Method for detecting catalytic function of carrot lycopene beta-cyclase protein

Abstract

The invention discloses a method for detecting the protein catalytic function of carrot lycopene beta-cyclase, and belongs to the technical field of protein catalytic function detection. According to the method for detecting the catalytic function of the carrot lycopene beta-cyclase protein, escherichia coli is used as a heterologous expression host, a lycopene substrate is accumulated in the escherichia coli by expressing pACCRT-EIB plasmids, then lycopene epsilon-cyclase protein and lycopene beta-cyclase are constructed on the same carrier for co-expression, and the lycopene beta-cyclase protein is obtained. A monocyclic carotene intermediate product in the process of converting lycopene into carotene is introduced into a reaction system so as to detect the substrate preference and functional difference of two lycopene beta-cyclase isoenzymes. The method is easy to operate, expression in an escherichia coli system is convenient and rapid, various lycopene beta-cyclase catalytic substrates except lycopene can be provided, and the catalytic function of lycopene beta-cyclase protein can be identified more accurately.

Description

Technical Field

[0001] The invention relates to the technical field of protein catalytic function detection, and more specifically to a method for detecting the catalytic function of carrot lycopene beta-cyclase protein. Background Art

[0002] Carotenoids are widely present in all photosynthetic organisms as well as some non-photosynthetic prokaryotes, fungi and a few animals. Under the action of multiple catalytic enzymes, the substrate geranylgeranyl pyrophosphate of the carotenoid biosynthesis pathway forms the linear carotenoid lycopene step by step. This also marks that the biosynthesis pathway of carotenoids has reached the key branch point - lycopene cyclization. The cyclization of lycopene is completed by lycopene cyclase. Different types of lycopene cyclases form ring structures of different configurations (ε-ring or β-ring) at both ends of lycopene, thereby producing cyclized carotenes, mainly β-carotene, and α-carotene is mainly accumulated in plants and some algae. In non-photosynthetic and anaerobic photosynthetic bacteria, lycopene cyclase is encoded by the crtY gene and is relatively conservative. In oxygenic photosynthetic organisms, lycopene cyclase is encoded by the crtL gene. The carotenoid pathway in fungi is relatively simple, with lycopene cyclase and phytoene synthase encoded by the same gene, producing a bifunctional enzyme similar to crtY and crtB. Lycopene cyclase in plants can be divided into lycopene ε-cyclase (LcyE) and lycopene β-cyclase (LcyB), which are responsible for the formation of ε-ring and β-ring, respectively. With the evolution and expansion of plant genomes, the lycopene cyclase gene has gradually undergone multiple duplications, and its functions have also diverged, which may be redundant or complementary.

[0003] Microbial lycopene cyclase is often used to produce carotenoids, especially β-carotene, using microbial cell factories. The chemical mechanism, substrate specificity and activity of lycopene cyclase can be further applied to the optimization of carotenoid synthesis technology. There are three genes encoding lycopene cyclase in carrots, one is DcLcyE, which encodes lycopene ε-cyclase, and two are DcLcyB1 and DcLcyB2, which encode lycopene β-cyclase. Research on the function of plant lycopene β-cyclase mainly focuses on two aspects: carotenoid accumulation and stress resistance. Experiments in tobacco have shown that carrot DcLcyB1 and DcLcyB2 can enhance stress resistance by regulating carotenoid, gibberellin and chlorophyll metabolic pathways, and transgenic tobacco plants also have changes in plant growth and hormone metabolism. In terms of carotenoid synthesis regulation, although it is known that DcLcyB protein can catalyze the cyclization of lycopene to form β-ring, the functional differences such as substrate preference of the two DcLcyB proteins in the catalytic reaction are still unclear. Based on this, there is an urgent need to develop methods that can detect the catalytic activity of lycopene β-cyclase protein, especially to analyze the functional differences between the two isozyme proteins.

[0004] Therefore, providing a method for detecting the catalytic function of carrot lycopene β-cyclase protein is an urgent problem to be solved by those skilled in the art. Summary of the invention

[0005] In view of this, the present invention provides a method for detecting the catalytic function of carrot lycopene β-cyclase protein, using Escherichia coli as a heterologous expression host, accumulating lycopene substrate in Escherichia coli by expressing pACCRT-EIB plasmid, and co-expressing lycopene ε-cyclase protein and lycopene β-cyclase on the same vector, introducing a monocyclic carotene intermediate in the process of lycopene conversion to carotene into the reaction system, so as to detect the substrate preference and functional difference of two lycopene β-cyclase isozymes. The method is simple to operate, convenient and fast to express in the Escherichia coli system, and can provide a variety of lycopene β-cyclase catalytic substrates other than lycopene, and can more accurately identify the catalytic function of lycopene β-cyclase protein.

[0006] In order to achieve the above object, the present invention adopts the following technical solution: A method for detecting the catalytic function of carrot lycopene β-cyclase protein, comprising the following steps: S1. Expressing the pACCRT-EIB plasmid in competent E. coli cells to obtain an E. coli prokaryotic expression system capable of accumulating lycopene; pACCRT-EIB plasmid: see Misawa, N., Satomi, Y., Kondo, K., Yokoyama, A.,Kajiwara, S., Saito, T. et al. (1995) Structure and functional analysis of amarine bacterial carotenoid biosynthesis gene cluster and astaxanthinbiosynthetic pathway proposed at the gene level. Journal of Bacteriology, 177(22), 6575–6584. S2, constructing a DcLcyE-DcLcyB1 protein co-expression vector and a DcLcyE-DcLcyB2 protein co-expression vector, transforming the DcLcyE-DcLcyB1 protein co-expression vector, the DcLcyE-DcLcyB2 protein co-expression vector and the DcLcyE protein expression vector into the Escherichia coli prokaryotic expression system, respectively, adding them to LB liquid culture medium, shaking and culturing at 37°C and 220 rpm for 16-24 h, and culturing in the dark to prevent light from causing carotenoid degradation; S3, collecting Escherichia coli cells that co-express DcLcyE-DcLcyB1 protein and DcLcyE-DcLcyB2 protein respectively; S4. Extract and determine carotenoids in Escherichia coli cells, and evaluate the catalytic activity of DcLcyB protein based on the types and contents of carotenoids.

[0007] Further, in step S1, the E. coli competent cells are E. coli BL21 (DE3) competent cells.

[0008] Furthermore, in step S1, constructing the Escherichia coli prokaryotic expression system for accumulating lycopene comprises the following steps: S11, the pACCRT-EIB plasmid was transformed into E. coli BL21 (DE3) competent cells by heat shock transformation method to obtain E. coli colonies; S12. Expand the cultured E. coli colonies, prepare competent cells using the calcium chloride method, and obtain E. coli competent cells that accumulate lycopene.

[0009] Further, in step S2, constructing the DcLcyE-DcLcyB1 protein co-expression vector and the DcLcyE-DcLcyB2 protein co-expression vector comprises the following steps: S21, synthesized DcLcyE-2A-DcLcyB1 sequence and DcLcyE-2A-DcLcyB2 sequence; the DcLcyE-2A-DcLcyB1 sequence is shown in SEQ ID NO.1; the DcLcyE-2A-DcLcyB2 sequence is shown in SEQ ID NO.2; S22. Use restriction endonuclease to linearize the protein expression vector, and construct the DcLcyE-2A-DcLcyB1 sequence and the DcLcyE-2A-DcLcyB2 sequence into the protein expression vector by recombination method to obtain the LcyE-LcyB1 protein co-expression vector and the LcyE-LcyB2 protein co-expression vector.

[0010] Furthermore, the protein expression vector is pET30a.

[0011] Furthermore, in step S2, the DcLcyE-DcLcyB1 protein co-expression vector and the DcLcyE-DcLcyB2 protein co-expression vector are respectively transferred into lycopene-accumulating Escherichia coli competent cells by heat shock method.

[0012] Further, in step S3, collecting Escherichia coli cells that co-express DcLcyE-DcLcyB1 protein and DcLcyE-DcLcyB2 protein comprises the following steps: S31, inoculate the transformed E. coli colony into LB medium, culture at 37℃ 220rpm, and grow the E. coli to OD 600 When the pH value is 0.5-0.6, 0.1 M IPTG (isopropyl-β-D-thiogalactoside) is added for induction and cultured overnight to obtain Escherichia coli bacterial solution; S32. Transfer the E. coli culture liquid to a centrifuge tube, centrifuge at 4000 rpm at 4℃ for 10 min, remove the supernatant; add ddH2O and resuspend, and centrifuge again to collect the E. coli cells.

[0013] Further, in step S4, extracting and determining carotenoids in Escherichia coli cells comprises the following steps: S41, freeze-drying the Escherichia coli cells in a vacuum environment for 12 h, weighing the freeze-dried powder of the cells, and repeatedly leaching in acetone until the powder becomes colorless to obtain an extract; S42. The extract was separated and determined by ultra-high performance liquid chromatography and tandem mass spectrometry. The liquid phase conditions were as follows: chromatographic column YMC C30 column (100 mm×2.0 mm; 3 μm); mobile phase A: methanol / acetonitrile (V / V) = 1:3, with 0.01% BHT (butylated hydroxytoluene) and 0.1% formic acid added; phase B: methyl tert-butyl ether, with 0.01% BHT added; gradient elution program: 0-3 min A / B was 100:0 (V / V), 3-5 min A / B was 30:70 (V / V), 5-9 min A / B was 5:95 (V / V), 9-11 min A / B was 100:0 (V / V); flow rate was 0.8 mL / min; column temperature was 28°C; injection volume was 2 μL; mass spectrometry conditions were as follows: atmospheric pressure chemical ion source temperature was 350°C, curtain gas was 25 psi; scan and detect each ion pair according to the optimized declustering voltage and collision energy; S43. MultiQuant 3.0.3 software was used to process mass spectrometry data. The chromatographic peaks detected in different samples of the analyte were integrated and corrected with reference to the retention time and peak shape information of the standard. A standard curve was drawn based on the concentration and ion current intensity of the standard. The peak area of ​​the test sample was substituted into the standard curve to convert the content of various carotenoids.

[0014] It can be seen from the above technical scheme that compared with the prior art, the present invention discloses a method for detecting the catalytic function of carrot lycopene β-cyclase protein. The Escherichia coli prokaryotic expression system is used as the heterologous expression host of the lycopene cyclase protein. The exogenous protein is easy to achieve efficient expression in Escherichia coli and can be rapidly propagated, thereby achieving a large amount of product accumulation. The type and content of the cyclized carrot product are detected by ultra-high performance liquid chromatography tandem mass spectrometry, which has the characteristics of simple operation and high sensitivity. In addition, the DcLcyE-DcLcyB protein is co-expressed by connecting two proteins in series through the 2A sequence, and the intermediate product monocyclic carotene of the reaction is introduced into the reaction system, which can provide more substrate information for the catalytic activity and improve the accuracy of catalytic function identification. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0016] Figure 1This is the total ion current chromatogram of carotenoid analysis of Escherichia coli expressing pACCRT-EIB plasmid by liquid chromatography-mass spectrometry. The arrow indicates lycopene and the upper left corner is the phenotype of Escherichia coli.

[0017] Figure 2 This is the total ion current chromatogram of carotenoids analyzed by LC-MS of Escherichia coli co-expressing pACCRT-EIB and DcLcyE-2A-DcLcyB1 plasmids; the arrow indicates β-carotene; the small orange box represents the peak position of α-carotene in the total ion current chromatogram, the large orange box is the single substance ion current chromatogram of α-carotene extracted based on the total ion current chromatogram peak, and 5.99 indicates the peak time; the small yellow box represents the peak position of γ-carotene in the total ion current chromatogram, the large yellow box is the single substance ion current chromatogram of γ-carotene extracted based on the total ion current chromatogram peak, and N / A means not detected; the upper left corner is the phenotype of Escherichia coli.

[0018] Figure 3 This is the total ion current chromatogram of carotenoids analyzed by LC-MS of Escherichia coli co-expressing pACCRT-EIB and DcLcyE-2A-DcLcyB2 plasmids; the arrow indicates β-carotene; the small orange box represents the peak position of α-carotene in the total ion current chromatogram, the large orange box is the single substance ion current chromatogram of α-carotene extracted based on the total ion current chromatogram peak, and 5.99 indicates the peak time; the small yellow box represents the peak position of γ-carotene in the total ion current chromatogram, the large yellow box is the single substance ion current chromatogram of γ-carotene extracted based on the total ion current chromatogram peak, 7.44 indicates the peak time, and the upper left corner is the E. coli bacterial phenotype. DETAILED DESCRIPTION

[0019] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0020] Example 1 Analysis of the catalytic activity of two lycopene β-cyclases DcLcyB1 and DcLcyB2 in carrots The relevant sequences for the construction of DcLcyE-2A-DcLcyB co-expression vector are as follows: The artificially synthesized DcLcyE-2A-DcLcyB1 sequence is shown in SEQ ID NO.1.

[0021] ATGGAGTCGTACTGCATAGGTGGATCTGATCAAAGATAGAGAATAG ; SEQ ID NO.1.

[0022] In SEQ ID NO.1, 1-1590 bp is the DcLcyE sequence, 1591-1656 bp is the 2A connection fragment, and 1657-3183 bp is the DcLcyB1 sequence.

[0023] The artificially synthesized DcLcyE-2A-DcLcyB2 sequence is shown in SEQ ID NO.2.

[0024] ATGGAGTCGTACTGCATAGGTGGATTTAGCTGTTGAGACTATTTGA ; SEQ ID NO.2.

[0025] In SEQ ID NO.2, 1-1590 bp is the DcLcyE sequence without the stop codon, 1591-1656 bp is the 2A connection fragment, and 1657-3135 bp is the DcLcyB2 sequence.

[0026] The artificially synthesized DcLcyE sequence is shown in SEQ ID NO.3.

[0027] ATGGAGTCGTACTGCATAGGTGGTAAAAACATATTTAACGG CCTAG ; SEQ ID NO.3.

[0028] The synthesized gene fragments DcLcyE-2A-DcLcyB1, DcLcyE-2A-DcLcyB2 and DcLcyE were amplified by PCR using PrimeStar Max DNA Polymerase high-fidelity enzyme (Takara, R045a) to connect the vector homology arms and restriction site sequences to both ends of the gene fragments. The primer sequences used are as follows: DcLcyE-pET30-F:GCCATGGCTGATATCGGATCC ATGGAGTCGTACTGCATAGGTGG ; SEQ ID NO.4.

[0029] DcLcyE-pET30-R: GCAAGCTTGTCGACGGAGCTC CTAGGCCGTTAAATATGTTTTTA ; SEQ ID NO.5.

[0030] DcLcyB1-pET30-R: GCAAGCTTGTCGACGGAGCTC CTATTCTCTATCTTTGATCAGAT ; SEQ ID NO.6.

[0031] DcLcyB2-pET30-R: GCAAGCTTGTCGACGGAGCTC TCAAATAGTCTCAACAGCTAAAT ; SEQ ID NO.7.

[0032] The DcLcyE-2A-DcLcyB1 fragment was amplified using DcLcyE-pET30-F / DcLcyB1-pET30-R, the DcLcyE-2A-DcLcyB2 fragment was amplified using DcLcyE-pET30-F / DcLcyB2-pET30-R, and the DcLcyE fragment was amplified using DcLcyE-pET30-F / DcLcyE-pET30-R as a control.

[0033] PCR reaction system: PrimeSTAR Max Premix (2X) 25 μL, upstream and downstream primers 0.25 μM each, gene fragment 200 ng, ddH2O to 50 μL.

[0034] PCR amplification program: pre-denaturation at 98°C for 5 min; denaturation at 98°C for 10 s, annealing at 55°C for 15 s, extension at 72°C for 30 s, for a total of 35 cycles, and extension at 72°C for 10 min.

[0035] The amplified fragment was recombined between the BamHI and SacI vectors of the pET30a vector using 2×MultiF Seamless Assembly Mix homologous recombinase (ABclonal, RK21020). The reaction system was: 2X MultiF Seamless Assembly Mix 10 μL, pET30a vector 100 ng, fragment 100 ng, ddH2O supplemented to 20 μL; recombination reaction procedure: 50℃ 15 min. The DcLcyE-DcLcyB1 protein co-expression vector, DcLcyE-DcLcyB2 protein co-expression vector and DcLcyE protein expression vector were obtained.

[0036] The pACCRT-EIB plasmid was transformed into E. coli BL21 (DE3) competent cells by heat shock transformation method to obtain E. coli colonies; the obtained E. coli colonies were expanded and competent cells were prepared by calcium chloride method to obtain E. coli competent cells accumulating lycopene.

[0037] The DcLcyE-DcLcyB1 protein co-expression vector, DcLcyE-DcLcyB2 protein co-expression vector and DcLcyE protein expression vector were respectively transferred into lycopene-accumulating Escherichia coli competent cells by heat shock method; the transformed Escherichia coli colonies were inoculated into LB medium and cultured at 37℃ 220 rpm until the Escherichia coli grew to OD 600 When the pH was 0.5, 0.1 M IPTG was added for induction and cultured for 16 h to obtain E. coli culture. The E. coli culture was transferred to a centrifuge tube and centrifuged at 4000 rpm for 10 min at 4°C to remove the supernatant. After adding ddH2O, the suspension was resuspended and centrifuged again to collect the E. coli cells.

[0038] Escherichia coli cells were vacuum freeze-dried for 12 h, and the freeze-dried powder of the cells was weighed and repeatedly extracted in acetone until it was colorless to obtain an extract; the extract was separated and determined by ultra-performance liquid chromatography and tandem mass spectrometry, and the liquid phase conditions were as follows: chromatographic column YMC C30 column (100 mm×2.0 mm; 3 μm); mobile phase A: methanol / acetonitrile (V / V) = 1:3, added with 0.01% BHT and 0.1% formic acid; phase B: methyl tert-butyl ether, added with 0.01% BHT; gradient elution program: 0-3 min A / B is 100:0 (V / V), 3-5 min A / B is 30:70 (V / V), 5-9 min A / B is 5:95 (V / V), 9-11 min A / B is 100:0 (V / V); flow rate is 0.8 mL / min; column temperature is 28℃; injection volume is 2 μL; mass spectrometry conditions are as follows: atmospheric pressure chemical ion source temperature 350℃, curtain gas 25 psi; scan and detect each ion pair according to the optimized declustering voltage and collision energy; use MultiQuant 3.0.3 software to process mass spectrometry data, refer to the retention time and peak type information of the standard, and perform integral correction on the chromatographic peaks detected in different samples of the analyte; draw a standard curve based on the concentration and ion current intensity of the standard, and convert the peak area of ​​the test sample into the standard curve to obtain the content of various carotenoids. The results are shown in Tables 1-4 and Figures 1 - 3 .

[0039] Table 1. Carotene types and contents of Escherichia coli expressing pACCRT-EIB plasmid alone

[0040] Table 2. Carotene types and contents of Escherichia coli co-expressing pACCRT-EIB plasmid and DcLcyE protein expression vector

[0041] Table 3. Carotene types and contents of Escherichia coli co-expressing pACCRT-EIB plasmid and carrot DcLcyE-2A-DcLcyB1 protein co-expression vector

[0042] Table 4. Carotene types and contents of Escherichia coli co-expressing pACCRT-EIB plasmid and carrot DcLcyE-2A-DcLcyB2 protein co-expression vector

[0043] According to the above measurement results, after the introduction of DcLcyE protein, in addition to the accumulation of lycopene, E. coli cells also contain ε-carotene, γ-carotene, α-carotene, and possibly a certain amount of δ-carotene (due to the lack of standard substances, δ-carotene was not quantified in this article).

[0044] In order to further compare the role of DcLcyB1 and DcLcyB2 proteins in the reaction, DcLcyE protein and DcLcyB1 / 2 proteins were constructed on the same vector. E. coli co-expressing pACCRT-EIB and DcLcyE-2A-DcLcyB1 accumulated β-carotene and a small amount of α-carotene. Three cyclized carotenes, β-carotene, α-carotene and γ-carotene, were detected in the carotenoid extract of E. coli co-expressing pACCRT-EIB and DcLcyE-2A-DcLcyB2. Compared with E. coli co-expressing pACCRT-EIB and DcLcyE-2A-DcLcyB1, the content of β-carotene was comparable, and the content of α-carotene was higher, which was 3.59 times that of E. coli co-expressing pACCRT-EIB and DcLcyE-2A-DcLcyB1. The accumulation of γ-carotene can also be observed, but the content is low, at 0.1286 μg / g. In general, both DcLcyB1 and DcLcyB2 can cyclize lycopene to β-carotene, and DcLcyB2 shows stronger catalytic activity in catalyzing the production of α-carotene. In addition, the accumulation of monocyclic carotenes such as γ-carotene can be detected, indicating that the process of DcLcyB2 catalyzing the cyclization of lycopene may be relatively slow, which leads to the accumulation of intermediate monocyclic carotenes.

[0045] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A method for detecting the catalytic function of carrot lycopene β-cyclase protein, characterized in that: The following steps are involved: S1. Express the pACCRT-EIB plasmid in E. coli competent cells to obtain the E. coli prokaryotic expression system; S2, constructing a DcLcyE-DcLcyB1 protein co-expression vector and a DcLcyE-DcLcyB2 protein co-expression vector, transforming the DcLcyE-DcLcyB1 protein co-expression vector and the DcLcyE-DcLcyB2 protein co-expression vector into the Escherichia coli prokaryotic expression system, respectively, and culturing them in LB liquid culture medium at 37°C and 220 rpm for 16-24 h, and then culturing them in the dark for propagation; S3, collecting Escherichia coli cells that co-express DcLcyE-DcLcyB1 protein and DcLcyE-DcLcyB2 protein respectively; S4. Extract and determine carotenoids in Escherichia coli cells, and evaluate the catalytic activity of DcLcyB protein based on the types and contents of carotenoids.

2. The method for detecting the catalytic function of carrot lycopene β-cyclase protein according to claim 1, characterized in that: In step S1, the E. coli competent cells are E. coli BL21 (DE3) competent cells.

3. The method for detecting the catalytic function of carrot lycopene β-cyclase protein according to claim 2, characterized in that: In step S1, constructing the E. coli prokaryotic expression system comprises the following steps: S11, the pACCRT-EIB plasmid was transformed into E. coli BL21 (DE3) competent cells by heat shock transformation method to obtain E. coli colonies; S12. Expand the cultured E. coli colonies, prepare competent cells using the calcium chloride method, and obtain E. coli competent cells that accumulate lycopene.

4. The method for detecting the catalytic function of carrot lycopene β-cyclase protein according to claim 3, characterized in that: In step S2, constructing a DcLcyE-DcLcyB1 protein co-expression vector and a DcLcyE-DcLcyB2 protein co-expression vector comprises the following steps: S21, synthesized DcLcyE-2A-DcLcyB1 sequence and DcLcyE-2A-DcLcyB2 sequence; the DcLcyE-2A-DcLcyB1 sequence is shown in SEQ ID NO.1; the DcLcyE-2A-DcLcyB2 sequence is shown in SEQ ID NO.2; S22. Use restriction endonuclease to linearize the protein expression vector, and construct the DcLcyE-2A-DcLcyB1 sequence and the DcLcyE-2A-DcLcyB2 sequence into the protein expression vector by recombination method to obtain the DcLcyE-DcLcyB1 protein co-expression vector and the DcLcyE-DcLcyB2 protein co-expression vector.

5. The method for detecting the catalytic function of carrot lycopene β-cyclase protein according to claim 4, characterized in that: The protein expression vector is pET30a.

6. The method for detecting the catalytic function of carrot lycopene β-cyclase protein according to claim 5, characterized in that: In step S2, the DcLcyE-DcLcyB1 protein co-expression vector and the DcLcyE-DcLcyB2 protein co-expression vector are respectively transferred into lycopene-accumulating Escherichia coli competent cells by heat shock method.

7. The method for detecting the catalytic function of carrot lycopene β-cyclase protein according to claim 6, characterized in that: In step S3, collecting Escherichia coli cells that co-express DcLcyE-DcLcyB1 protein and DcLcyE-DcLcyB2 protein comprises the following steps: S31, inoculate the transformed E. coli colony into LB medium, culture at 37℃ 220rpm, and grow the E. coli to OD 600 When the pH is 0.5-0.6, add 0.1M IPTG for induction and culture overnight to obtain E. coli culture liquid; S32. Transfer the E. coli culture liquid to a centrifuge tube, centrifuge at 4000 rpm at 4℃ for 10 min, remove the supernatant; add ddH2O and resuspend, and centrifuge again to collect the E. coli cells.

8. The method for detecting the catalytic function of carrot lycopene β-cyclase protein according to claim 7, characterized in that: In step S4, extracting and determining carotenoids in Escherichia coli cells comprises the following steps: S41, vacuum freeze-drying the Escherichia coli cells for 12 h, weighing the freeze-dried powder of the cells and repeatedly leaching it in acetone until it becomes colorless to obtain an extract; S42. The extract was separated and determined by ultra-high performance liquid chromatography and tandem mass spectrometry. The liquid phase conditions were as follows: chromatographic column YMC C30 column, 100 mm×2.0 mm, 3 μm; mobile phase A: methanol / acetonitrile V / V=1:3, with 0.01% BHT and 0.1% formic acid added; phase B: methyl tert-butyl ether, with 0.01% BHT added; gradient elution program: 0-3 min A / B was 100:0 V / V, 3-5 min A / B was 30:70 V / V, 5-9 min A / B was 5:95 V / V, 9-11 min A / B was 100:0 V / V; flow rate was 0.8 mL / min; column temperature was 28°C; injection volume was 2 μL; mass spectrometry conditions were as follows: atmospheric pressure chemical ion source temperature was 350°C, curtain gas was 25 psi; each ion pair was scanned and detected according to the optimized declustering voltage and collision energy; S43. MultiQuant 3.0.3 software was used to process mass spectrometry data. The chromatographic peaks detected in different samples of the analyte were integrated and corrected with reference to the retention time and peak shape information of the standard. A standard curve was drawn based on the concentration and ion current intensity of the standard. The peak area of ​​the test sample was substituted into the standard curve to convert the content of various carotenoids.

Images