A nucleic acid detection paper chip, detection method, device and application based on the RPA / RT-RPA and CRISPR / Cas12a systems

Abstract

The present invention provides a nucleic acid detection paper chip, a detection method, a device and an application based on the RPA / RT-RPA and CRISPR / Cas12a systems. The paper chip comprises a hydrophobic backing layer located at the lower layer and a hydrophilic reaction layer located at the upper layer. The hydrophilic reaction layer includes a first hydrophilic reaction region and a second hydrophilic reaction region. The first hydrophilic reaction region is coated with a freeze-dried RPA / RT-RPA premix, and the second hydrophilic reaction region is coated with a freeze-dried CRISPR / Cas12a premix. The present invention provides a simple, rapid and sensitive nucleic acid detection platform by using the isothermal amplification of RPA / RT-RPA and the targeted nucleic acid recognition of CRISPR / Cas12a, which is particularly suitable for on-site detection environments with limited resources.

Description

Technical Field

[0001] The present invention belongs to the technical field of nucleic acid detection, and in particular relates to a nucleic acid detection paper chip, a detection method, a device and an application based on the RPA / RT-RPA and CRISPR / Cas12a systems. Background Art

[0002] With the development of modern molecular biology, nucleic acid detection, as an important means for disease diagnosis, pathogen identification and genetic analysis, occupies an indispensable position in clinical medicine and basic research. Traditional nucleic acid detection methods usually rely on polymerase chain reaction (PCR). Since this method requires a thermal cycler with high temperature control accuracy, and the denaturation, annealing and extension steps necessary for the reaction make the entire amplification detection time longer, it is difficult to achieve rapid on-site detection of nucleic acid molecules. CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) is a gene editing technology derived from bacteria and archaea. It is essentially an immune system of bacteria that can recognize and destroy invading viral DNA. crRNA can bind to an RNA-induced endonuclease Cas (CRISPR-associated) protein to form a complex. In addition, when the nucleic acid sequence of crRNA can be complementary to the nucleic acid sequence of the target genome, the CRISPR / Cas system can cleave the nucleic acid sequence. The V-type Cas12 enzyme family is one of them. After specific recognition and cleavage, it can rapidly cleave any non-specific single-stranded DNA (ssDNA) near it. This unique catalytic property has been used as a diagnostic tool for CRISPR.

[0003] A commonly used detection strategy includes first amplifying the target sequence to generate a large number of detection templates. Then, the CRISPR / Cas system specifically recognizes these templates and activates the Cas effector protein to cleave the fluorescent probe in the reaction system, so as to be able to detect samples with low virus loads. Isothermal nucleic acid amplification-based methods mainly include loop-mediated isothermal amplification (LAMP) and recombinase polymerase amplification (RPA). Currently, most studies combining CRISPR detection with nucleic acid amplification detection utilize tubular liquid reactions, involving multiple fluid handling steps, which makes them suboptimal for point-of-care (POC) diagnosis. Paper is a material with simple manufacturing, portability and low cost. Paper-based molecular tests provide an attractive form for the development of nucleic acid diagnostic assays for POC applications, thanks to their inherent simplicity, biocompatibility, and the fact that they do not rely on external fluid handling components. Paper-based diagnostic devices have been considered a good alternative for future POC tests, which can achieve rapid, portable and accurate on-site instant detection, that is, a paper-based sensor for nucleic acid detection for POCT. Summary of the Invention

[0004] In view of this, the present invention aims to overcome the defects in the prior art and provides a nucleic acid detection paper chip, a detection method, a device and an application based on the RPA / RT-RPA and CRISPR / Cas12a systems.

[0005] To achieve the above object, the technical solution of the present invention is realized as follows:

[0006] In a first aspect of the present invention, there is provided a nucleic acid detection paper chip based on the RPA / RT-RPA and CRISPR / Cas12a systems. The paper chip includes a hydrophobic backing layer located at the lower layer and a hydrophilic reaction layer located at the upper layer. The hydrophilic reaction layer includes a first hydrophilic reaction region and a second hydrophilic reaction region. The first hydrophilic reaction region is coated with an RPA / RT-RPA premix solution, and the second hydrophilic reaction region is coated with a CRISPR / Cas12a premix solution.

[0007] In some embodiments of the present invention, the RPA / RT-RPA premix solution includes, but is not limited to, enzyme powder, buffer solution, amplification primers for the target gene, lyoprotectant, and ultrapure water.

[0008] In some embodiments of the present invention, the design principle of the amplification primer sequence of the target gene is that the lengths of the upstream primer and the downstream primer sequences are 20-50 nt, and the sequences do not form stable secondary structures. The amplification primer sequence of the target gene is an amplification primer that satisfies the amplification primer design principle of the present invention for any one of the nucleic acid detection targets.

[0009] In some embodiments of the present invention, the CRISPR / Cas12a premix solution includes, but is not limited to, Cas12a protein, crRNA, reaction buffer solution, reducing agent, ssDNA-FQ fluorescent reporter probe, lyoprotectant, and ultrapure water.

[0010] In some embodiments of the present invention, the reducing agent selected is DTT (dithiothreitol) or tris(2-carboxyethyl)phosphine hydrochloride (TCEP).

[0011] In some embodiments of the present invention, the reaction buffer solution selected is NEBuffer2.1 buffer solution.

[0012] In some embodiments of the present invention, the cryoprotectants in the RPA / RT-RPA premix and the CRISPR / Cas12a premix are independently selected from one or more of sucrose, mannitol, trehalose, bovine serum albumin, glycerol, pH buffer, and glycine. The cryoprotectant can effectively extend the active period of RPA-related enzyme components, Cas12a protein and its components, and ensure the stability and reliability of the detection components.

[0013] In some embodiments of the present invention, the cryoprotectant is any one of the following:

[0014] (1) Trehalose;

[0015] (2) A mixture of trehalose and sucrose;

[0016] (3) A mixture of sucrose and mannitol;

[0017] (4) A mixture of trehalose and mannitol;

[0018] (5) A mixture of sucrose, mannitol and trehalose.

[0019] In some embodiments of the present invention, the materials of the hydrophobic backing layer and the hydrophilic reaction layer are Whatman No.1 qualitative filter paper.

[0020] In some embodiments of the present invention, the design principle of the crRNA sequence is that the 5'-end of the crRNA targeting sequence should have 5'-TTN-3' or TCTV, TTCV, CTTV sequences, and the number of complementary base pairs between the crRNA and the targeting sequence is not less than 18 bp. The sequence of the crRNA is a crRNA sequence that meets the crRNA design principle of the present invention for any one of the nucleic acid detection targets.

[0021] In some embodiments of the present invention, the Cas12a protein is a Cas12a protein having endonuclease activity and accessory nucleic acid cleavage activity. In some embodiments of the present invention, the Cas12a protein is selected from LbCas12a, FnCas12a, AsCas12a, ScCas12a.

[0022] In some embodiments of the present invention, the ssDNA-FQ fluorescent reporter probe is modified with a fluorescent reporter group and a fluorescent quenching group. The fluorescent reporter group includes but is not limited to FAM, VIC, HEX, TET, JOE, Cy5, Cy3, TAMRA. The fluorescent quenching group includes but is not limited to BHQ1, BHQ2, BHQ3.

[0023] Based on the trans-cleavage activity of CRISPR / Cas12a, ssDNA-FQ is non-specifically cleaved to design the ssDNA-FQ fluorescent reporter probe required for the fluorescence detection system. Since the LbCas12a protein has better cleavage activity for adenine A and thymine T, the basic sequence of ssDNA-FQ includes but is not limited to TTATT. A fluorescent reporter group FAM group is added to the 5' end, and a fluorescent quenching group BHQ1 group is added to the 3' end. Preferably, the structure of the sequence of the ssDNA-FQ fluorescent reporter probe is 5'-FAM-TTATT-BHQ1-3'.

[0024] In some embodiments of the present invention, the final volume of the RPA / RT-RPA premix is 50 μL, which includes 29.4 μL of buffer and enzyme powder, forward primer, reverse primer, mannitol, sucrose, and the final volume of 50 μL is made up with ultrapure water. Among them, the concentration of the forward primer is 0.1-1 μM, the concentration of the reverse primer is 0.1-1 μM, the concentration of mannitol is 0.001-2.0 g / mL, and the concentration of sucrose is 0.001-2.0 g / mL. Among them, the buffer includes 0.5-100 mM Tris acetate, 10-200 mM potassium acetate, 10-200 mM magnesium acetate, 1-10 mM DTT, 10-300 uM dNTPs, 1-5 mM ATP, 5% PEG, 2-200 mM creatine.

[0025] The enzyme powder contains DNA polymerase, DNA recombinase, single-stranded DNA binding protein GP32, recombinant regulatory protein and kinase.

[0026] In some embodiments of the present invention, the CRISPR / Cas12a premix includes the following components at the following concentrations: 50-800 nM Cas12a protein, 0.2-10 μM crRNA, 1× NEBuffer 2.1 buffer, 1-20 mM DTT, 0.1-10 μM ssDNA-FQ fluorescent reporter probe, 0.001-2.0 g / mL mannitol, 0.001-2.0 g / mL sucrose, and the final volume of 25 μL is made up with ultrapure water.

[0027] The second aspect of the present invention provides a method for preparing the nucleic acid detection paper chip based on the RPA / RT-RPA and CRISPR / Cas12a systems as described above, including the following steps:

[0028] (1) Adhere two hydrophilic layers to the surface of the hydrophobic backing layer to form a first hydrophilic reaction zone and a second hydrophilic reaction zone respectively to form a carrier;

[0029] (2) Add the RPA / RT-RPA premix to the first hydrophilic reaction zone, add the CRISPR / Cas12a premix to the second hydrophilic reaction zone, and then perform freeze-drying to obtain the nucleic acid detection paper chip, which is stored at room temperature after drying.

[0030] In some embodiments of the present invention, the conditions for freeze-drying are to freeze the carrier with the RPA / RT-RPA premix and the CRISPR / Cas12a premix added at -80°C for 20 min, and then perform vacuum freeze-drying at -90°C for 5 h using a freeze-dryer.

[0031] In some embodiments of the present invention, the hydrophobic backing layer is a rectangular platform with a length of 2 cm and a width of 1 cm, and the first hydrophilic reaction zone and the second hydrophilic reaction zone are divided into independent reaction regions by printing patterns, drawing hydrophobic barriers, etc.

[0032] In some embodiments of the present invention, both the first hydrophilic reaction zone and the second hydrophilic reaction zone are disc-shaped with a diameter of 3 mm, and the dropping amounts of the RPA / RT-RPA premix and the CRISPR / Cas12a premix are both 3 μL.

[0033] In the third aspect of the present invention, a method for nucleic acid detection using the above-mentioned nucleic acid detection paper chip based on the RPA / RT-RPA and CRISPR / Cas12a systems is provided, including the following steps:

[0034] S1: Introduce the sample to be tested into the first hydrophilic reaction zone of the paper chip and then perform RPA / RT-RPA isothermal amplification;

[0035] S2: Fold the paper chip so that the RPA / RT-RPA isothermal amplification product in the first hydrophilic reaction zone contacts the second hydrophilic reaction zone to perform the CRISPR / Cas12a reaction;

[0036] S3: Read the detection result. If a fluorescence signal is read, the sample to be tested contains the target gene, otherwise the sample to be tested does not contain the target gene.

[0037] In some embodiments of the present invention, the sample to be tested is a mixed solution of a nucleic acid template and magnesium acetate.

[0038] In some embodiments of the present invention, the sample to be tested is a mixed solution containing 1 μL of nucleic acid template, 0.15 μL of magnesium acetate solution with a concentration of 200 mM, and 0.85 μL of nuclease-free water.

[0039] In some embodiments of the present invention, the conditions for the RPA / RT-RPA isothermal amplification in step S1 are: perform an isothermal amplification reaction at 35 - 45°C for 5 - 30 min.

[0040] In some embodiments of the present invention, the conditions for the CRISPR / Cas12a reaction in step S2 are: incubation at 37 °C for 5 - 60 min.

[0041] In a fourth aspect of the present invention, there is provided a nucleic acid detection device based on the RPA / RT - RPA and CRISPR / Cas12a systems, comprising the above - mentioned paper chip, a camera, a darkroom, a light source, and a band - pass filter; a sample observation window is provided at the top of the darkroom, the camera is installed above the sample observation window, the paper chip is arranged at the bottom of the darkroom and below the sample observation window, the band - pass filter is installed between the sample observation window and the paper chip, and a constant - temperature heating pad is arranged at the bottom of the paper chip.

[0042] In some embodiments of the present invention, the darkroom is made of light - proof material and is open at one end for the constant - temperature heating pad and the paper chip to enter and exit.

[0043] In some embodiments of the present invention, the constant - temperature heating pad is a 37 °C constant - temperature heating pad, which is used to heat the paper chip to provide the temperature required for the reaction.

[0044] In some embodiments of the present invention, the wavelength of the light source is 450 nm.

[0045] In some embodiments of the present invention, the band - pass filter is a 525 nm green band - pass filter, which selectively filters light to reduce interference from other colors.

[0046] In some embodiments of the present invention, the nucleic acid detection device further includes a power source for powering the light source, such as a mobile power source, an external AC power source, etc.

[0047] In some embodiments of the present invention, the camera can be replaced by a commercially available smartphone with a camera. After the reaction is completed, the LED light source irradiates the reacted paper chip to excite the fluorescence signal. Subsequently, the smartphone is used to capture the fluorescence image after passing through the green band - pass filter. The acquired image data will be quantitatively analyzed by software such as ImageJ to achieve an accurate assessment of the sample.

[0048] In a fifth aspect of the present invention, there is provided the application of the above - mentioned paper chip in nucleic acid detection for non - disease diagnosis and treatment purposes, such as norovirus, Salmonella, etc.

[0049] In some embodiments of the present invention, the target gene of norovirus is (5'-3'): TTTGGAAAACTGGAGCAGAGTTCAATACTTAGGCAAATGTACTGGACTAGGGGTTCCAACCATGAAGACCCATCTGAAACAATGATTCCACACTCCCAAAGACCCATACAACTGATGTCCCTACTGGGGGAGGCCGCACTCCACGGCCCAGCATTCTACAGCAAAATCAGCAAGTTAGTCATTGCAGAGCTAAAAGAAGGTGGCATGGATTTTTACGTGCCCAGACAAGAGCCAATGTTCAGATGGATGAGATTCTCAGATCTGAGCACGTGGGAGGGCGATCGCAATCTGGCTCCCAGTTTTGTGAATGAAGATGGCGTCGAGTGACGCCAACCCATCTGATGGGTCCACAGCCAACCTCGTCCCAGAGGTCAACAATGAGGTTATGGCTTTGGAGCCCGTTGTTGGTGCCGCCATTGCGGCACCTGTAGCGGGCCAACAAAATGTAATTGACCCCTGGATTAGAAACAATTTTGTACAAGCCCCTGGTGGAGAGTTCACAGTATCCCCTAGAAACGCTCCAGGTGAAATACTGTGGAGCGCGCCCTTAGGTCCTGATTTGAATCCCTACC (SEQ ID NO:1).

[0050] In some embodiments of the present invention, the amplification primer sequences for detecting norovirus are as follows:

[0051] Forward primer: ATGTTCAGATGGATGAGATT (SEQ ID NO:2);

[0052] Reverse primer: TCGACGCCATCTTCATTCAC (SEQ ID NO:3).

[0053] In some embodiments of the present invention, the target gene of Salmonella is (5'-3'): GTGGTAAATTATTCCGATGAAGTCGTGTCCTTTGGTATTAATCCAACAATCCATCAGCAAGGTAGCAGTCAGTATTTCTGGGTAACGCATGAAGAGGGGGAGAAACTCCGGGAGCTTGGCTATGTGTTGCGGAACGCGCTTGATGAGCTTTACCACTGTCTGGCGGTGACGCTGGCGCGCAACGTCAATGAATATTTCGGTATTCAGGAAACAAAACATATGCTGGACCAACTGGAAGCGAAATTTCCTGATTTACTTAAAGAAGTGCTCAGACATGCCACGGTACAACGTATATCTGAAGTTTTGCAGCGTTTGTTAAGCGAACGTGTTTCCGTGCGTAATATGAAGTTAATTATGGAAGCGCTCGCATTGTGGGCGCCAAGAGAAAAAGATGTCATTAACCTTGTGGAGCATATTCGTGGAGCAATGGCGCGTTATATTTGTCATAAATTCGCCAATGGCGGCGAATTACGAGCAGTAATGGTATCTGCTGAAGTTGAGGATGTTATTCGCAAAGGGATCCGTCAGACCTCTGGCAGTACCTTCCTCAGCCTTGACCCGGAAGCCTCCGCTAATTTGATGGATCTCATTACACTTAAGTTGGATGATTTATTGATTGCACATAAAGATCTTGTCCTCCTTACGTCTGT (SEQ ID NO:4).

[0054] In some embodiments of the present invention, the primer sequences of Salmonella are as follows:

[0055] Forward primer: AACTGGAAGCGAAATTTCCTGATTTACT (SEQ ID NO:5);

[0056] Reverse primer: CGAATTTATGACAAATATAACGCGCCAT (SEQ ID NO:6).

[0057] Compared with the prior art, the present invention has the following advantages:

[0058] (1) Constant temperature and simplicity: Traditional PCR methods require complex temperature control equipment. In contrast, the detection method combining RPA / RT-RPA and CRISPR / Cas12a in the present invention utilizes isothermal amplification reactions to eliminate the dependence on high-temperature equipment. The detection process is simple, rapid, and suitable for on-site environments without high-end equipment.

[0059] (2) Rapid: The total time for RPA / RT-RPA and CRISPR / Cas12a nucleic acid detection (including isothermal amplification, CRISPR / Cas12a detection, and signal reading) does not exceed half an hour, significantly shortening the detection cycle.

[0060] (3) High sensitivity and high specificity: The nucleic acid detection method of the present invention has the dual signal amplification and specificity of RPA / RT-RPA and CRISPR / Cas12a. Therefore, the present invention has higher detection sensitivity and specificity. The detection sensitivity reaches 1 copy / reaction, and it can specifically detect target nucleic acids without detecting signals for other non-target substances such as novel coronavirus, herpes simplex virus, human papillomavirus, Salmonella, Staphylococcus aureus, group B streptococcus, human genome, Candida tropicalis, rotavirus, etc.

[0061] (4) Stable: The detection systems of existing technologies involve cumbersome sample addition steps, and nucleic acid cross-contamination may occur during the liquid sample addition process. Most of the reagents used need to be stored at -20°C, which brings inconvenience to the storage and transportation of reagents, thereby increasing the detection cost. Through freeze-drying technology, the present invention selects a paper-based material suitable for freeze-drying of the two systems to accommodate RPA and CRISPR components, which can be stored at room temperature, facilitating use and transportation. Through the folding of the paper-based material, the RPA amplification products can be directly transferred to the CRISPR reaction area without additional operations, avoiding potential cross-contamination. It does not rely on cold chain for long-term storage and is easy to be restored on paper for field applications.

[0062] (5) Portable: Through the paper-based material, the detection platform of the present invention has good portability, does not rely on expensive equipment, has low production and use costs, is suitable for large-scale low-cost screening, and is especially suitable for the rapid detection needs of primary hospitals and remote areas.

[0063] (6) Low cost: Through simple paper processing and structural design, an efficient detection process can be achieved without expensive equipment. Description of the Drawings

[0064] Figure 1 Schematic diagram of freeze-drying with the premixed solutions of RT-RPA and CRISPR / Cas12a related components added to the paper chip respectively;

[0065] Figure 2Optimization results of the conditions for nucleic acid detection on paper chips by RT-RPA and CRISPR / Cas12a. (A) Numerical graph of the autofluorescence background of different paper substrates; (B) Numerical graph of the fluorescence for nucleic acid detection on different paper substrates and their signal-to-noise ratios; (C) Numerical graph of the fluorescence of different single and combined lyoprotectants.

[0066] Figure 3 Sensitivity results for nucleic acid detection on paper chips by RT-RPA and CRISPR / Cas12a;

[0067] Figure 4 Specificity results for norovirus detection on paper chips by RT-RPA and CRISPR / Cas12a;

[0068] Figure 5 Specificity results for Salmonella detection on paper chips by RT-RPA and CRISPR / Cas12a;

[0069] Figure 6 Results of nucleic acid detection in oyster samples on paper chips by RT-RPA and CRISPR / Cas12a. In the figure, *** indicates extremely significant statistical differences;

[0070] Figure 7 Schematic diagram of a portable detection device for nucleic acid detection on paper chips by RT-RPA and CRISPR / Cas12a;

[0071] Figure 8 Sensitivity results for norovirus detection by a nucleic acid detection device based on the RPA / RT-RPA and CRISPR / Cas12a systems.

[0072] Reference numerals:

[0073] 1. Paper chip; 2. Camera; 3. Darkroom; 4. Light source; 5. Band-pass filter; 6. Sample observation window; 7. Constant temperature heating pad; 8. Power supply. Detailed implementation manners

[0074] The embodiments of the present invention will be described in detail below. The following described embodiments are exemplary and are only used to explain the present invention and should not be construed as a limitation to the present invention.

[0075] In this article, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the technical field to which this application belongs.

[0076] In this article, when values are described as ranges, it should be understood that such disclosure includes the disclosure of all possible sub-ranges within that range, as well as specific values falling within that range, regardless of whether specific values or specific sub-ranges are explicitly indicated.

[0077] In this text, when it comes to "multiple", etc., unless otherwise specified, it means greater than 2 or equal to 2 in quantity. For example, "one or more" means one or greater than or equal to two.

[0078] In this text, when it comes to "preferred" and "more preferred", they are only used to describe the embodiments or examples with better effects. It should be understood that they do not constitute a limitation on the protection scope of the present invention.

[0079] In this text, when it comes to "further", etc., which are used for descriptive purposes, indicating differences in content, but should not be understood as a limitation on the protection scope of the present invention.

[0080] In this text, the term "and / or" is a description of the associative relationship of objects, indicating that three relationships can exist. For example, A and / or B means: A or B, or the three relationships of A and B.

[0081] In this text, the term "about" means + / - 10% of the specified value, preferably + / - 5%, and more preferably + / - 1%.

[0082] In this text, the terms "comprising", "including", "having", "containing", etc. are all open-ended terms, that is, they are meant to include but not be limited to.

[0083] Unless otherwise specified, all technical and scientific terms used in this text have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described in this text can also be used in the implementation or testing of the present invention.

[0084] In the first aspect of the present invention, a nucleic acid detection paper chip based on the RPA / RT-RPA and CRISPR / Cas12a systems is provided. The paper chip includes a hydrophobic backing layer located at the lower layer and a hydrophilic reaction layer located at the upper layer. The hydrophilic reaction layer includes a first hydrophilic reaction region and a second hydrophilic reaction region. The first hydrophilic reaction region is coated with an RPA / RT-RPA premix, and the second hydrophilic reaction region is coated with a CRISPR / Cas12a premix.

[0085] Specifically, the preparation method of the paper chip includes but is not limited to:

[0086] The paper chip is constructed using Whatman No.1 qualitative filter paper and consists of two layers: a lower hydrophobic backing layer and an upper hydrophilic reaction layer. For the lower hydrophobic backing layer, a rectangular Whatman No.1 qualitative filter paper with a cut size of 2 cm × 1 cm is used. The hydrophobic area is depicted on the filter paper using black crayon. Black paraffin wax is added to a conical flask and melted by heating in a metal bath. The melted paraffin wax is poured into a plastic petri dish. Then the filter paper is slowly immersed in the melted paraffin wax to form a wax-impregnated area, and then the wax-impregnated filter paper is placed on a clean aluminum foil and cooled for at least 2 minutes. The cooled filter paper is cut into a cuboid with dimensions of 2 cm×1 cm using a clean paper cutter. For the upper hydrophilic reaction layer, Whatman No.1 qualitative filter paper is prepared into circular paper discs with a diameter of 3 mm using a hole punch. Two of these hydrophilic circular paper discs are adhered to the left and right sides of the rectangular backing layer. The circular paper discs are vertically axisymmetric in the rectangle and serve as the first hydrophilic reaction area and the second hydrophilic reaction area in the upper part;

[0087] The above hydrophobic area can also use black hydrophobic tape to form the lower hydrophobic backing layer. The first hydrophilic reaction area and the second hydrophilic reaction area are circular paper discs with a diameter of 3 mm.

[0088] In some embodiments of the present invention, the RPA / RT-RPA premix includes but is not limited to enzyme powder, buffer solution, amplification primers for the target gene, cryoprotectant, and ultrapure water.

[0089] In some embodiments of the present invention, the design principle of the amplification primer sequence for the target gene is: the lengths of the upstream primer and the downstream primer sequences are 20 - 50 nt, and the sequences do not form stable secondary structures. The amplification primer sequence for the target gene is an amplification primer that meets the amplification primer design principle of the present invention for any one of the nucleic acid detection targets.

[0090] In some embodiments of the present invention, the CRISPR / Cas12a premix includes but is not limited to Cas12a protein, crRNA, NEBuffer 2.1 buffer solution, reducing agent (such as DTT (dithiothreitol)), ssDNA-FQ fluorescent reporter probe, cryoprotectant, and ultrapure water.

[0091] In some embodiments of the present invention, the cryoprotectant is composed of one or several of sucrose, mannitol, trehalose, bovine serum albumin, glycerol, pH buffer, and glycine, and can effectively extend the active period of RPA-related enzyme components, Cas12a protein and its components, and ensure the stability and reliability of the detection components.

[0092] In some embodiments of the present invention, the cryoprotectant is any one of the following:

[0093] (1)Trehalose;

[0094] (2)A mixture of trehalose and sucrose;

[0095] (3)A mixture of sucrose and mannitol;

[0096] (4)A mixture of trehalose and mannitol;

[0097] (5)A mixture of sucrose, mannitol and trehalose.

[0098] In some embodiments of the present invention, the design principle of the crRNA sequence is that the 5'-end of the crRNA targeting sequence should have 5'-TTN-3', or TCTV, TTCV, CTTV sequences, and the number of complementary base pairs between the crRNA and the targeting sequence is not less than 18 bp. The sequence of the crRNA is a crRNA sequence that meets the crRNA design principle of the present invention for any one of the nucleic acid detection targets.

[0099] In some embodiments of the present invention, the Cas12a protein is a Cas12a protein with endonuclease activity and accessory nucleic acid cleavage activity. In some embodiments of the present invention, the Cas12a protein is selected from LbCas12a, FnCas12a, AsCas12a, ScCas12a.

[0100] In some embodiments of the present invention, the ssDNA-FQ fluorescent reporter probe is modified with a fluorescent reporter group and a fluorescent quenching group. The fluorescent groups include but are not limited to FAM, VIC, HEX, TET, JOE, Cy5, Cy3, TAMRA. The fluorescent quenching groups include but are not limited to BHQ1, BHQ2, BHQ3.

[0101] Based on the trans-cleavage activity of CRISPR / Cas12a, the ssDNA-FQ is non-specifically cleaved to design the ssDNA-FQ fluorescent reporter probe required for the fluorescent detection system. Since the LbCas12a protein has better cleavage activity on adenine A and thymine T, the basic sequence of the ssDNA-FQ includes but is not limited to TTATT, with a fluorescent reporter group FAM group added at the 5'-end and a fluorescent quenching group BHQ1 group added at the 3'-end. Preferably, the structural formula of the sequence of the ssDNA-FQ fluorescent reporter probe is 5'-FAM-TTATT-BHQ1-3'.

[0102] In some embodiments of the present invention, the final volume of the RPA / RT-RPA premix is 50 μL, which includes 29.4 μL of buffer and enzyme powder, forward primer, reverse primer, mannitol, and sucrose. The final volume is made up to 50 μL with ultrapure water. Among them, the concentration of the forward primer is 0.1 - 1 μM, the concentration of the reverse primer is 0.1 - 1 μM, the concentration of mannitol is 0.001 - 2.0 g / mL, and the concentration of sucrose is 0.001 - 2.0 g / mL. Among them, the buffer includes 0.5 - 100 mM Tris acetate, 10 - 200 mM potassium acetate, 10 - 200 mM magnesium acetate, 1 - 10 mM DTT, 10 - 300 uM dNTPs, 1 - 5 mM ATP, 5% PEG, and 2 - 200 mM creatine.

[0103] The enzyme powder contains DNA polymerase, DNA recombinase, single-stranded DNA binding protein GP32, recombinant regulatory protein, and kinase.

[0104] In one embodiment of the present invention, the components in the RPA / RT-RPA premix are as follows: 29.4 μL of buffer, forward primer with a final concentration of 0.4 μM, reverse primer with a final concentration of 0.4 μM, 0.01 g / mL of sucrose, 0.03 g / mL of mannitol, and the final volume is made up to 50 μL with ultrapure water.

[0105] In some embodiments of the present invention, the CRISPR / Cas12a premix includes components with the following concentrations: 50 - 800 nM Cas12a protein, 0.2 - 10 μM crRNA, 1× NEBuffer 2.1 buffer, 1 - 20 mM DTT, 0.1 - 10 μM ssDNA-FQ fluorescent reporter probe, 0.001 - 2.0 g / mL mannitol, 0.001 - 2.0 g / mL sucrose, and the final volume is made up to 25 μL with ultrapure water.

[0106] In one embodiment of the present invention, the components in the CRISPR / Cas12a premix are as follows: 500 nM Cas12a protein, 1 μM crRNA, 1× NEBuffer 2.1 buffer, 10 mM DTT, 1 μM ssDNA-FQ fluorescent reporter probe, 0.01 g / mL of sucrose, 0.03 g / mL of mannitol, and the final volume is made up to 25 μL with ultrapure water.

[0107] In the second aspect of the present invention, a method for preparing the above nucleic acid detection paper chip based on the RPA / RT-RPA and CRISPR / Cas12a systems is provided, including the following steps:

[0108] (1) Adhere two hydrophilic layers to the surface of the hydrophobic backing layer to form a first hydrophilic reaction zone and a second hydrophilic reaction zone respectively to form a carrier.

[0109] (2) Drop the RPA / RT-RPA premixed solution onto the first hydrophilic reaction zone, and drop the CRISPR / Cas12a premixed solution onto the second hydrophilic reaction zone. Then, freeze-dry the carrier, and store the freeze-dried carrier at room temperature after drying.

[0110] In one embodiment of the present invention, the hydrophobic backing layer is a rectangular platform with a length of 2 cm and a width of 1 cm. The first hydrophilic reaction zone and the second hydrophilic reaction zone are divided into independent reaction regions by means of printing patterns, drawing hydrophobic barriers, etc.

[0111] In one embodiment of the present invention, the dropping amounts of both the RPA / RT-RPA premixed solution and the CRISPR / Cas12a premixed solution are 3 μL.

[0112] In some embodiments of the present invention, the freeze-drying conditions are as follows: freeze the carrier dropped with the RPA / RT-RPA premixed solution and the CRISPR / Cas12a premixed solution at -80 °C for 20 min, and then vacuum freeze-dry at -90 °C for 5 h by a freeze-dryer.

[0113] In the third aspect of the present invention, a method for nucleic acid detection using the above-mentioned nucleic acid detection paper chip based on the RPA / RT-RPA and CRISPR / Cas12a systems is provided, including the following steps:

[0114] S1: Introduce the sample to be tested into the first hydrophilic reaction zone of the paper chip and then perform RPA / RT-RPA isothermal amplification.

[0115] S2: Fold the paper chip in half so that the RPA / RT-RPA isothermal amplification product in the first hydrophilic reaction zone contacts the second hydrophilic reaction zone to perform the CRISPR / Cas12a reaction; the simple folding operation enables the amplification product to be directly transferred to the CRISPR reaction zone, avoiding the risk of cross-contamination.

[0116] S3: Read the detection result. If a fluorescence signal is detected, the sample to be tested contains the target gene; otherwise, the sample to be tested does not contain the target gene.

[0117] In some embodiments of the present invention, the sample to be tested is a mixed solution of a nucleic acid template and magnesium acetate.

[0118] In one embodiment of the present invention, the sample to be tested contains a mixed solution of 1 μL of nucleic acid template, 0.15 μL of magnesium acetate solution with a concentration of 200 mM, and 0.85 μL of nuclease-free water.

[0119] In some embodiments of the present invention, the conditions for the RPA / RT-RPA isothermal amplification in step S1 are: an isothermal amplification reaction is carried out at 37-42 °C for 5-30 min.

[0120] In some embodiments of the present invention, the conditions for the CRISPR / Cas12a reaction in step S2 are: incubation at 37 °C for 5-60 min.

[0121] Specifically, as a specific embodiment of the present invention, a specific method for detecting nucleic acid is as follows:

[0122] (1) RPA / RT-RPA isothermal amplification:

[0123] For the paper-based RPA / RT-RPA reaction, a sample mixture containing 1 μL of nucleic acid template, 0.15 μL of magnesium acetate solution (concentration 200 mM), and 0.85 μL of nuclease-free water is introduced into the first hydrophilic reaction zone dried on the paper chip;

[0124] Subsequently, the paper chip is placed in a petri dish with a diameter of 35 mm. Create a humidity chamber for the reaction system, moisten a circular paper with a diameter of 35 mm with water, and place it at the bottom of the petri dish.

[0125] The RPA / RT-RPA reverse transcription isothermal amplification program is: isothermal at 37-45 °C, reaction for 5-30 min;

[0126] For the negative control, replace the target with ultrapure water in the reaction mixture;

[0127] (2) CRISPR / Cas12a detection:

[0128] After the RPA / RT-RPA reaction, the paper chip is folded along its midline so that the amplified target is in direct contact with the second hydrophilic reaction zone, thereby initiating the CRISPR / Cas12a reaction.

[0129] Reaction conditions: isothermal at 37 °C, incubation for 5-60 min;

[0130] (3) Signal reading and analysis: After the reaction is completed, observe the fluorescence signal on the paper chip and perform imaging using a MiniChemi chemiluminescence fluorescence imaging analysis system. Use fluorescence or color or grayscale analysis software to obtain and analyze the fluorescence intensity data. By analyzing the fluorescence intensity of the control group and the experimental group, perform a statistical significance difference analysis using the T-test. P < 0.05 means the research results have statistical significance (*), P < 0.01 is a significant statistical difference (**), and P < 0.001 is an extremely significant statistical difference (***).

[0131] In the fourth aspect of the present invention, a nucleic acid detection device based on the RPA / RT-RPA and CRISPR / Cas12a systems is provided, including the above-mentioned paper chip, a camera, a darkroom, a light source, and a green band-pass filter; a sample observation window is provided at the top of the darkroom, the camera is installed above the sample observation window, the paper chip is arranged at the bottom of the darkroom and below the sample observation window, the green band-pass filter is installed between the sample observation window and the paper chip, preferably close to the sample observation window, and a constant temperature heating pad is arranged at the bottom of the paper chip.

[0132] In some embodiments of the present invention, the darkroom is made of light-shielding material and is open at one end for the constant temperature heating pad and the paper chip to be placed in.

[0133] In some embodiments of the present invention, the constant temperature heating pad is a 37°C constant temperature heating pad for heating the paper chip to provide the temperature required for the reaction.

[0134] In some embodiments of the present invention, the wavelength of the light source is 450 nm.

[0135] In some embodiments of the present invention, the green band-pass filter is a 525 nm band-pass filter for selectively filtering light to reduce the interference of other colors.

[0136] In some embodiments of the present invention, the nucleic acid detection device further includes a power source for supplying power to the light source, such as a mobile power source, an external AC power source, etc.

[0137] In some embodiments of the present invention, the camera can be replaced by a smartphone with a camera on the market. After the reaction is completed, the LED light source irradiates the reacted paper chip to excite the fluorescence signal. Subsequently, the smartphone is used to capture the fluorescence image after passing through the green band-pass filter. The obtained image data will be quantitatively analyzed by the ImageJ software in the mobile phone to achieve an accurate assessment of the sample.

[0138] The present invention will be described in detail below with reference to embodiments.

[0139] Example 1: Feasibility study on detecting nucleic acid with a paper chip based on RT-RPA and CRISPR / Cas12a

[0140] The present invention obtains the genomic sequence of the nucleic acid through NCBI, and uses bioinformatics methods to compare and analyze a large number of sequences to determine the conserved sequence specific to the nucleic acid, that is, the nucleic acid detection target. Taking norovirus as an example:

[0141] The target gene of norovirus is (5'-3'): TTTGGAAAACTGGAGCAGAGTTCAATACTTAGGCAAATGTACTGGACTAGGGGTTCCAACCATGAAGACCCATCTGAAACAATGATTCCACACTCCCAAAGACCCATACAACTGATGTCCCTACTGGGGGAGGCCGCACTCCACGGCCCAGCATTCTACAGCAAAATCAGCAAGTTAGTCATTGCAGAGCTAAAAGAAGGTGGCATGGATTTTTACGTGCCCAGACAAGAGCCAATGTTCAGATGGATGAGATTCTCAGATCTGAGCACGTGGGAGGGCGATCGCAATCTGGCTCCCAGTTTTGTGAATGAAGATGGCGTCGAGTGACGCCAACCCATCTGATGGGTCCACAGCCAACCTCGTCCCAGAGGTCAACAATGAGGTTATGGCTTTGGAGCCCGTTGTTGGTGCCGCCATTGCGGCACCTGTAGCGGGCCAACAAAATGTAATTGACCCCTGGATTAGAAACAATTTTGTACAAGCCCCTGGTGGAGAGTTCACAGTATCCCCTAGAAACGCTCCAGGTGAAATACTGTGGAGCGCGCCCTTAGGTCCTGATTTGAATCCCTACC (SEQ ID NO:1).

[0142] According to the RPA primer design principle, specific primers were designed using Primer Premier 5.0 software according to the instructions of Twist DX Company. The primer information of norovirus is as follows:

[0143] Forward primer: ATGTTCAGATGGATGAGATT (SEQ ID NO:2);

[0144] Reverse primer: TCGACGCCATCTTCATTCAC (SEQ ID NO:3).

[0145] Detection mechanism: On the paper chip, the RT-RPA isothermal amplification primers reverse-transcribe and amplify the viral RNA in the sample to be tested, obtaining the amplification reaction product. Subsequently, the paper substrate is folded, and CRISPR / Cas12a, guided by crRNA, recognizes the detection target sequence on the amplification reaction product, thereby activating the collateral cleavage activity of Cas12a, which cleaves the ssDNA fluorescent probe in the detection system. After the probe molecules are cleaved, a large amount of detectable fluorescent signals are generated; under green fluorescence irradiation, a visual fluorescence change is shown.

[0146] The following is the method for detecting nucleic acids by RT-RPA and CRISPR / Cas12a methods on the paper chip:

[0147] 1. Reagents

[0148] (1) RT-RPA isothermal amplification primers;

[0149] (2) Cas12 protein: LbCas12a;

[0150] (3) crRNA;

[0151] (4) The isothermal amplification reagents are: enzyme lyophilized powder, rehydration buffer, activator (magnesium acetate);

[0152] (5) NE Buffer 2.1 buffer: 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 10 mM DTT, pH 7.9;

[0153] (6) Single-stranded DNA reporter molecule modified with a fluorescent reporter group and a fluorescent quenching group.

[0154] 2. Detection process

[0155] (1) Freeze-drying process:

[0156] The pre-preparation method of the RT - RPA premix is as follows: It contains enzyme lyophilized powder (including DNA polymerase, DNA recombinase, single-stranded DNA binding protein GP32, recombinant regulatory protein, kinase), upstream primer with a final concentration of 0.4 μM, downstream primer with a final concentration of 0.4 μM, buffer (8 mM Tris acetate, 50 mM potassium acetate, 40 mM magnesium acetate, 1 mM DTT, 200 μM dNTPs, 1 mM ATP, 5% PEG, 30 mM creatine), as well as sucrose with a final concentration of 0.01 g / mL and mannitol with a final concentration of 0.03 g / mL. The remaining part is made up to 50 μL with nuclease-free water. Magnesium acetate is not added to the mixture.

[0157] The CRISPR / Cas12a premix is pre-formulated with the following components at a final concentration of 0.5 μM Cas12a, 1 μM crRNA, 1×NE Buffer 2.1, 10 mM DTT, 1 μM ssDNA-FQ fluorescent reporter probe, and sucrose at a final concentration of 0.01 g / mL, mannitol at a final concentration of 0.03 g / mL, and ultrapure water. 3 μL of the above RT-RPA premix and CRISPR / Cas12a premix were respectively added dropwise to different areas reserved on the filter paper, and the filter paper was freeze-dried using a bench-top freeze dryer. The freeze-dried filter paper was stored at room temperature for further experiments.

[0158] (2)RT-RPA isothermal amplification: For the paper chip RT-RPA reaction, a sample mixture containing 1 μL of nucleic acid template, 0.15 μL of magnesium acetate solution (concentration 200 mM), and 0.85 μL of nuclease-free water was introduced into the freeze-dried RT-RPA reagent area (the first hydrophilic reaction area) on the paper substrate. The RT-RPA isothermal amplification program was: isothermal at 37 °C for 15 min. The reaction was carried out in a sealed petri dish to prevent aerosol contamination. The experimental group with water as the template was used as the negative control group;

[0159] (3)CRISPR / Cas12a detection: The paper chip was folded so that the amplification product on the paper chip contacted the Cas12a component in the second hydrophilic reaction area of the paper chip, and then incubated at 37 °C for 5 - 60 min.

[0160] (4)Signal reading and analysis: After the reaction was completed, the fluorescence signal on the paper was observed and analyzed using a MiniChemi chemiluminescence fluorescence imaging analysis system. ImageJ software was used to analyze the fluorescence intensity. By analyzing the fluorescence intensities of the control group and the experimental group, a t-test was used for statistical significance analysis. P < 0.05 means that the research results are statistically significant, P < 0.01 is a significant statistical difference, that is, positive, and P < 0.001 is an extremely significant statistical difference.

[0161] (5)Detection results:

[0162] As Figure 1 shown, after mixing the relevant components of RT-RPA and CRISPR / Cas12a using a pipette, they were respectively added dropwise to the central positions of two pieces of paper-based materials (i.e., the first hydrophilic reaction area and the second hydrophilic reaction area) to form droplet-shaped circular areas. The freeze dryer freeze-dried the liquid samples on the paper chip material. The sample was dehydrated by reducing the temperature and pressure, and the dried sample and the paper chip structure were retained. After freeze-drying the paper chip, the sample was fixed on the paper chip, retaining its morphology and function for subsequent use.

[0163] Figure 2 includes Figure 2 A, Figure 2 B, and Figure 2 C, mainly involving the screening and optimization of the fluorescence background, reaction optimization, and lyoprotectants of paper chips.

[0164] Among them, Figure 2 A shows the background fluorescence intensities (unit: a.u.) when different materials (including A4 wood pulp paper, cellulose paper, ordinary filter paper, Whatman No.1 qualitative filter paper, and glass fiber filter papers RB65, BT03, and BT50) are used as carriers. As can be seen from the figure, Whatman No.1 qualitative filter paper has the lowest fluorescence intensity and shows the best performance (the least background interference). In contrast, A4 wood pulp paper shows relatively high background fluorescence.

[0165] Figure 2 B compares the fluorescence signal intensities of different papers during the reaction. The evaluation criteria include the fluorescence signal intensities of positive and negative samples and the signal-to-noise ratio (SNR), which is defined as the ratio of the fluorescence signal intensity of the positive sample to that of the negative sample. The performances of the positive control (black column) and negative samples (gray column) were measured respectively. Whatman No.1 qualitative filter paper is not only superior in terms of background fluorescence, but also the fluorescence signal intensity of its positive samples is significantly higher than that of other materials. At the same time, the fluorescence signal difference multiple between positive and negative is also high, indicating its advantage in sensitivity.

[0166] Figure 2 C compares the effects of different types of lyoprotectants on the fluorescence signal. The purpose is to evaluate the effects of different lyoprotectants, including sucrose, mannitol, trehalose, sucrose + mannitol, mannitol + trehalose, trehalose + sucrose, and sucrose + mannitol + trehalose, used alone and in different combinations on the lyophilization system.

[0167] For the CRISPR / Cas12a reaction system, the reaction mixture contains Cas12a protein (500 nM), crRNA (1 μM), 1× NEBuffer 2.1 buffer solution, DTT (10 mM), ssDNA-FQ fluorescent reporter probe (1 μM), and different cryoprotectants. Finally, nuclease-free water is added to make up to 25 μL. At this time, the final concentrations of sucrose, mannitol, and trehalose in the 25-μL system are 0.01 g / mL, 0.03 g / mL, and 0.14 g / mL, respectively. The samples after freeze-drying treatment present a dry powder state. When the reaction needs to be activated, 23 μL of nuclease-free water is added to reconstitute the freeze-dried powder, and then 2 μL of nucleic acid template is added to initiate the CRISPR / Cas12a reaction. By comparing the effects of different cryoprotectants on the Cas12a cleavage efficiency and the final fluorescence signal intensity, the formulation with high cleavage efficiency and strong fluorescence signal is selected as the optimal cryoprotectant formulation.

[0168] Figure 2 The picture in the upper right corner of C shows the appearance of the samples under different cryoprotectant conditions. The curve represents the trend of fluorescence intensity changing with time. Trehalose, trehalose + sucrose, sucrose + mannitol, trehalose + mannitol, and sucrose + mannitol + trehalose show better fluorescence signal intensities. Single sucrose and single mannitol perform mediocrely: for example, the effects of using only sucrose or mannitol are poor. The fluorescence signal is the lowest without cryoprotectant, indicating the importance of cryoprotectants in improving the stability of samples.

[0169] Example 2: Sensitivity study of nucleic acid detection by paper chip using RT-RPA and CRISPR / Cas12a

[0170] To determine the sensitivity of the nucleic acid detection method based on RT-RPA and CRISPR / Cas12a of the present invention, nucleic acid samples with known concentrations are serially diluted. The samples are diluted to 10 0 copies / μL, 10 1 copies / μL, 10 2 copies / μL, 10 3 copies / μL, 10 4 copies / μL, 10 5 copies / μL, 10 6 copies / μL, 10 7 copies / μL, 10 8 copies / μL and used as templates. At the same time, water is used as a template as a negative control, and amplification and detection are carried out according to the detection reagents and detection methods in Example 1.

[0171] The results are as Figure 3As shown in the figure, significance analysis was performed by the T-test. When the concentration ≥ 1 copy / μL, P < 0.001, and there were significant differences between the experimental group and the control group. This indicates that when the method of the present invention is used for detection, the detection sensitivity of nucleic acid is 1 copy / μL.

[0172] Example 3: Specificity study of paper chip for detecting viral nucleic acid by RT-RPA and CRISPR / Cas12a

[0173] Taking norovirus as an example, according to the detection reagents and detection methods in Example 1, norovirus, Salmonella, group B streptococcus (GBS), Staphylococcus aureus (S. aureus), Candida tropicalis (C. tropicalis), Escherichia coli (E. coli), SARS-CoV-2, rotavirus (RV), human papillomavirus (HPV), and human genomic DNA, etc. were detected respectively, and water was used as the negative control group to analyze the specificity of the detection method provided by the present invention.

[0174] The specific method is to use nucleic acid and the genomic DNA of the above other microorganisms or human cells as templates respectively, perform amplification reaction and CRISPR / Cas12a detection according to the detection system and detection procedure in Example 1, and read the fluorescence signal by a multi-color fluorescence instrument.

[0175] The results are as Figure 4 shown. Compared with the negative control group, only norovirus had significant fluorescence signals, while Salmonella, group B streptococcus (GBS), Staphylococcus aureus ( S. aureus ), Candida tropicalis ( C. tropicalis ), Escherichia coli ( E. coli ), SARS-CoV-2, rotavirus (RV), human papillomavirus (HPV), and human genomic DNA, etc. had no significant signal enhancement (no statistical difference), indicating that the nucleic acid detection method established by the present invention has high specificity.

[0176] Example 4: Specificity study of paper chip for detecting bacterial nucleic acid by RT-RPA and CRISPR / Cas12a

[0177] Taking Salmonella as an example, according to the detection reagents and detection methods in Example 1, Salmonella, norovirus, SARS-CoV-2, rotavirus (RV), group B streptococcus (GBS), Staphylococcus aureus ( S. aureus ), Candida tropicalis ( C. tropicalis ), Escherichia coli ( E. coli ), etc. were detected respectively, and water was used as the negative control group to analyze the specificity of the detection method provided by the present invention.

[0178] The target gene of Salmonella is (5'-3'): GTGGTAAATTATTCCGATGAAGTCGTGTCCTTTGGTATTAATCCAACAATCCATCAGCAAGGTAGCAGTCAGTATTTCTGGGTAACGCATGAAGAGGGGGAGAAACTCCGGGAGCTTGGCTATGTGTTGCGGAACGCGCTTGATGAGCTTTACCACTGTCTGGCGGTGACGCTGGCGCGCAACGTCAATGAATATTTCGGTATTCAGGAAACAAAACATATGCTGGACCAACTGGAAGCGAAATTTCCTGATTTACTTAAAGAAGTGCTCAGACATGCCACGGTACAACGTATATCTGAAGTTTTGCAGCGTTTGTTAAGCGAACGTGTTTCCGTGCGTAATATGAAGTTAATTATGGAAGCGCTCGCATTGTGGGCGCCAAGAGAAAAAGATGTCATTAACCTTGTGGAGCATATTCGTGGAGCAATGGCGCGTTATATTTGTCATAAATTCGCCAATGGCGGCGAATTACGAGCAGTAATGGTATCTGCTGAAGTTGAGGATGTTATTCGCAAAGGGATCCGTCAGACCTCTGGCAGTACCTTCCTCAGCCTTGACCCGGAAGCCTCCGCTAATTTGATGGATCTCATTACACTTAAGTTGGATGATTTATTGATTGCACATAAAGATCTTGTCCTCCTTACGTCTGT (SEQ ID NO:4).

[0179] According to the RPA primer design principle, specific primers were designed using Primer Premier 5.0 software according to the instructions of Twist DX Company. The primer information of Salmonella is as follows:

[0180] Forward primer: AACTGGAAGCGAAATTTCCTGATTTACT (SEQ ID NO:5);

[0181] Reverse primer: CGAATTTATGACAAATATAACGCGCCAT (SEQ ID NO:6).

[0182] The specific method is to use nucleic acid and the above-mentioned other microorganisms as templates respectively, and perform amplification reactions and CRISPR / Cas12a detection according to the detection system and detection procedure in Example 1, and read the fluorescence signals through a multi-color fluorescence analyzer.

[0183] The results are as Figure 5 shown. Compared with the negative control group, only Salmonella had significant fluorescence signals, while norovirus, SARS-CoV-2, rotavirus (RV), group B streptococcus (GBS), Staphylococcus aureus ( S. aureus ), Candida tropicalis ( C. tropicalis ), Escherichia coli ( E. coli ) etc. had no significant signal enhancement (no statistical difference), indicating that the nucleic acid detection method established by the present invention has specific recognition ability for Salmonella and is not interfered by other microorganisms or the human genome. Therefore, the detection system provided by the present invention is not only applicable to virus nucleic acid detection, but also can be used for the detection of other biological samples such as bacteria, and has broad application prospects.

[0184] Example 5: Detection results of nucleic acids in real oyster samples

[0185] (1) Sample treatment and RNA extraction:

[0186] Use sterile scissors, surgical forceps or other equivalent instruments to dissect the digestive gland in the shellfish soft tissue on a rubber pad and place it in a clean petri dish. Collect 1.0 g. After homogenizing the digestive gland with a sterile blade or equivalent homogenizer, transfer it to a centrifuge tube. Add 1.0 mL of proteinase K (0.1 mg / mL) solution and mix well. Use a thermostatic shaker or equivalent device at 37 °C and 320 times / min for 60 min. Place the test tube in a water bath or equivalent device at 60 °C for 15 min. Centrifuge at 3000 r / min for 5 min at room temperature, transfer the supernatant to a clean test tube, measure and record the mL number of the supernatant for subsequent RNA extraction.

[0187] Add the virus extraction solution into a centrifuge tube, add an equal volume of Trizol reagent to the virus extraction solution, mix well, shake vigorously, let it stand at room temperature for 5 min, add 0.2 times the volume of chloroform, vortex vigorously for 30 s (do not be too strong to avoid generating an emulsion layer, or you can also mix by inverting the tube by hand), centrifuge at 12000 r / min for 5 min, transfer the upper aqueous phase to a new centrifuge tube without sucking out the middle layer. Add an equal volume of isopropanol to the centrifuge tube, invert to mix well, let it stand at room temperature for 5 min, centrifuge at 12000 r / min for 5 min, discard the supernatant, invert the tube on the absorbent paper to blot dry the liquid (different samples must be blotted dry at different places on the absorbent paper). Add an equal volume of 75% ethanol, invert to wash the RNA precipitate 2 times. Centrifuge at 4 °C and 12000 r / min for 10 min, carefully discard the supernatant, invert the tube on the absorbent paper to blot dry the liquid (different samples must be blotted dry at different places on the absorbent paper). Or carefully pour out the supernatant and aspirate it dry with a micropipette. Use a new pipette tip for each sample, and do not let the tip touch the precipitate. Dry at room temperature for 3 min, do not dry too much to avoid insolubility of RNA. Add 16 μL of RNase-free ultrapure water, gently mix to dissolve the RNA on the tube wall, centrifuge at 2000 r / min for 5 s, and store on ice for later use

[0188] In this invention, the RT-RPA and CRISPR / Cas12a detection systems of Example 1 were used to detect 9 oyster digestive gland samples (using isothermal amplification primers and crRNA), and the CRISPR / Cas detection results were compared with the qPCR detection results (CT values).

[0189] The results are as Figure 6 shown. The detection accuracies of RT-RPA and CRISPR / Cas12a for positive and negative samples are both 100%, indicating that the RT-RPA and CRISPR / Cas12a detection systems of this invention have 100% sensitivity, accuracy and specificity for nucleic acid detection in real oyster samples.

[0190] Example 6: Schematic diagram of a portable detection device for nucleic acid detection by paper chip of RT-RPA and CRISPR / Cas12a and its sensitivity study

[0191] This invention developed a portable, smartphone-assisted fluorescence detection system that can efficiently and sensitively detect nucleic acids. This system combines paper chip RT-RPA amplification technology with CRISPR / Cas12a detection method and operates on a constant temperature heating pad at 37 °C. The constant temperature heating pad can be continuously powered by a small power bank to provide the temperature conditions required for the reaction. For fluorescence imaging analysis, this invention designed a nucleic acid detection device based on the RPA / RT-RPA and CRISPR / Cas12a systems, as Figure 7 shown.

[0192] The device includes a paper chip 1, a camera 2, a darkroom 3, a light source 4, and a band-pass filter 5. A sample observation window 6 is provided at the top of the darkroom 3. The camera 2 is installed above the sample observation window 6. The paper chip 1 is arranged at the bottom of the darkroom 3 and below the sample observation window 6. The band-pass filter 5 is installed between the sample observation window 6 and the paper chip 1, preferably close to the sample observation window 6. A 37°C constant temperature heating pad 7 is provided at the bottom of the paper chip 1.

[0193] The darkroom 3 is made of light-proof material and is open at one end for the constant temperature heating pad 7 and the paper chip 1 to be placed in. The constant temperature heating pad 7 is used to heat the paper chip 1 to provide the temperature required for the reaction. The light source 4 is an LED lamp with a wavelength of 450 nm, which is used to illuminate the detection area of the paper chip 1. The band-pass filter 5 is a green band-pass filter with a wavelength of 525 nm to reduce background noise and selectively filter light to reduce interference from other colors. The nucleic acid detection device also includes a power source 8 for supplying power to the light source, such as a mobile power source, an external AC power source, etc. The camera 2 can be replaced by a smartphone camera on the current market, and the smartphone is used to collect image information and analyze the detection results. The device is small and portable, equipped with an LED light source and an external power source, and can be photographed using a smartphone outside the experimental environment, greatly expanding its application range.

[0194] Use known concentrations of NoV RNA (10 0 、10 1 、10 2 、10 4 、10 6 copies / μL) to evaluate the detection sensitivity and analytical performance of the device. The results show that the device can detect NoV RNA well, and the LOD is 1 copy / µL. As Figure 8 shown, the effectiveness and practicability of the portable device are verified.

[0195] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A nucleic acid detection paper chip based on the RPA / RT-RPA and CRISPR / Cas12a systems, characterized in that: The paper chip includes a hydrophobic backing layer located at the lower layer and a hydrophilic reaction layer located at the upper layer. The hydrophilic reaction layer includes a first hydrophilic reaction region and a second hydrophilic reaction region. The first hydrophilic reaction region is coated with an RPA / RT-RPA premix, and the second hydrophilic reaction region is coated with a CRISPR / Cas12a premix; The RPA / RT-RPA premix includes, but is not limited to, enzyme powder, buffer solution, amplification primers for the target gene, cryoprotectant, and ultrapure water; the CRISPR / Cas12a premix includes, but is not limited to, Cas12a protein, crRNA, reaction buffer solution, reducing agent, ssDNA-FQ fluorescent reporter probe, cryoprotectant, and ultrapure water; The cryoprotectant is any one of the following: (1) Trehalose; (2) A mixture of trehalose and sucrose; (3) A mixture of sucrose and mannitol; (4) A mixture of trehalose and mannitol; (5) A mixture of sucrose, mannitol, and trehalose.

2. A method for preparing a nucleic acid detection paper chip based on the RPA / RT-RPA and CRISPR / Cas12a systems according to claim 1, characterized in that: It includes the following steps: (1) Adhere two hydrophilic layers to the surface of the hydrophobic backing layer to form a first hydrophilic reaction region and a second hydrophilic reaction region respectively to form a carrier; (2) Drop the RPA / RT-RPA premix on the first hydrophilic reaction region, and drop the CRISPR / Cas12a premix on the second hydrophilic reaction region, and then perform freeze-drying to obtain a nucleic acid detection paper chip, and store it at room temperature after drying.

3. The preparation method of the nucleic acid detection paper chip based on the RPA / RT-RPA and CRISPR / Cas12a systems according to claim 2, wherein: The conditions for freeze-drying are to freeze the carrier dropped with the RPA / RT-RPA premix and the CRISPR / Cas12a premix for 1 - 60 min at a temperature of -20°C to -90°C, and then perform vacuum freeze-drying at -60°C to -95°C by a freeze-dryer for 0.5 - 24 h.

4. A nucleic acid detection device based on the RPA / RT-RPA and CRISPR / Cas12a systems, characterized in that: It includes the paper chip, camera, darkroom, light source, and band-pass filter described in claim 1; a sample observation window is provided at the top of the darkroom, the camera is installed above the sample observation window, the paper chip is arranged at the bottom of the darkroom and below the sample observation window, the band-pass filter is installed between the sample observation window and the paper chip, and a constant-temperature heating pad is arranged at the bottom of the paper chip.

5. Use of the paper chip described in claim 1 in nucleic acid detection for non-disease diagnosis and treatment purposes.

Images