Method for simultaneously determining gene point mutation and DNA methylation based on CRISPR / Cas12a system

Abstract

The invention discloses a method for simultaneously determining gene point mutation and DNA methylation based on a CRISPR / Cas12a system. The method is characterized by comprising four steps of enzyme digestion, recognition, conversion and detection, wherein in the enzyme digestion step, methylation-sensitive restriction endonuclease (MSRE) is selected according to a target site sequence, unmethylated DNA is not hydrolyzed by MSRE and is kept complete, methylated DNA is hydrolyzed and broken under the action of MSRE, and the broken 3'end can be used as a primer P1 to trigger SDA1 amplification; wherein in the recognition step, a Flap primer and an Invading primer are designed according to a point mutation sequence, and an enzyme digestion product generated under the action of FEN1 enzyme can be used as a primer P2 to trigger SDA2 amplification; wherein in the conversion step, two different SDA amplification templates are designed according to sequences of P1 and P2, and amplification of SDA1 and SDA2 is triggered by enzyme digestion products P1 and P2 respectively, so that DNA methylation and gene mutation information are quickly converted into two different amplification products T1 and T2; wherein in the detection step, crRNA1 and crRNA2 are respectively designed as guide chains of a CRISPR / Cas12a reaction system according to sequences of T1 and T2, and synchronous detection of gene point mutation and DNA methylation is realized through'strong 'and'weak' of fluorescence signals. Based on a CRISPR / Cas12a system, the method solves the problem that a traditional detection method cannot realize simultaneous detection of gene point mutation and DNA methylation, can be used for scientific research analysis and clinical detection, and has a wide market prospect.

Description

Technical Field

[0001] The present invention relates to an analysis method, in particular to a method for simultaneous analysis of gene point mutation and DNA methylation. Background Art

[0002] Gene mutation refers to the phenomenon of changes in gene sequences. Genes are composed of deoxyribonucleic acid (DNA), which contains instructions for the genetic information of organisms. Under normal circumstances, the gene sequence is relatively stable, but under the influence of certain factors, the base pairs in the gene will be replaced and cause gene point mutations, that is, changes in a single base pair. Gene point mutations can affect gene transcription and protein synthesis, and are related to the occurrence of many complex diseases such as cancer. Therefore, the detection of gene point mutations is of great significance for the prediction and diagnosis of diseases.

[0003] DNA methylation is an epigenetic modification, which is catalyzed by DNA methyltransferase, using S-adenosylmethionine as a methyl donor to selectively add methyl groups to the cytosine of the two nucleotides CG of DNA to form 5-methylcytosine (5-mC). A large number of studies have shown that DNA methylation can cause changes in chromatin structure, DNA conformation, DNA stability, and the way DNA interacts with proteins, thereby controlling gene expression. Disorders in DNA methylation can lead to changes in genome structure and function, thereby affecting cell differentiation and gene expression, and thus participating in the occurrence and development of a variety of complex diseases such as atherosclerosis, cancer, obesity, type 2 diabetes, and neuropsychiatric diseases. Therefore, the detection of DNA methylation at specific sites is of great significance in the early diagnosis of diseases.

[0004] Currently, the commonly used methods for detecting point mutations and DNA methylation at specific sites are PCR and sequencing, but they all require the use of professional instruments and equipment, cumbersome pre-treatment and high operating requirements, so there is an urgent need to develop new detection methods. The CRISPR / Cas12a detection system has rapidly developed into a new generation of nucleic acid detection technology due to its advantages such as high sensitivity, high specificity, programmability, short time consumption and mild reaction.

[0005] The CRISPR / Cas12a detection system triggers the trans-cleavage activity of the Cas12a protein by guiding the recognition of target DNA through crRNA, hydrolyzing the short DNA single strands labeled with fluorescent groups and quenching groups at both ends to generate fluorescent signals to detect the target DNA. However, due to the non-specificity of the trans-cleavage activity of CRISPR / Cas12a, point mutations and DNA methylation cannot be detected simultaneously.

[0006] Typically, DNA methylation testing involves first treating DNA with bisulfite to convert non-methylated cytosine into uracil, while retaining methylated cytosine, and then obtaining the methylation level through PCR analysis or DNA sequencing. However, bisulfite treatment destroys the DNA sequence, and the information of gene point mutations is also tampered with, making it impossible to perform simultaneous analysis of gene point mutations and DNA methylation.

[0007] In order to solve the above problems, the present invention uses methylation-sensitive restriction endonuclease (MSRE) to distinguish methylated and non-methylated targets, applies FEN1 enzyme to identify gene point mutations, designs SDA amplification to convert the information of gene point mutations and DNA methylation, and uses CRISPR / Cas12a system for detection, thereby realizing the synchronous analysis of gene point mutations and DNA methylation. Summary of the invention

[0008] The purpose of the present invention is to construct a method for simultaneously determining gene point mutations and DNA methylation based on the CRISPR / Cas12a system.

[0009] The purpose of the present invention can be achieved by the following technical measures:

[0010] The present invention is a method for simultaneously determining gene point mutations and DNA methylation based on the CRISPR / Cas12a system, characterized in that: the method comprises four steps of enzyme cutting, recognition, conversion and detection; wherein the enzyme cutting step is to select a methylation-sensitive restriction endonuclease (MSRE) according to the target site sequence, the unmethylated DNA is not hydrolyzed by the MSRE and remains intact, while the methylated DNA is hydrolyzed and broken under the action of the MSRE, and the 3' end of the break can be used as a primer P1 to trigger SDA1 amplification; wherein the recognition step is to design a Flap primer and an Invading primer according to the point mutation sequence primer, the enzyme cleavage product produced under the action of FEN1 enzyme can be used as primer P2 to trigger SDA2 amplification; wherein the conversion step is to design two different SDA amplification templates according to the sequences of P1 and P2, and the enzyme cleavage products P1 and P2 trigger SDA1 and SDA2 amplification respectively, so as to realize the rapid conversion of DNA methylation and gene mutation information into two different amplification products T1 and T2; wherein the detection step is to design crRNA1 and crRNA2 as the guide chains of the CRISPR / Cas12a reaction system according to the sequences of T1 and T2 respectively, and the synchronous detection of gene point mutation and DNA methylation can be realized through the "strong" and "weak" fluorescence signals.

[0011] The present invention has the following beneficial effects:

[0012] The invention avoids the use of bisulfite, and can realize the reading of DNA methylation information through the hydrolysis of methylation-sensitive restriction endonuclease, and can avoid the change of DNA sequence to ensure the synchronous analysis of gene point mutation and DNA methylation.

[0013] The conversion step of the present invention is to design two different SDA amplification templates according to the sequences of P1 and P2. The enzyme cleavage products P1 and P2 trigger SDA amplification to efficiently obtain two different amplification products T1 and T2, which not only realizes the rapid conversion of gene point mutations and DNA methylation information, but also can reduce the sample amount requirement through amplification and realize trace detection.

[0014] In the CRISPR / Cas12a detection stage, the present invention designs crRNA1 and crRNA2 as guide chains of the CRISPR / Cas12a reaction system according to the sequence characteristics of SDA amplification products T1 and T2, respectively. By controlling the concentration of crRNA1 and crRNA2, not only the specificity of the detection is guaranteed, but also the rapid and synchronous detection of gene point mutations and DNA methylation can be achieved according to the "strength" and "weakness" of the fluorescence signal.

[0015] The present invention solves the universality, specificity and efficiency of mutation and methylation detection at different sites of the CRISPR / Cas12a reaction system through the design of Flap primer, SDA template and crRNA, and the concentration control of crRNA1 and crRNA2. The synchronous detection of gene point mutation and DNA methylation can be achieved based on the CRISPR / Cas12a system without the assistance of other technical means, which saves detection time and reduces detection cost. The present invention can be widely used in scientific research and clinical laboratories, and has broad market prospects. DETAILED DESCRIPTION

[0016] The present invention will be further described below in conjunction with embodiments, but the present invention is not limited thereto.

[0017] Example 1

[0018] This embodiment uses the CRISPR / Cas12a system method to simultaneously detect Kras gene mutation and Septin9 gene methylation, which consists of 6 steps: nucleic acid sequence design and synthesis, enzyme digestion, recognition, amplification, detection and result output. The specific steps are as follows:

[0019] (1) Design and synthesis of nucleic acid sequences: Based on the sequence characteristics of the Kras gene and Septin9 gene and the characteristics of the present invention, the following sequences need to be designed and synthesized:

[0020] Flap primer: 5'-GCTTTCGCTTCCAGCCGAAGTCCAACTACCACAAGTTTTATATTCA-3', Invading primer: 5'-ATCGTCAAGGCACTCTTGCCTACGCCACG-3', SDA template 1: 5'-ATGACCAAAACCACACAC CCTCCCCCGTAGCACGCGATCCCCTCAGCGGGGCCTCAGCTCGGCTGGAAGCGAAAGCAGGCG AA AAA-3', SDA template 2: 5'-GCAACCGCCGAACGCACGCGATCCCCTCAGCAACCCCTCAGCGCGACCCGC TGCCCACCAGCCATC AAAAA-3', the sequences of crRNA1 and crRNA2 are 5'-UAAUUUCUACUAAGUGUAG AU CCGCCGAACGCACGCGAUCC-3' and 5'-UAAUUUCUACUAAGUAGAUUCCCCGGUAGCACG CGAUCC-3';

[0021] (2) Enzyme digestion: Use a peripheral blood genomic DNA extraction kit to obtain a genomic DNA sample from 1 mL of venous blood, and use GlaI enzyme to hydrolyze the DNA sample to obtain product P1, which is used to trigger the SDA1 amplification reaction;

[0022] (3) Identification: After denaturation and annealing, the Flap primer and Invading primer from step 1 are digested with FEN1 to obtain the 5' end digestion product P2, which is used to trigger the SDA2 amplification reaction;

[0023] (4) Amplification: Enzyme cleavage products P1 and P2 trigger SDA amplification of SDA template 1 and SDA template 2, respectively. The information of Kras gene mutation and Septin9 gene methylation is quickly converted into two different amplification products T1 and T2.

[0024] (5) Detection: In the CRISPR / Cas12a reaction system, the amplified product, crRNA1, crRNA2, Cas12a protein, Reporter and buffer were added in sequence, the concentration of crRNA1 was 1 nmol / μL, the concentration of crRNA2 was 2 nmol / μL, the concentration of Cas12a protein was nmol / μL, the reaction was carried out at 37°C for 15 minutes, and the fluorescence signal was measured under the conditions of excitation wavelength of 493 nm and emission wavelength of 517 nm;

[0025] (6) Result output: When a low-intensity fluorescence signal is detected, it can be determined as a Kras gene mutation; when a medium-intensity fluorescence signal is detected, it can be determined as a Septin9 gene methylation; when a high-intensity fluorescence signal is detected, it can be determined as a Kras gene mutation and a Septin9 gene methylation.

Claims

1. A method for simultaneously determining gene point mutations and DNA methylation based on the CRISPR / Cas12a system, characterized in that: The method comprises four steps of enzyme digestion, recognition, conversion and detection; wherein the enzyme digestion step is to select a methylation-sensitive restriction endonuclease (MSRE) according to the target site sequence, the unmethylated DNA is not hydrolyzed by the MSRE and remains intact, while the methylated DNA is hydrolyzed and broken under the action of the MSRE, and the broken 3' end can be used as a primer P1 to trigger SDA1 amplification; wherein the recognition step is to design a Flap primer and an Invading primer according to the target site mutation sequence, and the enzyme digestion product produced under the action of the FEN1 enzyme can be used as a primer P2 to trigger SDA2 amplification; wherein the conversion step is to design two different SDA amplification templates according to the sequences of P1 and P2, P1 and P2 trigger SDA1 and SDA2 amplification respectively, and realize the rapid conversion of DNA methylation and gene mutation information into two different amplification products T1 and T2; wherein the detection step is to design crRNA1 and crRNA2 as the guide chains of the CRISPR / Cas12a reaction system according to the sequences of T1 and T2 respectively, and the simultaneous detection of gene point mutation and DNA methylation can be realized through the "strong" and "weak" fluorescence signals.

2. crRNA1 and crRNA2 according to claim 1, characterized in that: crRNA1 and crRNA2 are used to target SDA amplification products T1 and T2, respectively. The concentrations of crRNA1 and crRNA2 in the CRISPR / Cas12a reaction system are quite different and should be less than 1 / 2 of the Cas12a protein concentration.