Fluorescence signal probe for CRISPR-Cas12a detection technology, kit and application
By designing hairpin nucleic acid probes containing thiomodified G3 sequences, using the target to activate the SCas12a cleavage probe and bind to thioflavin T, the problem of high cost and susceptibility to interference in traditional fluorescent signal probes is solved, and high sensitivity and low cost detection effects are achieved.
Patent Information
- Application Number
- CN202510415834.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-03
- Publication Date
- 2025-05-13
AI Technical Summary
In the existing CRISPR-Cas12a detection technology, traditional fluorescence signal probes use expensive fluorophores and quenchers to modify, resulting in high detection costs and susceptibility to environmental interference.
A hairpin nucleic acid probe was designed, and its stem contained a thio-modified G3 sequence. When the target was present, the SCas12a cleavage probe was activated to release the thio-modified G3 sequence to bind to thioflavin T, producing a strong fluorescence signal.
The "turn-on" mode of fluorescent signals is realized, which reduces detection costs and avoids complex instruments and operating steps. It is suitable for rapid on-site inspection and large-scale screening.
Smart Images
Figure CN119979672A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of in vitro detection technology, and specifically relates to a fluorescent signal probe and a kit and application for CRISPR-Cas12a detection technology. Background Art
[0002] Molecular detection of nucleic acids and non-nucleic acids is essential for diagnosing diseases, monitoring the environment, and ensuring food safety. However, it is difficult to effectively detect and quantify target molecules due to their low abundance in test samples, susceptibility to degradation, and susceptibility to interference from the detection environment. The above challenges have hindered the development of simple, sensitive, and specific detection methods that have the potential to revolutionize molecular detection. Currently, polymerase chain reaction is the gold standard method for detecting nucleic acid targets, while methods for detecting non-nucleic acid targets (such as metal ions, viruses, and small molecules) include enzyme-linked immunosorbent assay, high-performance liquid chromatography, and mass spectrometry. Therefore, there is an urgent need for a simple, economical, and durable biosensing platform that can handle complex environmental insults.
[0003] CRISPR / Cas technology is a cutting-edge gene editing tool that can precisely modify genome sequences. It is now mainly used for gene function research, genetic disease treatment and other related applications. Since 2017, the CRISPR / Cas system has been widely used in the field of biosensing due to its excellent trans-cutting ability to detect nucleic acid and non-nucleic acid targets. In CRISPR / Cas-driven biosensors, CRISPR-Cas12a is widely used because it can recognize specific single-stranded DNA (ssDNA) or double-stranded DNA (dsDNA) targets through guide RNA and subsequently activate its trans-cutting of any ssDNA. In addition to the ability to directly detect DNA, Qiao and Xiong reported that a method that splits guide RNA into handle RNA and space RNA still has trans-cutting activity in the CRISPR / Cas12a system. In addition, replacing space RNA with target RNA can achieve direct detection of target RNA (called SCas12a). Thanks to the help of aptamers, the SCas12a system also has great potential in non-nucleic acid detection. The signal output of these biosensors uses active Cas12a or SCas12a to cut ssDNA probes modified with signal molecules. The cleavage of ssDNA causes the separation of signal molecules, resulting in different signal outputs, including fluorescence, electrochemistry, colorimetry, etc. Among them, the fluorescence method has the advantages of simplicity, sensitivity and accuracy, making it the best choice for detecting nucleic acids and non-nucleic acid markers. However, traditional fluorescent signal probes of Cas12a or SCas12a usually involve modifying ssDNA with expensive fluorophores and quenchers, resulting in excessively high detection costs.
[0004] Guanine (G)-rich DNA sequences (such as G-quadruplexes and G-triplet) can fold into four / three-stranded non-canonical secondary structures (referred to as G4 and G3, respectively) through Hoogsteen hydrogen bonding. Studies have shown that G4 and G3 can bind to thioflavin T (ThT) to show strong fluorescence. On this basis, G4 and G3 have been widely used as fluorescent reporters in CRISPR / Cas12a systems. For example, Zou et al. developed a CRISPR / Cas12a-driven fluorescent biosensor to detect mercuric ions by using the G4-ThT complex as a reporter. Liu et al. developed a new biosensor based on the fact that active Cas12a can effectively cleave G3 and combined Cas12a with G3 as a fluorescent reporter. This tool is valuable in various fields such as biomedical research and diagnosis because it has the potential to detect nucleic acids and non-nucleic acids with high sensitivity and specificity. However, since the active Cas12a system can effectively cleave G3 or G4, the output biosensors of these "turn-off" signals are easily affected by environmental interference and high background signals during detection. Recently, it was reported that phosphorothioate (ps)-modified G4 sequences can be used as "turn-on" colorimetric / photothermal reporters for CRISPR / Cas12a systems. However, the construction of ps-modified G3 sequences as fluorescent signal probes for SCas12a systems and their application in nucleic acid and non-nucleic acid detection remains to be explored. Summary of the invention
[0005] In view of the problems and shortcomings in the prior art, the present invention aims to provide a fluorescent signal probe, a kit and an application for CRISPR-Cas12a detection technology.
[0006] In order to achieve the purpose of the present invention, the technical solution adopted by the present invention is as follows:
[0007] A first aspect of the present invention provides a fluorescent signal probe for CRISPR-Cas12a detection technology, wherein the fluorescent signal probe is a hairpin nucleic acid probe, and the stem of the hairpin nucleic acid probe contains a thiolated modified G3 sequence.
[0008] Preferably, the nucleotide sequence of the thiolated modified G3 sequence is 5'-TGGGAAGGGAGGG-3'.
[0009] Preferably, the length of the DNA sequence complementary to the thiolated G3 sequence in the stem of the hairpin nucleic acid probe is not less than 5 nt.
[0010] The second aspect of the present invention provides an application of the fluorescent signal probe described in the first aspect in the detection of nucleic acids and antibiotics.
[0011] Preferably, the nucleic acid is miRNA-21, and the antibiotic is kanamycin.
[0012] The third aspect of the present invention provides a kit, which contains the fluorescent signal probe described in the first aspect.
[0013] Preferably, the kit also contains Cas12a protein and hRNA.
[0014] Preferably, the kit further contains NEBuffer 2.1 and Thioflavin T.
[0015] Preferably, when the kit is used for antibiotic detection, it also contains an AP / CP complex and sRNA, wherein the AP / CP complex consists of an AP that binds to the antibiotic and a CP nucleic acid sequence that complementarily pairs with the AP, and the sRNA is used to detect the recognition of the target; when the kit is used for nucleic acid detection, it also contains an ssDNA activator.
[0016] More preferably, the sequence of the AP is: CAAAATCTACCTACTCACACTATATGGGGGTTGAGGCTAAGCCGA, the sequence of the CP is: AAAACCCCCATATAGTGTAA, and the sequence of the sRNA is: UUACACUAUAUGGGGGUUUU.
[0017] The fourth aspect of the present invention provides a use of the kit described in the third aspect of the present invention in the detection of nucleic acids and antibiotics.
[0018] Preferably, the nucleic acid is miRNA-21, and the antibiotic is kanamycin.
[0019] The fifth aspect of the present invention provides a nucleic acid detection method, comprising the following steps: adding the nucleic acid to be tested to a mixed solution containing Cas12a, hRNA, ssDNA activator, NEBuffer 2.1, thioflavin T and a fluorescent signal probe, reacting at 37°C for 30 minutes, and detecting the fluorescent signal after the reaction is completed.
[0020] A sixth aspect of the present invention provides an antibiotic detection method, comprising the following steps:
[0021] (1) adding an AP / CP complex to the antibiotic to be tested, wherein the AP / CP complex is composed of an AP that binds to the antibiotic and a nucleic acid sequence that is complementary to the AP, reacting at 37° C. for 30 minutes to obtain a reaction solution;
[0022] (2) The reaction solution was added to a mixed solution containing Cas12a, hRNA, sRNA, NEBuffer 2.1, Thioflavin T and a fluorescent signal probe, and the reaction was carried out at 37° C. for 30 min. After the reaction was completed, the fluorescent signal was detected.
[0023] Compared with the prior art, the present invention has the following advantages:
[0024] (1) The fluorescent probe of the present invention contains a thio-modified G3 sequence. When the target nucleic acid and the non-nucleic acid are present, the trans-cleavage activity of SCas12a is activated, and the loop of the fluorescent signal probe is cut to release the thio-modified G3 sequence. The released thio-modified G3 sequence binds to thioflavin T (ThT) to produce a strong fluorescent signal.
[0025] (2) The fluorescent signal probe of the present invention can not only realize the "turn-on" mode of fluorescent signal from scratch, but also avoid expensive fluorophore (such as FAM) and quencher group modification (such as BHQ1). The detection process does not require complicated instruments and operation steps, and is suitable for rapid on-site detection and large-scale screening. BRIEF DESCRIPTION OF THE DRAWINGS
[0026] Figure 1 A diagram of a "turn-on" reporter probe designed using the psG3 sequence in the Scas12a system, wherein Figure A is a diagram of a pSHG3 fluorescent probe, Figure B is a diagram of a fluorescence signal detection of a pSHG3 fluorescent probe (where a represents thio-modified G3 producing a significantly enhanced fluorescence signal psG3+ThT, b represents the fluorescent probe pSHG3+ThT prepared by the present invention, and c represents ThT), Figure C is a diagram of a fluorescence signal of a psG3 sequence released by a fluorescent signal probe (where a represents ThT, b represents pSHG3+ThT, c represents pSHG3+activeSCas12a+ThT, and d represents psG3+ThT), Figure D is a diagram of an optimized number of bases in the loop of the fluorescent signal probe, and Figure E is a diagram of an optimized number of bases in the stem of the fluorescent signal probe complementary to psG3;
[0027] Figure 2 Schematic diagram of the SCas12a / psHG3 system for detecting nucleic acid and non-nucleic acid targets;
[0028] Figure 3Figure 1 is a diagram of the SCas12a / psHG3 system for detecting miRNA-21, wherein Figure A is a schematic diagram of the detection of miRNA-21 by a pSHG3 fluorescent probe, Figure B is a fluorescence signal diagram of the miRNA-21 activation sensing system (wherein a represents pSHG3+ThT, b represents pSHG3+Cas12a+miRNA-21+ssDNA+ThT, c represents pSHG3+Cas12a+hRNA+ssDNA+ThT blank control, and d represents pSHG+Cas12a+hRNA+ssDNA+miRNA-21+ThT), Figure C is a fluorescence signal diagram of miRNA-21 at different concentrations, Figure D is a correlation equation diagram of miRNA-21 concentration and fluorescence signal, and Figure E is a fluorescence signal diagram of different miRNAs (wherein a represents a blank control group, b represents miRNA-17, c represents miRNA-155, d represents miRNA-141, e represents miRNA-10b, f represents miRNA-21, and g represents a mixture of all miRNAs);
[0029] Figure 4 The SCas12a / psHG3 system is used for kanamycin detection, wherein Figure A is a schematic diagram of the pSHG3 fluorescent probe detecting kanamycin, Figure B is a fluorescence signal diagram of the kanamycin activation sensing system (wherein a represents pSHG3+ThT, b represents pSHG3+Cas12a+kanamycin+sRNA+AP / CP+ThT, c represents pSHG3+Cas12a+sRNA+hRNA+AP / CP+ThT blank control, and d represents pSHG3+Cas12a+kanamycin+sRNA+hRNA+AP / CP+ThT), Figure C is a fluorescence signal diagram of kanamycin at different concentrations, Figure D is a correlation equation diagram of kanamycin concentration and fluorescence signal, and Figure E is a fluorescence signal diagram of different antibiotics (wherein a represents blank control, b represents tetracycline, c represents oxytetracycline, d represents ciprofloxacin, e represents ofloxacin, f represents sulfamethazine, g represents kanamycin, and h represents a mixture of all antibiotics). DETAILED DESCRIPTION
[0030] In order to make the purpose, technical solution and advantages of the present invention clearer and more specific, the present invention is further described in detail by examples below. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.
[0031] Example 1 Design and optimization of psHG3 fluorescent probe
[0032] The present invention integrates the thiolated modified G3 sequence into a hairpin probe to design a fluorescent signal probe of the present invention (referred to as pSHG3 fluorescent probe). The nucleotide sequence of the thiolated modified G3 is: 5'-T*G*G*G*A*A*G*G*G*A*G*G*G-3' (SEQ ID NO.1), wherein * represents a thiophosphate bond, and the nucleotide sequence of the pSHG3 fluorescent probe is: T*G*G*G*A*A*G*G*G*A*G*G*GTTATTTTATTTTATTCCCTCCCTT (SEQ ID NO.2). The pSHG3 fluorescent probe of the present invention consists of two fragments: a loop portion designed to be cut by active Cas12a and a thiolated modified G3 sequence locked in the hairpin stem ( Figure 1 A).
[0033] The pSHG3 fluorescent probe prepared by the present invention was subjected to fluorescence signal detection, recorded as the pSHG3+ThT group (group b), and a pSHG3+ThT control group (group a) and a ThT control group (group c) were set up at the same time. The detection method of the pSHG3+ThT group was as follows: 10 μL of a solution containing pSHG3 (2.5 μM) was added to 40 μL of a mixed solution containing 1.25xNEBuffer 2.1, 2.5 μM ThT and 2.5 μM pSHG3 probe. After reacting at 37°C for 30 minutes, a Prism F98 fluorescence spectrophotometer (Shanghai Prism Technology Co., Ltd., China) was used to measure the fluorescence of the sample solution from 450 nm to 600 nm with the excitation fixed at 430 nm, and the fluorescence intensity was measured at a wavelength of 490 nm. The detection method for the psG3+ThT control group was as follows: 10 μL of a solution containing psG3 (2.5 μM) was added to 40 μL of a mixed solution containing 1.25x NEBuffer 2.1, 2.5 μM ThT, and 2.5 μM psHG3 probe. After reacting at 37°C for 30 min, the fluorescence of the sample solution was measured from 450 nm to 600 nm using a Prism F98 fluorescence spectrophotometer (Shanghai Prism Technology Co., Ltd., China) with excitation fixed at 430 nm, and the fluorescence intensity was measured at a wavelength of 490 nm. The ThT control group detection method was as follows: 40 μL of a mixed solution containing 1.25xNEBuffer 2.1, 2.5 μM ThT and 2.5 μM psHG3 probe was added, and the fluorescence of the sample solution was measured from 450 nm to 600 nm using a Lingguang F98 fluorescence spectrophotometer (Shanghai Lingguang Technology Co., Ltd., China) with the excitation fixed at 430 nm, and the fluorescence intensity was measured at a wavelength of 490 nm. The results are shown in Figure 2. Figure 1 As shown in Figure B, it can be seen that the pSHG3 fluorescent probe designed by the present invention not only maintains stability but also produces a low background signal (group b). Figure 1B The results show that the thiolated modified G3 sequence in the designed fluorescent signal probe has been successfully blocked.
[0034] Subsequently, active Cas12a was used to cut the hairpin signal probe, and the function of the psG3 sequence released by the fluorescent signal probe to generate a fluorescent signal was evaluated, which was recorded as group c. The specific steps were as follows: 10 μL of a solution containing pSHG3 (2.5 μM) was added to 40 μL of a mixed solution containing 125 nM Cas12a, 125 nM hRNA, 125 nM sRNA, 125 nMs ssDNA activator, 1x NEBuffer 2.1, 2.5 μM ThT and 2.5 μM psHG3 probe. After reacting at 37 °C for 30 min, the fluorescence of the sample solution was measured from 450 nm to 600 nm using a Prism F98 fluorescence spectrophotometer (Shanghai Prism Technology Co., Ltd., China) with excitation fixed at 430 nm, and the fluorescence intensity was measured at a wavelength of 490 nm. At the same time, control groups were set up: group a ThT, group b pSHG3+ThT, and group d psG3+ThT. The control group had the same detection process as above. The fluorescence signal size generated by pSHG3 after being cut by active Cas12a was compared with that of the same amount of psG3. The experimental results are as follows: Figure 1 As shown in C, the pSHG3 sample cut by active Cas12a produced a significantly enhanced fluorescence signal (group c) and was comparable to psG3 (group d), indicating that the thiolated modified G3 sequence released by the fluorescent probe can bind to ThT to form a complex. The number of bases in the pSHG3 loop and the number of DNA bases complementary to psG3 in the stem were optimized. According to the above fluorescence experimental steps, pSHG3 was replaced with pSHG3 with different numbers of designed bases in the loop and the number of DNA bases complementary to psG3 in the stem. The results are shown in Figure 1 D and 1E, Figure 1 D and 1E show that the optimal number of DNA bases for the loop and stem of the designed fluorescent signal probe complementary to psG3 are 15 nt and 9 nt, respectively.
[0035] The detection principle of the fluorescent probe of the present invention is as follows Figure 2 As shown, when the target nucleic acid or non-nucleic acid is present, the trans-cleavage activity of SCas12a is activated, and the loop of the fluorescent signal probe is cut to release the thio-modified G3 sequence. The released thio-modified G3 sequence binds to ThT to produce a strong fluorescent signal. When the target nucleic acid or non-nucleic acid is not present, the trans-cleavage activity of SCas12a is not activated, and the fluorescent signal probe remains stable. The thio-modified G3 sequence is enclosed in the signal probe, so there is no obvious fluorescent signal.
[0036] Example 2: Kit for nucleic acid molecule detection
[0037] A kit for nucleic acid molecule detection, the kit containing a mixed solution of 125nM Cas12a protein, 125nM hRNA, 125nM ssDNA activator, 1.25xNEBuffer 2.1, 2.5μM ThT and 2.5μM psHG3, wherein the volume of the mixed solution is 40μL.
[0038] The method for detecting nucleic acid molecules in the kit is: adding 10 μL of the nucleic acid molecule to be detected to the mixed solution of the kit, reacting at 37°C for 30 minutes, forming a psG3 / ThT complex to obtain a fluorescent signal, and measuring the intensity of the fluorescent signal. The nucleic acid molecule to be detected is miRNA-21.
[0039] The sequence of hRNA is as follows: UAAUUUCUACUAAGUGUAGAU (SEQ ID NO.3), the sequence of ssDNA activator is as follows: TCAACATCAGTCTGATAAGCTA (SEQ ID NO.4), and the sequence of miRNA-21 is as follows: UAGCUUAUCAGACUGAUGUUGA (SEQ ID NO.5).
[0040] Example 3: Kit for Antibiotic Detection
[0041] A kit for antibiotic detection, the kit containing an AP / CP complex (100 nM), a mixed solution of 125 nM Cas12a, 125 nM hRNA, 125 nM sRNA, 1.25x NEBuffer 2.1, 2.5 μM ThT and 2.5 μM psHG3 probe, wherein the volume of the mixed solution is 40 μL.
[0042] The method for detecting antibiotics in the kit is as follows: adding the antibiotic to be tested to the AP / CP complex, reacting at 37°C for 30 minutes to obtain a reaction solution, adding 10 μL of the reaction solution to a mixed solution of 125 nM Cas12a, 125 nM hRNA, 125 nM sRNA, 1.25xNEBuffer 2.1, 2.5 μM ThT and 2.5 μM psHG3 probe, reacting at 37°C for 30 minutes to activate the trans-cleavage activity of SCas12a, and then forming a psG3 / ThT complex to obtain a fluorescent signal, and measuring the intensity of the fluorescent signal. The antibiotic to be tested is kanamycin.
[0043] The sequence of AP is: CAAAATCTACCTACTCACACTATATGGGGGTTGAGGCTAAGCCGA (SEQ ID NO.6), the sequence of CP is: AAAACCCCCATATAGTGTAA (SEQ ID NO.7), and the sequence of sRNA is: UUACACUAUAUGGGGGUUUU (SEQ ID NO.8).
[0044] Example 4 Detection of miRNA-21 by using psHG3 fluorescent probe
[0045] The kit of Example 2 was used to detect miRNA-21, and the detection method was as described in Example 2, and the specific steps were as follows: 10 μL of the miRNA-21 to be tested was added to 40 μL of a mixed solution containing 125 nM Cas12a, 125 nM hRNA, 125 nM ssDNA activator, 1.25x NEBuffer 2.1, 2.5 μM ThT, and 2.5 μM psHG3 probe. After reacting at 37 ° C for 30 minutes, the fluorescence of the sample solution was measured from 450 nm to 600 nm using a Prism F98 fluorescence spectrophotometer (Shanghai Prism Technology Co., Ltd., China) with excitation fixed at 430 nm, and the fluorescence intensity was measured at a wavelength of 490 nm.
[0046] The principle of psHG3 fluorescent probe for detecting miRNA-21 is shown in Figure 3 A, after adding miRNA-21, it complementarily pairs with the ssDNA activator and then activates SCas12a. The active SCas12a cuts the hairpin loop of the fluorescent signal probe, releasing the thiolated modified G3 formation sequence, which will bind to ThT and provide a fluorescent signal. However, when miRNA-21 is not added, SCas12a is not activated, and the fluorescent signal probe remains stable, thus showing a low fluorescence intensity.
[0047] In order to verify the feasibility of detecting miRNA-21 by the kit of Example 2 of the present invention, control groups were set up at the same time, namely, pSHG3+ThT control group (group a), pSHG3+Cas12a+miRNA-21+ssDNA+ThT control group (group b), pSHG3+Cas12a+hRNA+ssDNA+ThT blank control (group c), and the kit of Example 2 of the present invention detected miRNA-21 as group d. The detection steps of the psHG3+ThT control group are as follows: 40 μL of a mixed solution containing 1.25xNEBuffer 2.1, 2.5 μM ThT and 2.5 μM psHG3 was reacted at 37°C for 30 minutes, and then the fluorescence of the sample solution was measured from 450 nm to 600 nm using a Prism F98 fluorescence spectrophotometer (Shanghai Prism Technology Co., Ltd., China) with excitation fixed at 430 nm, and the fluorescence intensity was measured at a wavelength of 490 nm. The detection steps of the psHG3+Cas12a+miRNA-21+ssDNA+ThT control group are as follows: 10 μL of the miRNA-21 to be tested is added to 40 μL of a mixed solution containing 125 nM Cas12a, 125 nM ssDNA activator, 1.25xNEBuffer 2.1, 2.5 μM ThT and 2.5 μM psHG3 probe. After reacting at 37 ° C for 30 minutes, the fluorescence of the sample solution is measured from 450 nm to 600 nm using a Prism F98 fluorescence spectrophotometer (Shanghai Prism Technology Co., Ltd., China) with excitation fixed at 430 nm, and the fluorescence intensity is measured at a wavelength of 490 nm. The detection steps of the blank control of psHG3+Cas12a+hRNA+ssDNA+ThT were as follows: 40 μL of a mixed solution containing 125 nM Cas12a, 125 nM hRNA, 125 nM ssDNA activator, 1.25xNEBuffer 2.1, 2.5 μM ThT, and 2.5 μM psHG3 probe was reacted at 37 °C for 30 min, and then the fluorescence of the sample solution was measured from 450 nm to 600 nm using a Prism F98 fluorescence spectrophotometer (Shanghai Prism Technology Co., Ltd., China) with the excitation fixed at 430 nm. The fluorescence signal of the miRNA-21 activated sensing system was measured at a wavelength of 490 nm. Figure 3 As shown in B, Figure 3 B shows that the fluorescence signal generated by the miRNA-21 activated sensing system (group d) is significantly higher than that of the blank control (group c), which proves the feasibility of the kit of Example 2 for detecting miRNA-21.
[0048] The kit detection method described in Example 2 was used to detect miRNA-21 at different concentrations of 0, 0.2, 5, 9, 12, 15, 18 and 20 pM, and the detection performance of the kit described in Example 2 was evaluated. The results are as follows: Figure 3 C shows that the fluorescence signal is significantly enhanced with the increase of miRNA-21. In the range of 0.2 to 20 nM, the correlation equation is F = 56.90C + 239.79 (see Figure 3 D, R 2 =0.995), and the limit of detection (LOD) was estimated to be 100 fM (S / N=3).
[0049] The kit detection method described in Example 2 was used to detect miRNA-17, miRNA-155, miRNA-141 and miRNA-10b to verify the selectivity of the kit for highly homologous miRNAs. The results are as follows Figure 3 As shown in E, it can be seen that the kit is insensitive to interfering miRNA, but has a strong response to miRNA-21, indicating that this method has significant selectivity.
[0050] Among them, the sequence of miRNA-17 is: CAAAGUGCUUACAGUGCAGGUAG (SEQ ID NO.9), the sequence of miRNA-155 is: UUAAUGCUAAUCGUGAUAGGGGU (SEQ ID NO.10), the sequence of miRNA-141 is: UAACACUGUCUGGUAAAGAUGG (SEQ ID NO.11), and the sequence of miRNA-10b is: UACCCUGUAGAACCGAAUUUGUG (SEQ ID NO.12).
[0051] Example 5 Detection of Kanamycin by psHG3 Fluorescent Probe
[0052] Kanamycin was detected using a kit containing a pSHG3 fluorescent probe in Example 3, and the detection method was as described in Example 3. The specific steps are as follows: (1) AP / CP complex (100 nM) was added to the kanamycin to be tested and incubated for 30 minutes at 37°C to release the CP sequence to obtain a reaction solution; wherein AP refers to a nucleic acid aptamer sequence that can bind to kanamycin; CP is a sequence complementary to AP and can act as an activator to activate the trans-cleavage activity of Cas12a; (2) 10 μL of the above reaction solution was added to 40 μL of a mixed solution containing 125 nM Cas12a, 125 nM hRNA, 125 nM sRNA, 1.25xNEBuffer 2.1, 2.5 μM ThT and 2.5 μM psHG3 probe; reacted at 37°C for 30 minutes to activate the trans-cleavage activity of SCas12a, and then formed a psG3 / ThT complex to obtain a fluorescent signal, and the intensity of the fluorescent signal was measured.
[0053] The principle of psHG3 fluorescent probe for detecting kanamycin is shown in Figure 4 A, When kanamycin is added, it binds to the AP sequence in the AP / CP complex and then releases the CP sequence. Subsequently, the released CP sequence hybridizes with the target recognition sequence (sRNA), activating the trans-cleavage activity of Cas12a, thereby initiating a signal on the fluorescent detection system.
[0054] In order to verify the feasibility of detecting kanamycin by the kit of Example 3 of the present invention, control groups were set up at the same time, namely, pSHG3+ThT control group (group a), pSHG3+Cas12a+kanamycin+sRNA+AP / CP+ThT control group (group b), pSHG3+Cas12a+sRNA+hRNA+AP / CP+ThT blank control (group c), and the kit of Example 3 of the present invention detected kanamycin as group d. The detection steps of the psHG3+ThT control group are as follows: 40 μL of a mixed solution containing 1.25xNEBuffer 2.1, 2.5 μM ThT and 2.5 μM pSHG3 probe, reacted at 37 ° C for 30 minutes, and the fluorescence of the sample solution was measured from 450 nm to 600 nm using a Prism F98 fluorescence spectrophotometer (Shanghai Prism Technology Co., Ltd., China) with excitation fixed at 430 nm, and the fluorescence intensity was measured at a wavelength of 490 nm. The detection steps of the psHG3+Cas12a+kanamycin+sRNA+AP / CP+ThT control group are as follows: (1) adding AP / CP complex (100 nM) to the kanamycin to be tested and incubating at 37°C for 30 minutes to release the CP sequence to obtain a reaction solution; wherein AP refers to the nucleic acid aptamer sequence that can bind to kanamycin; CP is a sequence complementary to AP and can act as an activator to activate the trans-cleavage activity of Cas12a; (2) adding 10 μL of the above reaction solution to 40 μL containing 125 nM Cas12a, 125 nM sRNA, 1.25x NEBuffer 2.1, 2.5 μM ThT and 2.5 μM After reacting in a mixed solution of psHG3 probe at 37°C for 30 min, the fluorescence of the sample solution was measured from 450 nm to 600 nm using a Lingguang F98 fluorescence spectrophotometer (Shanghai Lingguang Technology Co., Ltd., China) with excitation fixed at 430 nm, and the fluorescence intensity was measured at a wavelength of 490 nm. The detection steps of the blank control of psHG3+Cas12a+sRNA+hRNA+AP / CP+ThT are as follows: 10 μL AP / CP complex (100 nM) was added to 40 μL of a mixed solution containing 125 nM Cas12a, 125 nM sRNA, 125 nM hRNA, 1.25x NEBuffer2.1, 2.5 μM ThT and 2.5 μM psHG3 probe, and reacted at 37 °C for 30 minutes. The fluorescence of the sample solution was measured from 450 nm to 600 nm using a Prism F98 fluorescence spectrophotometer (Shanghai Prism Technology Co., Ltd., China) with the excitation fixed at 430 nm, and the fluorescence intensity was measured at a wavelength of 490 nm. The fluorescence signal results of the kanamycin-activated sensing system are shown in Figure 2. Figure 4 As shown in B, through Figure 4The fluorescence signal results in B prove that the detection system is triggered only in the presence of kanamycin (30 nM) (group d), demonstrating the feasibility of the system for detecting kanamycin.
[0055] The kit described in Example 3 was used to detect different concentrations of kanamycin (0.3-30 nM), and it was observed that the fluorescence value increased with the increase of kanamycin concentration (see Figure 4 C). In the detection range of 0.3-30 nM, the fluorescence value is linearly correlated with the kanamycin concentration, and the correlation equation is Y=37.31C+261.69 (see Figure 4 D, R 2 =0.997), and the limit of detection (LOD) was estimated to be 100 pM (S / N=3).
[0056] The practical application value of the detection method depends not only on its sensitivity, but also on its selectivity. The kit described in Example 3 was used to detect tetracycline, oxytetracycline, ciprofloxacin, ofloxacin and sulfamethazine according to the method for detecting antibiotics with the kit. The results are as follows: Figure 4 E, it can be seen that the SCas12a / psHG3 system has excellent selectivity for kanamycin detection, and the SCas12a / psHG3 system shows negligible fluorescence values for the blank control and other interfering antibiotics.
Claims
1. A fluorescent signal probe, characterized in that: The fluorescent signal probe is a hairpin nucleic acid probe, and the stem of the hairpin nucleic acid probe contains a thiolated modified G3 sequence.
2. The fluorescent signal probe according to claim 1, characterized in that The nucleotide sequence of the thiolated modified G3 sequence is 5'-TGGGAAGGGAGGG-3'.
3. The fluorescent signal probe according to claim 2, characterized in that: The length of the DNA sequence complementary to the thiolated modified G3 sequence in the stem of the hairpin nucleic acid probe is no less than 5 nt.
4. Use of the fluorescent signal probe according to any one of claims 1 to 3 in the detection of nucleic acids and antibiotics.
5. A kit, characterized in that: The kit contains the fluorescent signal probe according to any one of claims 1 to 3.
6. The kit according to claim 5, characterized in that The kit also contains Cas12a protein and hRNA.
7. The kit according to claim 6, characterized in that When the kit is used for antibiotic detection, it also contains an AP / CP complex and sRNA. The AP / CP complex consists of an AP that binds to the antibiotic and a nucleic acid sequence that is complementary to the AP. The sRNA is used for detecting the recognition of the target. When the kit is used for nucleic acid detection, it also contains an ssDNA activator.
8. Use of the kit according to any one of claims 5 to 7 in nucleic acid and antibiotic detection.
9. A method for nucleic acid detection, characterized in that: The following steps are involved: The nucleic acid to be tested is added to a mixed solution containing Cas12a, hRNA, ssDNA activator, NEBuffer 2.1, Thioflavin T and the fluorescent signal probe according to claim 1, and the reaction is carried out at 20 to 40° C. for 5 to 60 minutes. After the reaction is completed, the fluorescent signal is detected.
10. A method for detecting antibiotics, characterized in that: The following steps are involved: (1) adding an AP / CP complex to the antibiotic to be tested, wherein the AP / CP complex is composed of an AP that binds to the antibiotic and a nucleic acid sequence that is complementary to the AP, and reacting at 20 to 40° C. for 5 to 60 minutes to obtain a reaction solution; (2) adding the reaction solution to a mixed solution containing Cas12a, hRNA, sRNA, NEBuffer 2.1, thioflavin T and the fluorescent signal probe according to claim 1, reacting at 20 to 40° C. for 5 to 60 minutes, and detecting the fluorescent signal after the reaction is completed.