Pituitary tumor subtype distinguishing method
By extracting RNA from pituitary tumor samples and performing reverse transcription and PCR amplification, combined with agarose gel electrophoresis experiment, screen bands of specific splicing events were obtained, which solved the problem of rapid accuracy of the distinction between pituitary tumor subtypes and achieved efficient diagnosis during surgery.
Patent Information
- Application Number
- CN202411650539.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-19
- Publication Date
- 2025-05-13
AI Technical Summary
The prior art is difficult to quickly and accurately distinguish the subtypes of pituitary tumors, resulting in a long waiting time for diagnostic results and a fuzzy and overlapping problem of subtype distinction.
By extracting the RNA from pituitary tumor samples, reverse transcription into cDNA, and using specific alternative splicing gene primers for PCR amplification and agarose gel electrophoresis experiments, screen bands of specific splicing events were obtained, and subtype distinction was performed.
It achieves rapid and accurate distinction of pituitary tumor subtypes, can be diagnosed intraoperatively, uses smaller tissue samples, reduces the waiting time for diagnostic results, and improves the accuracy of subtype distinction.
Smart Images
Figure CN119979706A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the medical field, and in particular relates to a method for differentiating pituitary tumor subtypes. Background Art
[0002] The pituitary gland is the most important endocrine gland in humans, regulating key physiological functions through hormone secretion. Pituitary neuroendocrine tumors (PitNETs, also known as pituitary adenomas) are one of the most common intracranial tumors, accounting for 10-20% of all intracranial tumors. The pathological classification of PitNETs is mainly based on immunohistochemical detection of the expression of pituitary hormones and three lineage-specific pituitary transcription factors, including PIT1 (POU1F1), TPIT (TBX19), and SF1 (NR5A1). Although tumors within the same lineage have the same expression of transcription factors, they show different differences in cellular functions and tumorigenesis. PIT1-lineage pituitary tumors often show excessive hormone secretion, including somatotrophoblastomas that secrete growth hormone (GH), prolactinoblastomas that secrete prolactin (PRL), thyrotrophoblastomas that secrete thyroid stimulating hormone (TSH), mixed somatotrophoblastomas that secrete GH and PRL (PG), and multihormonal PIT1-lineage tumors that secrete multiple hormones (PIT1M). The TPIT-lineage tumors contain only one type, the adrenocorticotrophic hormone (ACTH)-secreting adrenocorticotrophic tumor, while the SF1-lineage includes gonadotrophs (GO) that secrete follicle-stimulating hormone (FSH) and luteinizing hormone (LH). Null cell tumors (NULL) do not express PitNETs transcription factors and hormones, while multihormonal tumors express multiple hormones involving two or more lineages. However, even the same subtype can show diverse clinical manifestations. For example, functional adrenocorticotroph tumors show typical Cushing's symptoms due to excessive secretion of ACTH, while non-functional adrenocorticotroph tumors (with ACTH expression but no Cushing's symptoms) show more aggressive clinical behavior than other subtypes. The complex hormone secretion patterns and different clinical manifestations of these tumors have put forward higher requirements and challenges for more accurate subtype classification. However, to date, the pathogenesis of most subtypes remains unclear and lacks effective genetic markers.
[0003] At present, the differentiation of clinical subtypes depends on the need for paraffin embedding of tissues, immunohistochemistry and other steps. Most of the pre-operative test results are used to make a preliminary judgment on the tumor subtype. Of course, the results of pathological analysis can make an accurate distinction between tumor subtypes, but there is a disadvantage of a long waiting time for the results.
[0004] At the same time, mixed pituitary tumors may secrete multiple hormones and show cross-characteristics of different subtypes, which makes the actual classification vague and overlapping, increasing the difficulty of diagnosis. In addition, some non-functional adenomas, such as non-functional ACTH, cannot be distinguished from functional and non-functional adenomas based on pathological results because immunohistochemical hormone staining is positive, making it difficult to distinguish subtypes. Summary of the invention
[0005] In order to solve the above-mentioned technical problems and realize rapid and accurate differentiation of pituitary tumor subtypes, the present invention provides a method for differentiating pituitary tumor subtypes, which provides valuable clues for the diagnosis and treatment of the disease.
[0006] The technical solutions adopted are as follows:
[0007] A method for distinguishing pituitary tumor subtypes comprises obtaining pituitary tumor subtype samples, extracting RNA from tissues and reversely transcribing it into cDNA; obtaining standard screen bands of specific splicing events of specific genes in corresponding pituitary tumor subtypes by PCR amplification using specific variable splicing gene primers and combining agarose gel electrophoresis experiments; performing PCR amplification and agarose gel electrophoresis experiments on pituitary tumor samples to be tested using specific genes to obtain experimental screen bands of pituitary tumor samples to be tested; comparing the experimental screen bands with the standard screen bands presented by the corresponding pituitary tumor subtypes to distinguish the subtypes of the pituitary tumor samples to be tested.
[0008] The preset alternative splicing gene primers for establishing standard screen bands include:
[0009]
[0010]
[0011] Further preferably, the screen strips presented by the specific splicing events of specific genes NCAM1, DENND1A, FBXO25, DYNC1I2, MAP3K7, MPPE1, PAPOLA, PTBP2, SCYL2, SIDT2, and SNAP23 in the GH subtype of pituitary tumors are used to distinguish GH subtypes. The alternative splicing positions corresponding to the alternative splicing events of each gene are shown in the following table:
[0012]
[0013]
[0014] Further preferably, the PRL subtypes are distinguished by using the screen bands presented by the specific splicing events presented by specific genes EPB4L1, ITGB3BP, DCTN2, MFF, PI4KB, and SYNE2 in the pituitary tumor PRL subtypes, and the alternative splicing positions corresponding to the alternative splicing events of each gene are as follows:
[0015]
[0016] Furthermore, the screen bands presented by the specific splicing events of specific genes AKAP8L, NFE2L1, GNB1, KHDRBS1, and MDH1 in pituitary tumor TSH subtypes were used to distinguish TSH subtypes. The alternative splicing positions corresponding to the alternative splicing events of each gene are shown in the following table:
[0017]
[0018]
[0019] Furthermore, the screen strips presented by the specific splicing events of specific genes APP, MCF2L, AP1G2, ARHGAP17, ASPH, CAMK2G, PRKAG1, and PTPRS in pituitary tumor GO subtypes were used to distinguish GO subtypes. The alternative splicing positions corresponding to the alternative splicing events of each gene are shown in the following table:
[0020]
[0021]
[0022] Furthermore, the functional ACTH subtypes were distinguished by using the screen bands presented by the specific splicing events of the specific genes ENAH, ARFGAP2, and NACA in the functional ACTH subtypes in pituitary tumors. The alternative splicing positions corresponding to the alternative splicing events of each gene are shown in the following table:
[0023]
[0024] Furthermore, the non-functional ACTH subtypes were distinguished by using the screen bands presented by the specific splicing events of specific genes VTI1A, ARFGAP1, LSR, ARAP1, CLASP2, CLIP1, GIT2, LETMD1, NCOR2, PISD, PRPF39, RAD23A, RELCH, RPS24, and SOS1 in pituitary tumors. The alternative splicing positions corresponding to the alternative splicing events of each gene are shown in the following table:
[0025]
[0026]
[0027] The technical solution of the present invention has the following advantages:
[0028] A. The present invention extracts RNA from pituitary tumor sample tissue, then reverse transcribes it into cDNA, and then performs PCR amplification with specific variable splicing gene primers, and then performs agarose gel electrophoresis to obtain screen band test results. Compared with conventional pathological staining methods, the present invention can perform relatively effective subtype diagnosis during surgery, can use smaller tissues to achieve subtype diagnosis effects, and can use postoperative tissue specimens for diagnosis and identification more quickly; of course, during pathological diagnosis, if some antibodies fail or have poor sensitivity, pathological diagnosis can also be supplemented to diagnose some pituitary tumor subtypes that cannot be determined for the time being.
[0029] B. The present invention combines the expression characteristics of subtype-specific splicing events to present patterns on screen strips to identify various pituitary tumor subtypes, and then quickly completes the accurate classification of pituitary tumor subtypes, thereby solving the technical problem that the various subtypes generated by pituitary tumor heterogeneity cannot be accurately distinguished by existing classification methods based on transcription factor markers. Compared with overall gene expression, the method of the present invention accurately captures the unique characteristics of pituitary tumor subtypes and assists in accurate subtype classification of pituitary tumors. BRIEF DESCRIPTION OF THE DRAWINGS
[0030] In order to more clearly illustrate the specific embodiments of the present invention, the drawings required for use in the specific embodiments will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.
[0031] Figure 1 It is a flow chart of the method for pituitary tumor subtype classification provided by the present invention.
[0032] Figure 2 The present invention provides RT-PCR validation of subtype-specific splicing events in patients. DETAILED DESCRIPTION
[0033] The technical solution of the present invention will be described clearly and completely below in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.
[0034] likeFigure 1 As shown, the present invention provides a method for classifying pituitary tumor subtypes based on alternative splicing features, which specifically includes the following steps:
[0035]
S01
[0036] [S02] Through PCR amplification of specific variable splicing gene primers, combined with agarose gel electrophoresis experiments, a standard screen band of specific splicing events of a specific gene in the corresponding pituitary tumor subtype is obtained. When establishing the standard screen band, the preferred variable splicing gene primers designed by the present invention are shown in Table 1 below:
[0037] Table 1
[0038] RT-PCR primer Forward primer Reverse primer NCAM1-homo TCTTACCTGTGAAGCCTCCG CTCTCCGGCATCAGTGTACT NFE2L1-homo GGCTGGGCGTGAGGTTTT CAAATGGTGACTCTGTCCCG FBXO25-homo ACTTCAGAAACATTACCCAGCG GCACAGACAGCAGGATTCAC DENND1A-homo CCATGTCCAGGTTGCTGAAG AAAGAGCAACATCGCAGTGG ITGB3BP-homo CGAGCTGGTATTTACTGGGC TTTGGAGGGCAGTAGAGAGC EPB41L1-homo GGTCAGCGAGAACCATGATG CGGTGGATGAGTTTGCTGTT AKAP8L-homo TCCACCTGAGCCGTACAC GCTATGGCCAGGATAACACC MCF2L-homo GGAAGAAAGGAAAACAGACCCC CGGACGAGTTAATCTGCTCC APP-homo TTGGCTTTCTGGAAATGGGC TCCCGCTGGTACTTTGATGT ENAH-homo AGTCAAGTCCTTCCGTCTGG ACAAATACAATGAATGGCAGCA ARFGAP2-homo CCTCACCCAAAGCCTCACT CCGCTCAATCTCACTGAAGC ARFGAP1-homo CTGGAGCAGCTTCACCACT CGTTCTCGTTCAGGCTGTG LSR-homo AGGGGAACAATGAGGCCTAC TGGGAATCATAGCTGGTGGG VTI1A-homo CAGTGACGAAGTACGGAATGAGC CAGCCTCTAGTCTCCGAGATGAC DENND1A-homo CAAGATCCAGCGCTCAAGG CGAAGATCCTCCAGGCTCTTG
[0039]
S03
[0040]
S04
[0041] The method of the present invention establishes standard screen strips presented by a plurality of specific genes corresponding to different pituitary tumor subtypes, which serve as a reference for distinguishing pituitary tumor subtypes.
[0042] like Figure 2 As shown, in order to further verify the splicing events found in pituitary tumors, the present invention verified some key subtype-specific splicing events by RT-PCR and agarose gel electrophoresis experiments.
[0043] As a further preferred embodiment of the present invention, the screen bands presented by the specific splicing events of genes NCAM1, DENND1A, FBXO25, DYNC1I2, MAP3K7, MPPE1, PAPOLA, PTBP2, SCYL2, SIDT2, and SNAP23 in pituitary tumor GH subtypes can be used to distinguish GH subtypes. The present invention can use one of the genes listed above to distinguish GH subtypes, and of course, a combination of two or more genes listed above can also be used to accurately distinguish GH subtypes.
[0044] The present invention establishes the alternative splicing mode and position corresponding to the alternative splicing events of each gene, as shown in Table 2 below.
[0045] Table 2
[0046]
[0047] SE stands for exon skipping.
[0048] like Figure 2 NCAM1, DENND1A, and FBXO25 genes were used for further verification. Figure 2 From the first row, first column, second column and last row in the figure, it can be seen that the screen bands corresponding to GH subtypes are different from the screen bands of other genes in the corresponding subtypes, that is, the specific splicing expression is different, based on which the GH subtypes of pituitary tumors can be distinguished.
[0049] The present invention can further utilize the screen bands presented by the specific splicing events of genes EPB4L1, ITGB3BP, DCTN2, MFF, PI4KB, and SYNE2 in pituitary tumor PRL subtypes to distinguish PRL subtypes. The present invention can use one of the genes listed above to distinguish PRL subtypes, and of course, can also use a combination of two or more genes listed above to accurately distinguish PRL subtypes.
[0050] The present invention establishes the alternative splicing mode and position corresponding to the alternative splicing events of each gene, as shown in Table 3 below.
[0051] Table 3
[0052]
[0053] Figure 2 The genes EPB4L1 and ITGB3BP were used for further verification. Figure 2 From the third and fourth columns of the first row, it can be seen that the screen band corresponding to PRL is different from the screen bands of other genes in the corresponding subtypes, that is, the specific splicing expression is different. Based on this, the PRL subtypes of pituitary tumors can be distinguished.
[0054] The present invention can further utilize the screen bands presented by the specific splicing events of genes AKAP8L, NFE2L1, GNB1, KHDRBS1, and MDH1 in pituitary tumor TSH subtypes to distinguish TSH subtypes. The present invention can use one of the genes listed above to distinguish TSH subtypes, and of course, can also use a combination of two or more genes listed above to accurately distinguish TSH subtypes.
[0055] The present invention establishes the alternative splicing mode and position corresponding to the alternative splicing events of each gene, as shown in Table 4 below.
[0056] Table 4
[0057]
[0058] The RI in the above table stands for intron retention.
[0059] Figure 2 The genes AKAP8L and NFE2L1 were used for further verification. Figure 2 From the first and second columns of the second row, it can be seen that the screen bands corresponding to TSH are different from the screen bands of other genes in the corresponding subtypes, that is, the specific splicing expression is different. Based on this, the TSH subtypes of pituitary tumors can be distinguished.
[0060] The present invention can further utilize the screen strips presented by the specific splicing events of genes APP, MCF2L, AP1G2, ARHGAP17, ASPH, CAMK2G, PRKAG1, and PTPRS in pituitary tumor GO subtypes to distinguish GO subtypes. The present invention can use one of the genes listed above to distinguish GO subtypes, and of course, can also use a combination of two or more genes listed above to accurately distinguish GO subtypes.
[0061] The alternative splicing modes and positions corresponding to the alternative splicing events of each gene are shown in Table 5 below.
[0062] Table 5
[0063]
[0064] A5SS in the above table stands for 5' alternative splicing.
[0065] Figure 2 The gene APP and MCF2L were used for further verification. Figure 2 From the third and fourth columns of the second row, it can be seen that the screen bands corresponding to GO are different from the screen bands of other genes in the corresponding subtypes, that is, the specific splicing expression is different. Based on this, the GO subtypes of pituitary tumors can be distinguished.
[0066] The present invention can further combine the screen bands presented by the specific splicing events of genes ENAH, ARFGAP2, and NACA in the functional ACTH subtypes in pituitary tumors to distinguish the functional ACTH subtypes. The present invention can use one of the genes listed above to distinguish the functional ACTH subtypes, and of course, it can also use a combination of two or more genes listed above to accurately distinguish the functional ACTH subtypes. The alternative splicing mode and position corresponding to the alternative splicing events of each gene are specifically shown in Table 6 below.
[0067] Table 6
[0068]
[0069] like Figure 2 The genes ENAH and ARFGAP2 were used for further verification. Figure 2 From the first and second columns of the third row, it can be seen that the screen bands corresponding to the functional ACTH subtype are different from the screen bands of other genes in the corresponding subtypes, that is, the specific splicing expression is different. Based on this, the functional ACTH subtypes of pituitary tumors can be distinguished.
[0070] The present invention can further utilize the screen strips presented by the specific splicing events of genes VTI1A, ARFGAP1, LSR, ARAP1, CLASP2, CLIP1, GIT2, LETMD1, NCOR2, PISD, PRPF39, RAD23A, RELCH, RPS24, and SOS1 in the non-functional ACTH subtype in pituitary tumors to distinguish the non-functional ACTH subtype. The present invention can use one of the genes listed above to distinguish the functional ACTH subtype, and of course, the combination of two or more genes listed above can also be used to accurately distinguish the functional ACTH subtype. The alternative splicing mode and position corresponding to the alternative splicing event of each gene are specifically shown in Table 7 below.
[0071] Table 7
[0072]
[0073]
[0074] like Figure 2 The genes VTI1A, ARFGAP1 and LSR were used for further verification. Figure 2 From the third row, third column, fourth column and last row, it can be seen that the screen bands corresponding to the non-functional ACTH subtype are different from the screen bands of other genes in the corresponding subtypes, that is, the specific splicing expression is different, based on which the non-functional ACTH subtypes can be distinguished.
[0075] The method of the present invention was experimentally verified using patient samples. The type of pituitary tumor subtype can be accurately and quickly obtained by using the screen bands presented by different specific splicing events of the specific gene provided by the present invention in the pituitary tumor subtype.
[0076] The present invention extracts RNA from pituitary tumor sample tissue, then reverse transcribes it into cDNA, and then performs PCR amplification with preset specific variable splicing gene primers, and then performs agarose gel electrophoresis experiment to obtain screen band test results. Compared with conventional pathological staining methods, the present invention can perform relatively effective subtype diagnosis during surgery. By using the genes provided by the present invention and their variable splicing methods and positions, the subtype diagnosis effect can be achieved using smaller tissues, and the postoperative tissue specimens can be used for diagnosis and identification more quickly. If some antibodies fail or have poor sensitivity, pathological diagnosis can be supplemented to diagnose some pituitary tumor subtypes that cannot be determined temporarily.
[0077] Anything not described in the present invention is applicable to the prior art.
[0078] Obviously, the above embodiments are merely examples for the purpose of clear explanation, and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. However, the obvious changes or modifications derived therefrom are still within the scope of protection of the present invention.
Claims
1. A method for distinguishing pituitary tumor subtypes, characterized in that: Obtain pituitary tumor subtype samples, extract RNA from sample tissues and reverse transcribe into cDNA; obtain standard screen bands of specific splicing events of specific genes in corresponding pituitary tumor subtypes through PCR amplification with preset variable splicing gene primers combined with agarose gel electrophoresis experiments; use specific genes to perform PCR amplification and agarose gel electrophoresis experiments on the pituitary tumor samples to be tested to obtain experimental screen bands of the pituitary tumor samples to be tested; compare the experimental screen bands with the standard screen bands presented by the corresponding pituitary tumor subtypes to distinguish the subtypes of the pituitary tumor samples to be tested.
2. The method for distinguishing pituitary tumor subtypes according to claim 1, characterized in that: Establishment of primers for alternative splicing genes with preset standard screen bands include:
3. The method for distinguishing pituitary tumor subtypes according to claim 1, characterized in that: The specific splicing events of specific genes NCAM1, DENND1A, FBXO25, DYNC1I2, MAP3K7, MPPE1, PAPOLA, PTBP2, SCYL2, SIDT2, and SNAP23 in GH subtypes of pituitary tumors are used to distinguish GH subtypes. The alternative splicing positions corresponding to the alternative splicing events of each gene are shown in the following table:
4. The method for distinguishing pituitary tumor subtypes according to claim 1, characterized in that: The PRL subtypes were distinguished by using the screen bands presented by the specific splicing events of specific genes EPB4L1, ITGB3BP, DCTN2, MFF, PI4KB, and SYNE2 in pituitary tumor PRL subtypes. The alternative splicing positions corresponding to the alternative splicing events of each gene are as follows:
5. The method for distinguishing pituitary tumor subtypes according to claim 1, characterized in that: The screen bands presented by the specific splicing events of specific genes AKAP8L, NFE2L1, GNB1, KHDRBS1, and MDH1 in pituitary tumor TSH subtypes are used to distinguish TSH subtypes. The alternative splicing positions corresponding to the alternative splicing events of each gene are shown in the following table:
6. The method for distinguishing pituitary tumor subtypes according to claim 1, characterized in that: The screen strips presented by the specific splicing events of specific genes APP, MCF2L, AP1G2, ARHGAP17, ASPH, CAMK2G, PRKAG1, and PTPRS in pituitary tumor GO subtypes are used to distinguish GO subtypes. The alternative splicing positions corresponding to the alternative splicing events of each gene are shown in the following table:
7. The method for distinguishing pituitary tumor subtypes according to claim 1, characterized in that: The functional ACTH subtypes in pituitary tumors are distinguished by using the screen bands presented by the specific splicing events of specific genes ENAH, ARFGAP2, and NACA in the functional ACTH subtypes. The alternative splicing positions corresponding to the alternative splicing events of each gene are shown in the following table:
8. The method for distinguishing pituitary tumor subtypes according to claim 1, characterized in that: The non-functional ACTH subtypes in pituitary tumors were distinguished by using the screen bands presented by the specific splicing events of specific genes VTI1A, ARFGAP1, LSR, ARAP1, CLASP2, CLIP1, GIT2, LETMD1, NCOR2, PISD, PRPF39, RAD23A, RELCH, RPS24, and SOS1. The alternative splicing positions corresponding to the alternative splicing events of each gene are shown in the following table: