, the latter form the majority of the species found in the chromatograms of the flow-through and wash fractions.

[0138] Collectively, these results demonstrated that the optimization of the virus titer in the lysate and of the chromatographic protocol grant high binding capacity and productivity of the affinity capture step along with excellent product yield (-55% of encapsidated genomes and 50% of cell-transducing viral units) and quality in the eluate (residual titer of HCP -0.9 pg / mL and hcDNA -70 ng / mL). Despite the improvements compared to the initial studies in Examples 1-3, the product yield (-50%) remains suboptimal. To explain the retention of a significant fraction of active AdVs within the chromatographic beads two mechanisms may be responsible: some virions (i) establish multiple ligand interactions resulting in nearly irreversible binding (avidity), or (ii) become physically entrapped within the intricate pore structures in the internal volume of the beads. Chromatographic procedures typically involve an extended loading phase of the feedstock, during which the virions have sufficient time (and concentration gradient) to diffuse deeply into the beads. Conversely, the elution phase is considerably shorter, approximately one fifth of the loading phase, thus allowing only virions with relatively low binding affinity and sufficient proximity to the bead surface to elute effectively. These phenomena have been documented in a recent study on the elution of adeno-associated viruses (AAVs) from an affinity matrix based on Poros™ beads; the entrapment AAVs, which are substantially smaller than AdVs, supports the likelihood of size- and avidity -retention of AdVs in chromatographic resins. The use of convective substrates, such as monoliths and membranes, may mitigate diffusion limitations and enhance viral vector yield and process productivity.NCSU-2024-218-02NCSU-43528.601Example 7

[0139] Lifetime and performance of the affinity resin in a platform AdV purification process The manufacturing of AdVs for oncolytic and vaccine applications currently relies on processes that employ anion-exchange resins or membranes operated in bind-and-elute mode for product capture and size-exclusion-mixed-mode chromatography in flow-through mode for product polishing. The disclosed peptide-functionalized resins, with their excellent binding capacity and purification performance, are excellent candidates as affinity adsorbents for product capture in a new AdV purification platform. Furthermore, these adsorbents can process cell lysates without prior conditioning and release the product under the same elution conditions employed with anion-exchange adsorbents. A platform AdV purification process comprising three steps was assembled: (i) clarification of the HEK293 cell lysate by depth filtration (of note, the UF / DF step was omitted), (ii) product capture and purification by affinity chromatography in bind-and-elute mode using a peptide-functionalized affinity resin, and (iii) polishing by size-exclusion-mixed- mode chromatography using Capto Core 700 resin in flow-through mode (FIG. 14A).

[0140] As the resin with the highest purification performance across multiple reuses, AEFFIWNA(SEQ ID NO: 3)-SulfoLink resin was adopted as affinity resin for the capture step in the platform purification process outlined above. The values of step and global recovery and removal of host cell proteins reported in Table 4 demonstrate the effectiveness of the proposed technology for AdV purification. The global product yield of -55% aligns with the values obtained with processes that utilize anion-exchange resins and membranes (50 - 55%) (Anon, 2019; Peixoto et al., 2006). Most notably, the HCP titer was decreased ~10, 000-fold, from 0.1 mg / mL to 9.3 ng / mL; similarly, the hcDNA level was lowered ~ 500-fold, from 5 pg / mL to 8.76 ng / mL, which is particularly remarkable since no DNase was utilized in the process.

[0141] The ability of an affinity resin to serve in an industrial process, especially one for manufacturing vaccines, whose price is expected to be lower than biological therapeutics, depends on its cost-effectiveness and lifetime. Linear peptide ligands, being produced synthetically, are significantly safer and more affordable than protein ligands produced recombinantly in bacterial systems, such as Protein A and the camelid ligands used for AAV purification. Specifically, the Cost of Goods Manufactured (CoGM) of AEFFIWNA(SEQ ID NO: 3)-functionalized resin is approximately S6.5-7.5K per liter when produced at beyond 10 liters scale. To assay the stabilityNCSU-2024-218-02NCSU-43528.601 of the resin 10 cycles of AdV5 purification, each followed by a harsh cleaning-in-place (CIP): 10% v / v phosphoric acid (pH < 2), was used for AEFFIWNA(SEQ ID NO: 3)-Toyopearl, while 0.1 M glycine buffer at pH 2.0 was adopted for the CIP of AEFFIWNA(SEQ ID NO: 3)-Sulfolink resin.

[0142] The resulting values of product yield and purity obtained with AEFFIWNA(SEQ ID NO: 3)-functionalized resins across multiple purification cycles are collated in FIG. 14B and 14C, while the corresponding results obtained with TNDGPDYSSPLTGSG (SEQ ID NO: 26)- Toyopearl are in FIG. 19. All the corresponding chromatograms are collated in FIG. 20. The affinity adsorbents, loaded to a ratio of -2.6 1O10vg per mb of resin (108% of DBCio%), did not show loss of binding capacity or selectivity across the successive purification cycles, affording average yields above 50%; the AEFFIWNA(SEQ ID NO: 3)-functionalized resins provided HPC LRVs ~ 2.0 - 2.3. The fluctuations in product yield and purity result from the inherent variability of cell lysates containing viral vectors and the analytical assays but are consistent with the values recorded in prior work on the purification of AAVs and LVVs.

[0143] Table 4: Values of AdV5 step and global recovery, removal of HEK293 HCPs and hcDNA, concentration factor, and total particles (TP) to infectious particles (IP) ratio obtained by purifying AdV5 from a HEK293 cell lysate (AdV5 titer ~1 IO10vg / mL; HCP titer -0.15 mg / mL) using the process in FIG. 14A (clarification: 0.45 um membrane sterile filtration; affinity capture: AEFFIWNA(SEQ ID NO: 3)- SulfoLink resin).Example 8

[0144] Measuring the cell-transduction activity of purified AdV5. To evaluate the activity of the AdV5 eluted from peptide-functionalized resins, transduction and transfection assays were performed. The AdVs encapsidated a transgene encoding for green fluorescent protein (GFP), which enables the quantification of the cell-transducing viral particles by fluorescence flow cytometry. However, during the incubation time required to complete a comprehensiveNCSU-2024-218-02NCSU-43528.601 transduction assay, the host cells developed cytopathic effects leading to significant cell death and a decline in cell growth. Consequently, despite observing a strong green fluorescent signal during flow cytometry, the limited cell counts prevented the derivation of quantitative metrics. Nonetheless, the qualitative observation of the pronounced fluorescent signal documented the transduction capability of the purified AdV5. In lieu of the transduction assay, a label-free cytopathic effect (CPE) assay was employed to assess the tissue culture infectious dose (TCID50) of AdV5 in the clarified lysates and the affinity eluates. A microscopic illustration of the cytopathic effect is presented in FIG. 15. Because AdVs cannot be propagated in Vero cells without introducing exogenous El, HEK293 adherent cells were utilized for all TCID50 assays. Aligning with the values of yield of encapsidated transgenes measured by RT-qPCR, the transfection assays returned values of yield from HEK293 and Vero cell lysates of 46.4% and 43.1% using AEFFIWNA(SEQ ID NO: 3)-Toyopearl® resin, and 50.1% and 43.6% using TNDGPDYSSPLTGSG (SEQ ID NO: 26)-Toy opearl® resin (Table 7). These results confirm that the selected peptide ligands yield a product with high purity and activity under mild conditions, validating the ligand development strategy presented in prior work.NCSU-2024-218-02NCSU-43528.601

[0145] Table 5: Values of adsorption and desorption constants (kads and kdes) and affinity constant (KA,SPR) of AdV5 hexon:peptide binding obtained via surface plasmon resonance (SPR) and corresponding values of affinity constant obtained via molecular docking and dynamics simulations (K.A.in-siiico).

[0146] Table 6. Peptide ligands purification results and purification condition. All wash steps were run for 20 CV and all regeneration steps were run for 10 CV. The 10 CV loading step utilized a residence time of 3.5 mins.NCSU-2024-218-02NCSU-43528.601NCSU-2024-218-02NCSU-43528.601NCSU-2024-218-02NCSU-43528.601

[0147] Table 7: Purification of AdV5 from clarified HEK293 and Vero cell lysates using AEFFIWNA(SEQ ID NO: 3)-Toyopearl® and TNDGPDYSSPLTGSG (SEQ ID NO: 26)-Toy opearl® resins. The lysates were loaded at the residence time of 3.5 min to a ratio of 5 • 109vg per mL of resin. The bound AdV5 were eluted in 20 mM Tris buffer with 1 M NaCl at pH 8.0. The values of AdV5 titer were measured via RT-qPCR (encapsi dated transgenes) and TCID50 assays (cell-transducing units); the HCP and hcDNA titers were measured by analyzing the eluates and corresponding feedstocks using ELISA and PicoGreen™ dsDNA assay kits.

[0148] Table 8: Purification of AdV5 from clarified a HEK293 cell lysate using different chromatographic resins functionalized with peptide ligands AEFFIWNA (SEQ ID NO: 3) and TNDGPDYSSPLTGSG (SEQ ID NO: 26). The lysates were loaded at the residence time of 3.5 min to a ratio of 5- 1010 vg per mL of resin. The bound AdV5 were eluted in 20 mM Tris buffer with 1 M NaCl atNCSU-2024-218-02NCSU-43528.601 pH 8.0. The values of AdV5 titer were measured via RT-qPCR (encapsidated transgenes) and TCID50 assays (cell-transducing units); the HCP and hcDNA titers were measured by analyzing the eluates and corresponding feedstocks using ELISA and PicoGreen™ dsDNA assay kits.

Claims

NCSU-2024-218-02NCSU-43528.601CLAIMSWhat is claimed is:

1. A peptide for purifying an adenovirus from a sample, wherein the peptide comprises an amino acid sequence having at least 80% sequence identity with one of SEQ ID NOs: 1-25.

2. The peptide of claim 1, wherein the peptide comprises an amino acid sequence having one of SEQ ID NOs: 1-25.

3. The peptide of claims 1 or 2, wherein the peptide comprises an amino acid sequence having one of SEQ ID NOs: 1-5.

4. The peptide of claim 1, wherein the peptide comprises an amino acid sequence having 1, 2, 3, 4, or 5 substitutions as compared with the amino acid sequence of any one of SEQ ID NOs: 1-25.

5. The peptide of claim 1 or 4, wherein the peptide comprises an amino acid sequence having 1, 2, 3, 4, or 5 substitutions as compared with the amino acid sequence of any one of SEQ ID NOs: 1-5.

6. The peptide of any one of claims 1-5, wherein the peptide further comprises a linker.

7. The peptide of claim 6, wherein the linker is bound to the C-terminus of the peptide, and wherein the linker is a glycine-rich linker or an alanine-rich linker.

8. A composition for purifying an adenovirus from a sample comprising at least one peptide of any one of claims 1-7.

9. The composition of claim 8, wherein the at least one peptide is bound to a solid support.

10. The composition of claim 9, wherein the solid support comprises a non-porous or porousNCSU-2024-218-02NCSU-43528.601 particle, a membrane, a plastic surface, a fiber or a woven or non-woven fibermat, a hydrogel, a microplate, a monolith, and / or a microfluidic device.

11. The composition of claim 9 or 10, wherein the solid support comprises polymethacrylate, polyolefin, polyester, polystyrene, polysaccharide, polyether, silica, iron oxide, silica, titania, and / or zirconia.

12. An adsorbent comprising at least one peptide of any one of claims 1-7 or a composition of any one of claims 8-11.

13. The adsorbent of claim 12, wherein the adsorbent has a binding capacity of at least 109viral particles per mb of adsorbent (vp / mL).

14. The adsorbent of claim 12 or 13, wherein the adsorbent has a binding capacity of at least IO10vp / mL.

15. The adsorbent of claim 12, wherein the adsorbent has a binding capacity of at least 109encapsidated transgenes per mL of adsorbent (vg / mL).

16. The adsorbent of claim 12 or 13, wherein the adsorbent has a binding capacity of at least IO10vg / mL.

17. The adsorbent of claim 12 or 13, wherein the adsorbent has a binding capacity of at least about 1010cell-transducing units per mL of adsorbent (TU / mL).

18. A method of purifying an adenovirus from a sample, the method comprising: contacting at least one peptide of any one of claims 1-7, the composition of any one of claims 8-11, or the adsorbent of any one of claims 12-17, with a sample comprising the adenovirus, wherein the at least one peptide binds the adenovirus; and eluting the adenovirus from the at least one peptide.NCSU-2024-218-02NCSU-43528.60119. The method of claim 18, wherein the sample is a biological fluid.

20. The method of claim 19, wherein the biological fluid is a cell culture fluid.

21. The method of claim 18 or 19, wherein the biological fluid comprises a supernatant and / or a cellular lysate.

22. The method of any one of claims 18-21, wherein the biological fluid is derived from a virus production cell line.

23. The method of claim 22, wherein the virus production cell line comprises one or more of MDCK-S cells, MDCK-A cells, Vero cells, LLC-MK2D cells, PER.C6 cells, EB66 cells, AGE1.CR cells, HT1080 cells, and HeLa cells, or any derivatives or variants thereof.

24. The method of any one of claims 18-23, wherein the elution of adenovirus is performed at pH from about 5.0 to about 9.0.

25. The method of any one of claims 18-24, wherein the elution is performed at pH of about 8.0.

26. The method of any one of claims 18-25, wherein the method further comprises a washing step before eluting the adenovirus.

27. The method of any one of claims 18-26, wherein the method produces at least a 50-fold reduction in host cell proteins as compared to the sample.

28. The method of any one of claims 18-26, wherein the method produces at least a 100-fold reduction in host cell proteins as compared to the sample.

29. The method of any one of claims 18-28, wherein the methods produce at least a 7-fold reduction in host cell DNA as compared to the sample.NCSU-2024-218-02NCSU-43528.60130. The method of any one of claims 18-29, wherein the methods produce at least a 60-fold reduction in host cell DNA as compared to the sample.

31. The method of any one of claims 18-30, wherein the method results in at least a 20% yield for encapsidated transgene.

32. The method of any one of claims 18-31, wherein the method results in at least a 35% yield for encapsidated transgene.

33. The method of any one of claims 18-32, wherein the method results in at least a 30% yield for cell-transducing units.

34. The method of any one of claims 17-33, wherein the method results in at least a 40% yield for cell-transducing units.

Citation Information

Patent Citations

  • Methods for genetic control of plant pest infestation and compositions thereof

    US20070271630A1

  • Method for the purification of virus

    WO1998041618A1

Cited By

  • Preparation method of low-host DNA (deoxyribonucleic acid) in human adenovirus preparation

    CN122097436A