Method for dynamically regulating and controlling plasmid copy number in saccharomyces cerevisiae based on RNA (Ribonucleic Acid) interference

Abstract

The invention provides a method for dynamically regulating and controlling the copy number of plasmids in saccharomyces cerevisiae based on RNA (Ribonucleic Acid) interference. According to the method, an orthogonal RNAi system is reconstructed, saccharomyces cerevisiae is used as a synthetic biological chassis with a dynamic programmable plasmid copy number, a heterologous RNAi mechanism from Ckstri saccharomyces cerevisiae is integrated, sequence-specific siRNA of a targeted plasmid coding selective marker is designed, a chemically induced gene dose control platform is established, and the gene dose control platform is used for controlling the gene dose. The dynamic regulation and control of the plasmid copy number are realized, so that the gene expression dosage is optimized, and the biosynthesis efficiency is improved. RNAi-mediated copy number regulation is applied to a carotenoid biosynthesis pathway, and compared with a static plasmid system, the lycopene titer is increased by 18.6 times. The method further enriches an anabolism regulation tool set, has huge potential in the aspect of improving the production performance of a microbial cell factory, and provides a new thought for metabolic engineering optimization in the field of synthetic biology.

Description

Technical Field

[0001] The invention belongs to the field of metabolic engineering, and in particular relates to a method for dynamically regulating the copy number of plasmids in saccharomyces cerevisiae based on RNA interference. Background Art

[0002] In the design of microbial cell factories, precise coordination of gene dosage and expression dynamics is of great significance for optimizing metabolic flux, reducing cell burden, and increasing the yield of target products. Saccharomyces cerevisiae ) is an important synthetic biology chassis microorganism and is widely used in genetic engineering and the production of recombinant proteins. Plasmids are commonly used tools in genetic engineering, and their copy number has an important influence on the expression of target genes and the yield of biosynthetic products. However, traditional plasmid systems have problems such as large copy number fluctuations, lack of dynamic regulation means, and lack of dynamic regulation capabilities, which limit their application in the optimization of complex metabolic networks. Therefore, it is necessary to provide a method for dynamically regulating the copy number of plasmids in Saccharomyces cerevisiae to increase the yield of biosynthetic products such as recombinant proteins in engineered strains of Saccharomyces cerevisiae. Summary of the invention

[0003] In order to solve the problem that the number of plasmid copies in the prior art is difficult to regulate in real time, the present invention provides a method for dynamically regulating the number of yeast plasmid copies by RNA interference (RNAi) technology. The method achieves dynamic regulation of the number of plasmid copies by reconstructing an orthogonal RNAi pathway in Saccharomyces cerevisiae and using chemically induced short interfering RNA (siRNA) to target the plasmid-encoded selection marker gene, thereby optimizing the gene expression dosage and improving the biosynthesis efficiency.

[0004] The technical solution adopted by the present invention is: to reconstruct the RNAi pathway in Saccharomyces cerevisiae cells, and to use a chemically induced hairpin RNA expression module to target a plasmid-encoded selection marker gene to achieve dynamic regulation of the plasmid copy number; the hairpin RNA expression module includes an estradiol-inducible system and a hairpin structure sequence homologous to the selection marker gene.

[0005] RNA interference (RNAi) is a post-transcriptional gene silencing mechanism that inhibits gene expression by specifically degrading target mRNA. Although the RNAi system has been lost in Saccharomyces cerevisiae during evolution, it exists in other yeasts. This invention aims to use Saccharomyces cerevisiae as a synthetic biology chassis with dynamically programmable plasmid copy number by reconstructing the RNAi system of Saccharomyces cerevisiae. By integrating the RNAi system from Saccharomyces castellii ( Saccharomyces castelli) and a chemically inducible hairpin RNA (hpRNA) expression module targeting a plasmid-encoded selection marker gene was designed based on the heterologous RNAi mechanism including Dicer ribonuclease and Argonaute protein. The system can control the plasmid copy number through a chemically inducible promoter: the presence of the inducer estradiol triggers the transcription of the hairpin structure sequence homologous to the selection marker gene in the hairpin RNA expression module, which is then processed into siRNA complementary to the mRNA of the selection marker gene. After pairing, the mRNA of the selection marker gene is cleaved and degraded by the Argonaute protein, and the growth pressure of the plasmid is increased, thereby achieving dynamic regulation of the plasmid copy number to increase the yield of recombinant proteins and biosynthetic products. Specifically, the method for dynamically regulating the plasmid copy number in Saccharomyces cerevisiae provided by the present invention mainly includes two parts, namely 1) RNAi pathway reconstruction part and 2) specific siRNA regulation part.

[0006] The RNAi pathway reconstruction part specifically includes the following contents: Target gene selection: The present invention obtains the RNA interference core component gene from Saccharomyces cerevisiae DCR1 (encoding Dicer ribonuclease) and AGO1 (encoding Argonaute protein), these two genes are key components of the RNA interference pathway, responsible for processing long double-stranded RNA into small interfering RNA (siRNA) and forming an RNA-induced silencing complex (RISC).

[0007] Integration site selection: Select Saccharomyces cerevisiae ( Saccharomyces cerevisiae ) are integrated into neutral sites in the genome, such as 416d and 308a. These sites will not significantly affect the normal physiological functions of the host cells, and can stably express the integrated foreign genes.

[0008] The specific siRNA regulation part specifically includes the following contents: Target selection: Select a plasmid-encoded selectable marker gene as the target of the siRNA. For example, commonly used antibiotic resistance genes (such as HkDJ , encoding hygromycin B phosphotransferase; NrsR, encoding nourseoin sulfate) or auxotrophic selection marker genes (such as URA3 , LEU2 , TRP1 The estradiol inducible system and the hairpin structure sequence homologous to the selection marker gene are connected to construct a hairpin RNA expression module. The hairpin structure sequence homologous to the selection marker gene is transcribed and processed into siRNA complementary to the mRNA of the selection marker gene under the triggering of the inducer estradiol. HkDJThe nucleotide sequence of the hairpin structure gene homologous to the gene is preferably as shown in SEQ ID NO. 5; and Nr The nucleotide sequence of the hairpin structure gene homologous to the gene is preferably as shown in SEQ ID NO. 13; URA3 The nucleotide sequence of the hairpin structure gene homologous to the gene is preferably as shown in SEQ ID NO. 6; and LEU2 The nucleotide sequence of the hairpin structure gene homologous to the gene is preferably as shown in SEQ ID NO. 7; and TRP1 The nucleotide sequence of the hairpin structure gene homologous to the gene is preferably as shown in SEQ ID NO. 8.

[0009] Induction system design: In order to achieve dynamic regulation of the hairpin RNA expression module, a chemical induction system is introduced. The present invention preferably uses a β-estradiol induction system, which includes a DNA binding domain ZF97-4 that binds to β-estradiol, an estrogen ligand binding domain, a transcription activation domain VP16, and an engineered promoter containing multiple 97-4 operators.

[0010] Construction of inducible system: The hairpin RNA expression module is placed under the control of the β-estradiol inducible system, so that the expression level of siRNA can be adjusted by adding different concentrations of β-estradiol, thereby achieving dynamic regulation of the plasmid copy number.

[0011] Preferably, the method for reconstructing the RNAi pathway in yeast cells comprises: DCR1 Gene, AGO1 The genes are respectively integrated into the neutral sites of the Saccharomyces cerevisiae genome. DCR1 The nucleotide sequence of the gene is preferably as shown in SEQ ID NO. 14. AGO1 The nucleotide sequence of the gene is preferably as shown in SEQ ID NO. 15.

[0012] Preferably, the neutral sites of the Saccharomyces cerevisiae genome include: site 416d and site 308a; the nucleotide sequence of the 416d site is shown in SEQ ID NO. 1; and the nucleotide sequence of the 308a site is shown in SEQ ID NO. 2.

[0013] Preferably, the chemical induction method comprises: regulating the hairpin RNA expression module by introducing a β-estradiol induction system into the genome of Saccharomyces cerevisiae.

[0014] Preferably, the β-estradiol inducible system comprises: a DNA binding domain ZF97-4 that binds to β-estradiol, an estrogen ligand binding domain, a transcription activation domain VP16, and an engineered promoter containing a 97-4 operator. The nucleotide sequence of the β-estradiol inducible system is preferably as shown in SEQ ID NO. 3.

[0015] Preferably, the plasmid is a high copy plasmid containing a 2μ replicon. The nucleotide sequence of the 2μ replicon is preferably as shown in SEQ ID NO. 4.

[0016] Preferably, the selective marker gene comprises an antibiotic resistance gene or an auxotrophic marker gene. The antibiotic resistance gene may be HkDJ , Nr Gene. The nutritional deficiency marker gene can be URA3 , LEU2 , TRP1 Gene.

[0017] The present invention also provides a system for dynamically regulating the copy number of plasmids in Saccharomyces cerevisiae, comprising: RNA interference pathway reconstruction module, used to integrate the DCR1 gene and AGO1 gene from Saccharomyces castellii into the neutral site of the Saccharomyces cerevisiae genome; A specific siRNA module is used to introduce a hairpin RNA expression module targeting a plasmid-encoded selection marker gene and a β-estradiol induction system for regulating hairpin RNA expression into the Saccharomyces cerevisiae genome; the hairpin RNA expression module includes an estradiol induction system and a hairpin structure sequence homologous to the selection marker gene.

[0018] The present invention also provides the application of the system for dynamically regulating the copy number of plasmids in Saccharomyces cerevisiae in microbial metabolic engineering.

[0019] Preferably, the application includes: Constructing an engineered yeast strain containing the system, wherein the hairpin RNA expression module of the system targets the plasmid-encoded selection marker gene HkDJ ; Build contains CrtE , CrtB , CrtI Genes and selectable marker genes HkDJ Plasmids; Transforming the constructed plasmid into the engineered yeast Saccharomyces cerevisiae to obtain a carotenoid-synthesizing strain; Carotenoids are obtained by fermenting the carotenoid-producing strain under the induction of β-estradiol at a preferred concentration of 200 nM.

[0020] Preferably, the carotenoids include β-carotene, α-carotene, lycopene, lutein and zeaxanthin.

[0021] Preferably, the CrtE The nucleotide sequence of the gene is preferably as shown in SEQ ID NO. 9; CrtB The nucleotide sequence of the gene is preferably as shown in SEQ ID NO. 10; CrtI The nucleotide sequence of the gene is preferably as shown in SEQ ID NO.11.

[0022] The present invention applies the system to the carotenoid biosynthesis pathway. CrtE (geranylgeranyl pyrophosphate synthase), CrtB (phytoene synthase) and CrtI (phytoene desaturase) gene plasmid and insert it into the plasmid HkDJ Select the marker gene. The constructed plasmid is transformed into a yeast strain integrated with the system for dynamically regulating the copy number of plasmids in Saccharomyces cerevisiae to construct an engineered strain for carotenoid synthesis. CrtE , CrtB and CrtI Genes are key enzyme genes in the carotenoid biosynthesis pathway. By optimizing the expression of these genes, the production of carotenoids can be increased. Fermentation experiments were carried out under the induction of different concentrations of β-estradiol to monitor the growth curve and carotenoid production of yeast. The experimental results showed that the carotenoid production of the induced yeast strain increased by 18.6 times compared with the wild-type control strain. This result verifies the application potential of RNAi-mediated plasmid copy number regulation system in metabolic engineering and provides a new method for improving the production performance of microbial cell factories.

[0023] Beneficial effects of the present invention: 1. Dynamic regulation of plasmid copy number: The present invention realizes dynamic regulation of the plasmid copy number of Saccharomyces cerevisiae through RNA interference technology, which can adjust the plasmid copy number in real time according to metabolic needs, optimize gene expression levels, and solve the problem of fixed copy number in traditional plasmid systems.

[0024] 2. Increase metabolite production: By dynamically regulating the number of plasmid copies, the production of metabolites can be significantly increased, improving the production performance of microbial cell factories. In the carotenoid synthesis pathway, dynamic regulation of plasmid copy number increased lycopene production by 18.6 times, significantly better than the traditional static plasmid system.

[0025] 3. Universal application: This system is not only applicable to antibiotic resistance genes, but can also be extended to other selection marker genes (such as URA3 , LEU2 , TRP1 ), has a wide range of applicability, enabling it to be widely used in different metabolic engineering scenarios.

[0026] In summary, the present invention realizes dynamic regulation of the copy number of Saccharomyces cerevisiae plasmids through RNA interference technology, overcoming the limitations of traditional plasmid systems. This system not only improves the flexibility and accuracy of gene expression, but also significantly improves biological production efficiency, providing new tools and strategies for synthetic biology and metabolic engineering. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 In Example 1 of the present invention AGO1 and DCR1 Verification results of gene integration at sites 416d and 308a respectively.

[0028] Figure 2 This is the effect of RNA interference pathway reconstruction on the host Saccharomyces cerevisiae in Example 1 of the present invention.

[0029] Figure 3 The figure shows the change of plasmid copy number under the induction of different concentrations of β-estradiol in Example 1 of the present invention.

[0030] Figure 4 The fluorescence intensity and copy number changes of different auxotrophic marker plasmids under RNAi regulation in Example 1 of the present invention.

[0031] Figure 5 This is the application effect of the system for dynamically regulating the copy number of plasmids in Saccharomyces cerevisiae in Example 2 of the present invention in the lycopene biosynthesis pathway. DETAILED DESCRIPTION

[0032] The following is an explanation of the embodiments of the present invention by specific specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied by other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that, in the absence of conflict, the features in the following embodiments and embodiments can be combined with each other. In the embodiments of the present invention, the methods used are all conventional methods unless otherwise specified, and the reagents used can be obtained from commercial sources.

[0033] The culture medium used in the examples is: 1) LB medium: weigh 10 g tryptone, 5 g yeast extract, and 10 g sodium chloride, dissolve in water and make up to 1 L. For solid medium, add 2% agar powder. Sterilize at 121℃ for 20 min, and add corresponding antibiotics after cooling; 2) YPD medium: weigh 20 g tryptone, 10 g yeast extract, and 20 g glucose, dissolve in water and make up to 1 L. For solid medium, add 2% agar powder. Sterilize at 115℃ for 30 min, and add corresponding antibiotics after cooling.

[0034] The transformation method of Saccharomyces cerevisiae in the embodiment: Preparation of competent cells: Take an appropriate amount of bacterial solution from the seed tube and inoculate it into the corresponding liquid culture medium, and culture it at 30°C overnight until saturation; take an appropriate amount of saturated bacterial solution into 25 mL liquid culture medium, and culture it at 30°C overnight until the cell density reaches 1×10 8 / mL (OD600≈1.3~1.5); transfer the bacterial solution to a 50 mL sterile centrifuge tube, centrifuge at 4°C, 4000 rpm for 3 min, discard the supernatant, and resuspend with 8 mL ice-cold sterile water; add ice-cold 1 mL 10×TE buffer and 1mL 10×LiAc solution, incubate at 30°C in a shaker for 45 min; add 250 μL 1 M DTT aqueous solution, incubate at 30°C in a shaker for 15 min; add ice-cold sterile water to 40 mL in the above centrifuge tube, centrifuge at 4°C, 4000 rpm for 3 min, discard the supernatant; add 20~30 mL ice-cold sterile water, resuspend, centrifuge at 4°C, 4000 rpm for 3 min, discard the supernatant; add 20~30 mL ice-cold 1 M sorbitol aqueous solution, centrifuge at 4°C, 4000 rpm for 3 min, discard the supernatant; add 200 μL ice-cold 1 M The sorbitol aqueous solution was dispensed into ice-cold 1.5 mL centrifuge tubes, 100 μL per tube, to obtain the electroporation competent cells of Saccharomyces cerevisiae.

[0035] Electroporation: Take 100 μL of Saccharomyces cerevisiae competent cells, add 5-10 μL of plasmid or linear fragment, mix gently and transfer to a 0.1 cm electroporation reaction cup; adjust the mode of the electroporator to Saccharomyces cerevisiae, preheat for ten minutes, and then electroporate at 1.5 kV; quickly add 1 mL of ice-cold 1 M sorbitol after electroporation, and incubate in a 30°C water bath for 3 h, invert and mix every half an hour to avoid sinking to the bottom; take out the incubated centrifuge tube, centrifuge at 1000 rpm for 4 min, discard part of the supernatant and apply it to the corresponding culture medium, and transformants will grow after 2-4 days.

[0036] The shake flask fermentation method of brewer's yeast in the embodiment is as follows: take an appropriate amount of bacteria in a glycerol tube stored at -80°C into 5 mL of liquid culture medium, and culture at 30°C and 220 rpm for 48 h; take 1 mL of the above bacterial solution into 20 mL of liquid culture medium, the initial OD600 is about 0.2, and culture at 30°C and 220 rpm for 4 days.

[0037] Extraction and detection of lycopene in the embodiment: 1 mL of fermentation broth was taken, centrifuged at 12000 rpm for 2 min to collect the cells, the supernatant was discarded, and the cells were washed twice with water; 1 mL of ice-cold acetone was added to resuspend the cells; after ultrasonication for 30 min, the cells were centrifuged at 12000 rpm for 10 min, the supernatant was filtered through a membrane, and HPLC analysis was performed; another 10 mL of fermentation broth was taken, centrifuged at 12000 rpm for 2 min, and the supernatant was discarded; after washing once, the cells were placed in an oven at 80°C and dried to constant weight for calculation of cell dry weight; HPLC detection: the chromatographic column was Welch Ultimate AQ-C18 (4.6×250 mm, 5 μm), the mobile phase was acetonitrile: methanol: isopropanol = 5:3:2 (v / v / v), the flow rate was 0.5 mL / min, the column temperature was 30°C, and lycopene was detected at a wavelength of 470 nm.

[0038] Table 1. Plasmids and strains used in the examples Plasmids describe source p-Cas9 pRS414, AmpR, NrsR, TEF1p-Cas9-CYC1t Addgene p-sgRNA pRS426, AmpR, HygR, SNR52p-gRNA-SUP4t Addgene p-2µ-HygR-GFP pRS426, AmpR, HygR, TDH3p-yeGFP-ADH1t This study constructs p-2µ-URA3-GFP pRS426, AmpR, URA3, TDH3p-yeGFP-ADH1t This study constructs p-2µ-TRP1-GFP pRS426, AmpR, LEU2, TDH3p-yeGFP-ADH1t This study constructs p-2µ-LEU2-GFP pRS426, AmpR, TRP1, TDH3p-yeGFP-ADH1t This study constructs p-2µ-HygR-CRT pRS426, AmpR, HygR, GAL7p-CrtE-PGK1t_GAL1p-CrtB-ADH1t_GAL10p-CrtI-CYC1t This study constructs strain describe source CEN.PK2-1C EUROSCARF CGFP CEN.PK2-1C, 911b∷ TDH3p-yeGFP-ADH1t This study constructs CE-SH CEN.PK2-1C, gal80△∷ synER-siRNAHygR This study constructs RNAi+ CEN.PK2-1C, 416d∷TEF1p-AGO1-ADH1t, 308a∷TEF1p-DCR1-ADH1t This study constructs RGFP RNAi+ , 911b∷TDH3p-yeGFP-ADH1t This study constructs C-P2HGFP CEN.PK2-1C, p-2µ-HygR-GFP This study constructs R-P2HGFP RNAi+ , p-2µ-HygR-GFP This study constructs RE-SH-P2HGFP RE-SH,p-2µ-HygR-GFP This study constructs RE-SH RNAi+ , gal80△∷synER-siRNAHygR This study constructs RE-SU RNAi+ , gal80△∷synER-siRNAURA3 This study constructs RE-ST RNAi+ , gal80△∷synER-siRNATRP1 This study constructs RE-SL RNAi+ , gal80△∷synER-siRNALEU2 This study constructs RE-SU-P2UGFP RE-SU, p-2µ-URA3-GFP This study constructs RE-ST-P2TGFP RE-ST, p-2µ-TRP1-GFP This study constructs RE-SL-P2LGFP RE-SL, p-2µ-TRP1-GFP This study constructs CE-SH-P2HCRT CE-SH, p-2µ-HygR-CRT This study constructs R-P2HCRT RNAi+, p-2µ-HygR-CRT This study constructs RE-SH-P2HCRT RE-SH, p-2µ-HygR-CRT This study constructs Table 2. Primers used in the examples name sequence 308-yz-S AAAGTTGAAAGAATCCCGTATC 308-yz-A CCATATTGTTTGGCGCTGAT 416-yz-S ACTTGGTTGGCGTGTTTC 416-yz-A TGGGGTTGTCAATGTGGT AGO1-S AGTTTTAATTACAAAaatccttggcttggaacagg AGO1-A TCATAAGAAATTCGCaataggatattaataatagatgtttttaaacatac DCR1-S AGTTTTAATTACAAAtaaaagatcaattaaacaat DCR1-A TCATAAGAAATTCGCaaatgaacttaatgttatca 2UM-URA3-S tgacataactaattacatgactcgagaTTAGTTTTGCTGGCCGCA 2UM-URA3-A catccgaacataaacaaccCATATGATGTCGAAAGCTACATATAAGGAAC 2UM-LEU-S tgacataactaattacatgactcgagattaagcaaggattttcttaacttct 2UM-LEU-A catccgaacataaacaaccCATATGatgtctgcccctaagaagat 2UM-TRP-S tgacataactaattacatgactcgagactatttcttagcatttttgacgaa 2UM-TRP-A catccgaacataaacaaccCATATGatgtctgttattaatttcacaggta g-416d-S tagtgcacttaccccacgttgttttagagctagaaatagc g-416d-A aacgtggggtaagtgcactagatcatttatctttcactgc g-308a-S CACTTGTCAAACAGAATATAGTTTTAGAGCTAGAAATAGCAAG g-308a-A CACTTGTCAAACAGAATATAGTTTTAGAGCTAGAAATAGCAAG CRT-S gggaacaaaagctggagctcacatggagacatcaaaaattga CRT-A actatagggcgaattgggtacctttgtacagaaaaaaaagaaaaatttgaaa g-gal80-S GTGTCATGCAGTTTCAAAGGgttttagagctagaaatagcaagtt g-gal80-A CCTTTGAAACTGCATGACACgatcatttatctttcactgcgg 80-YZ-S ATACCCCTTTCTTCTCTCCC 80-YZ-A AATCAATCCAGCACCATCAC Among them, 308-yz-S / A was used for 308a integration site verification, 416-yz-S / A was used for 416d integration site verification, AGO1-S / A was used for AGO1 gene amplification, DCR1-S / A was used for DCR1 gene amplification, 2UM-URA3-S / A was used for URA3 gene amplification, 2UM-LEU-S / A was used for LEU2 gene amplification, 2UM-TRP-S / A was used for TRP1 gene amplification, g-416d-S / A was used for pg-416d plasmid construction, g-308a-S / A was used for pg-308a plasmid construction, CRT-S / A was used for CRT gene amplification, g-gal80-S / A was used for pg-gal80 plasmid construction, and 80-YZ-S / A was used for gal80 site integration verification.

[0039] The PCR amplification program for cloning in the embodiment is: ((98°C, 30 s), 1 cycle); ((98°C, 10 s), (50-72°C, 30 s), (72°C, 30s / kb), 35 cycles); (72°C, 120 s), 1 cycle); stored at 4°C.

[0040] Example 1: Construction and validation of a system for dynamically regulating plasmid copy number in Saccharomyces cerevisiae 1. System Construction 1. Construction of RNAi+ strain To obtain DCR1 and AGO1The gene fragment was cloned into a plasmid containing the TEF1 promoter, ADH1 terminator and homology arms of 416d / 308a sites by PCR using Q5 High Fidelity 2× Master Mix (NEB). AGO1 To knock in the gene encoding Argonaute protein, we electroporated the donor fragment and the sgRNA plasmid targeting the corresponding site (the p-sgRNA plasmid was used as a template, and the whole plasmid was PCR amplified using primers with the corresponding targeting site. The PCR product was recovered and transformed into DH5α competent cells, and the plasmid was successfully constructed by sequencing) into the Saccharomyces cerevisiae CEN.PK2-1C containing the p-Cas9 plasmid (the sgRNA at the 416d site was TAGTGCACTTACCCCACGTT, and the sgRNA at the 308a site was CACTTGTCAAACAGAATATA). After electroporation, the cells were incubated at 30°C for 3 h, spread on YPD solid medium containing nourseoin sulfate and hygromycin B (the final concentration of nourseoin was 50 mg / L, and the final concentration of hygromycin B was 300 mg / L), and cultured in a 30°C incubator for 2 days. After a single colony grows on the double-antibody plate, it is picked and placed in a test tube and cultured in a shaker at 30°C for 2 days. 200 μL of the bacterial solution is added to phenol and chloroform to quickly extract the total DNA. Primers 416-yz-S / A and 308-yz-S / A are designed according to the gene, ensuring that the forward primer and reverse primer are located upstream and downstream of the left and right arms of 416d or 308a, respectively. The PCR results are as follows: Figure 1 As shown, a successfully integrated RNAi+ strain was obtained.

[0041] 2. Functional verification of RNAi+ strains First, we investigated DCR1 and AGO1 The effect of gene introduction on yeast itself. Through the determination of growth curve (growth conditions: cultured in YPD liquid medium, 30°C, 220 rpm), we found that the restoration of RNA interference pathway had a certain effect on the growth of strains. Compared with wild-type strains, RNAi+ strains grew more slowly, but the final biomass reached by growth was not much different ( Figure 2 Middle B).

[0042] In order to eliminate the possible interference of RNA interference system on the transcriptional expression of reporter gene, we selected green fluorescent protein ( GFP ) as a reporter gene, and the same method as above was used to GFP The expression cassette was precisely integrated into the neutral site 911b of the genome of the wild-type (WT) strain and the RNAi strain, thus constructing the C-GFP and R-GFP strains. GFPClone into a plasmid vector containing the 2µ replicon to construct the plasmid p-2µ-HygR-GFP and transfer it to the GFP-positive cells as an episomal plasmid. GFP The yeast strains were introduced to generate C-P2HGFP and R-P2HGFP strains. The fluorescence intensity was then measured, and the results showed that there was no significant difference in the fluorescence intensity of the two strains. However, unlike the expression of GFP integrated into the genome, without the additional introduction of hairpin transcripts to interfere with gene expression, the GFP fluorescence intensity in the R-P2HGFP strain increased by about 1.59 times compared with the C-P2HGFP strain ( Figure 2 Middle C). The resistance gene on the plasmid was found based on the transcription status of the gene on the plasmid ( HyB ) The decrease in transcriptional abundance leads to a significant increase in the transcription level of the reporter gene GFP. GFP The nucleotide sequence of the gene is shown in SEQ ID NO. 12.

[0043] 3. Regulating siRNA to achieve engineered control of plasmid copy number In order to further enhance the regulation of plasmid copy number, siRNA was introduced to further enhance the effect of RNA interference, thereby increasing the plasmid copy number. We introduced an estradiol-inducible transcriptional regulatory system into the Saccharomyces cerevisiae strain (nucleotide sequence shown in SEQ ID NO. 3). The system contains a DNA binding domain (ZF97-4), an estrogen ligand binding domain, a transcriptional activation domain (VP16), and an engineered promoter containing a 7× 97-4 operator ( Figure 3 Middle A) has good inducible expression effect in yeast.

[0044] The green fluorescent protein was placed under the engineered CYC1 weak promoter, and the entire estradiol-induced transcriptional regulatory system was integrated into the RNAi strain genome to generate the RE-GFP strain. During the growth process (growth conditions: cultured in YPD liquid medium, 30°C, 220 rpm), different concentrations of estradiol (1, 10, 100, 1000 nM) were used for induction. The experimental results showed that with the increase of estradiol concentration, the fluorescent protein induced by the system showed a gradual increase, indicating that the system has a good induction transcription effect in Saccharomyces cerevisiae ( Figure 3 Middle B).

[0045] Afterwards, we will GFP Gene replacement with HygRThe hairpin structure gene with homology to the gene (nucleotide sequence is shown in SEQ ID NO. 5, constructing strain RE-SH) was introduced into the p-2µ-HygR-GFP plasmid to generate the RE-SH-P2HGFP strain. Real-time quantitative PCR (qPCR) technology was used to detect the changes in plasmid copy number. Single-copy genes in the yeast genome (such as ERG13) were used as reference genes, and the relative changes in plasmid copy number were calculated by comparing the Ct value difference between the target gene and the reference gene. The results showed that with the increase of inducer concentration, the plasmid copy number gradually increased; and compared with the C-P2HGFP strain, the plasmid copy number increased by up to 7.13 times, indicating that our system has the potential to control the plasmid copy number ( Figure 3 Middle C).

[0046] 4. Universality of RNAi strategy for regulating plasmid copy number We replaced the resistance gene on the p-2µ-HygR-GFP plasmid with three nutritional deficiency markers URA3, LEU2, and TRP1, respectively, to construct plasmids p-2µ-URA3-GFP, p-2µ-TRP1-GFP, and p-2µ-LEU2-GFP; at the same time, we constructed strains containing homologous hairpin structure sequences of corresponding screening markers, and obtained RE-SU, RE-ST, and RE-SL, so that the hairpin RNA expression module targeted the selection marker gene encoded by the plasmid; the above plasmids were introduced into the corresponding strains, and strains RE-SU-P2UGFP, RE-ST-P2TGFP, and RE-SL-P2LGFP were constructed. According to the fluorescence intensity results detected by the microplate reader, for different screening markers, the introduction of RNAi and siRNA increased the fluorescence intensity of the strains to varying degrees, and for the TRP1 screening marker, the fluorescence intensity increased most significantly ( Figure 4 ).

[0047] Example 2: RNAi regulates plasmid copy number to increase lycopene production The optimized CrtE , CrtB and CrtI Gene( Figure 5 A) and integrated it into a region containing a 2μ replication origin and HygR The high-copy plasmid vector was obtained by plasmid p-2µ-HygR-CRT ( Figure 5The plasmid was electroporated into Saccharomyces cerevisiae to obtain four engineered strains, namely C-P2HCRT, CE-SH-P2HCRT, R-P2HCRT, and RE-SH-P2HCRT. The growth curve of Saccharomyces cerevisiae was monitored by shake flask fermentation under the induction of 200 nM β-estradiol, and the lycopene production capacity was detected by high performance liquid chromatography (HPLC) to verify the effect of plasmid copy number regulation on metabolite synthesis. The results are shown in Figure 5 The experimental results showed that the carotenoid production of the induced yeast strain increased by 18.6 times compared with the wild-type control strain. This result verified the application potential of RNAi-mediated plasmid copy number regulation in metabolic engineering and provided a new method for improving the production performance of microbial cell factories.

[0048] The embodiments described above are merely descriptions of preferred implementations of the present invention and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope of the present invention.

Claims

1. A method for dynamically regulating the copy number of a plasmid in Saccharomyces cerevisiae, characterized in that: include: The RNA interference pathway is reconstructed in Saccharomyces cerevisiae cells, and a chemically induced hairpin RNA expression module is used to target a plasmid-encoded selection marker gene to achieve dynamic regulation of the plasmid copy number; the hairpin RNA expression module includes an estradiol-inducible system and a hairpin structure sequence homologous to the selection marker gene.

2. The method according to claim 1, characterized in that The method for reconstructing an RNA interference pathway in a yeast cell comprises: DCR1 Gene, AGO1 The genes were integrated into the neutral site of the Saccharomyces cerevisiae genome.

3. The method according to claim 2, characterized in that The neutral sites of the Saccharomyces cerevisiae genome include: site 416d and site 308a; the nucleotide sequence of the 416d site is shown in SEQ ID NO. 1; the nucleotide sequence of the 308a site is shown in SEQ ID NO.

2.

4. The method according to claim 1, characterized in that The chemical induction method comprises: regulating the hairpin RNA expression module by introducing a β-estradiol induction system into the genome of Saccharomyces cerevisiae.

5. The method according to claim 4, characterized in that The beta-estradiol induction system comprises: a DNA binding domain ZF97-4 binding to beta-estradiol, an estrogen ligand binding domain, a transcription activation domain VP16, and an engineered promoter containing a 97-4 operator.

6. The method according to claim 1, characterized in that The plasmid is a high copy plasmid containing a 2μ replicon.

7. The method according to claim 1, characterized in that The selection marker genes include: antibiotic resistance genes and nutritional deficiency marker genes.

8. A system for dynamically regulating the copy number of plasmids in Saccharomyces cerevisiae, characterized in that: include: RNA interference pathway reconstruction module for the remodeling of Saccharomyces cerevisiae from Castelli DCR1 Gene, AGO1 The genes were integrated into the neutral site of the Saccharomyces cerevisiae genome; A specific siRNA module is used to introduce a hairpin RNA expression module targeting a plasmid-encoded selection marker gene and a β-estradiol induction system for regulating hairpin RNA expression into the Saccharomyces cerevisiae genome; the hairpin RNA expression module includes an estradiol induction system and a hairpin structure sequence homologous to the selection marker gene.

9. Use of the system for dynamically regulating the copy number of plasmids in Saccharomyces cerevisiae as claimed in claim 8 in microbial metabolic engineering.

10. The use according to claim 9, characterized in that include: Constructing an engineered yeast strain containing the system, wherein the hairpin RNA expression module of the system targets the plasmid-encoded selection marker gene HkDJ ; Build contains CrtE , CrtB , CrtI Genes and selectable marker genes HkDJ Plasmids; Transforming the constructed plasmid into the engineered yeast Saccharomyces cerevisiae to obtain a carotenoid-synthesizing strain; Carotenoids were obtained by fermenting carotenoid-producing strains under the induction of β-estradiol.

Images