SNP (Single Nucleotide Polymorphism) site related to chicken testis character, molecular marker, primer pair and application of SNP site, molecular marker and primer pair

Abstract

The invention relates to the field of gene engineering, in particular to an SNP (Single Nucleotide Polymorphism) site related to chicken testis traits, a molecular marker, a primer pair and application of the SNP site, the molecular marker and the primer pair. The invention provides an SNP (Single Nucleotide Polymorphism) site and a molecular genetic marker containing the SNP site, the polymorphism of the site in Jiangxi local chicken breeds (Ningdu yellow cocks) is detected, the relationship between the site and testis traits is analyzed, and the result shows that the SNP site is remarkably related to the testis traits of the Ningdu yellow cocks. The invention provides a new molecular marker for identifying the testis traits of the Ningduo yellow chicken, can be used for early selection of individuals with excellent testis traits, provides a molecular marker-assisted selection basis for breeding of the Ningduo yellow chicken with excellent testis traits, and has important practical application value.

Description

Technical Field

[0001] The invention relates to the field of genetic engineering, and in particular to a SNP site, a molecular marker, a primer pair and applications thereof related to chicken testicle traits. Background Art

[0002] The local chicken breeds (such as Ningdu Yellow Chicken) are generally marketed at 110-120 days old. Because their organs are mature when they are marketed, some organs are by-products of broiler slaughter and marketed, which have high added value. Testicles are important reproductive organs of male animals, and their main function is to produce sperm and secrete androgens. In the breeding of high-quality chickens, testicular traits are not only important economic traits for laying hens, but also important economic traits for broiler breeding (Gu Minqing, 2008; Orlu et al., 2009; Sarabia et al., 2013). The size and weight of the testicles of roosters are directly related to the quantity and quality of sperm and semen, and are very important for the fertilization rate and maintenance of the flock. In the late breeding period, the reproductive function of roosters gradually declines, and the quality of semen will drop significantly, thereby shortening the service life of roosters. In addition, chicken testicles are one of the important tissue organs with great added value, with a wide market demand and a high market price, and are of concern to chicken producers.

[0003] Chicken testicles are a byproduct of high-quality chickens and have important medical and economic value. Therefore, how to select and increase the weight of chicken testicles has become one of the important research contents of chicken breeding and production. At the same time, by breeding chickens with moderate testicle size and good quality, the sustainable development of livestock and poultry farming can be achieved and the healthy development of the industry can be promoted.

[0004] However, given that chicken testicles are a slaughter trait, their selection often requires high slaughter costs. If effective molecular breeding markers or other indirect selection methods can be developed, it will greatly enhance the advantages of breeding. Summary of the invention

[0005] The purpose of the present invention is to provide a SNP site, a molecular marker, a primer pair and an application thereof related to chicken testicular traits, so as to solve the problems existing in the above-mentioned prior art.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The invention provides application of a SNP site in identifying chicken testis traits. The SNP site is located at the position of 18863652bp of chicken chromosome 11, and its polymorphism is T / C.

[0008] Further preferably, the chicken gene version number is GRCg6a (GCF_000002315.6).

[0009] Preferably, the chicken is Ningdu yellow chicken;

[0010] And / or, the chicken testicle traits include chicken testicle size and / or chicken testicle index.

[0011] The invention provides a SNP molecular marker related to chicken testicle traits. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.3, and there is a T / C base mutation at the 192nd position of the nucleotide sequence.

[0012] Preferably, the chicken is Ningdu yellow chicken;

[0013] And / or, the chicken testicle traits include chicken testicle size and / or chicken testicle index.

[0014] The present invention provides a primer set for detecting the above-mentioned SNP molecular marker, wherein the primer set comprises an upstream primer F having a nucleotide sequence as shown in SEQ ID NO.1 and a downstream primer R having a nucleotide sequence as shown in SEQ ID NO.2.

[0015] The present invention provides a detection reagent or a detection kit for the above-mentioned SNP molecular marker, comprising the above-mentioned primer set.

[0016] The present invention provides the use of the above-mentioned SNP molecular marker, the above-mentioned primer set or the above-mentioned detection reagent or detection kit in identifying chicken testis traits and / or chicken breeding.

[0017] Preferably, the chicken is Ningdu yellow chicken;

[0018] And / or, the chicken testicle traits include chicken testicle size and / or chicken testicle index.

[0019] The present invention provides a method for detecting chicken testicle traits, comprising the following steps:

[0020] Using the chicken DNA to be tested as a template, PCR amplification was performed using the above primer set;

[0021] Detecting the genotype of the chicken to be tested at the above-mentioned SNP molecular markers, and determining the chicken testicular traits according to the genotype;

[0022] When the genotype is TC or AG, the testicular traits of the tested chicken are judged to be good; when the genotype is CC or GG, the testicular traits of the tested chicken are judged to be poor.

[0023] Preferably, the chicken is Ningdu yellow chicken;

[0024] And / or, the chicken testicle traits include chicken testicle size and / or chicken testicle index.

[0025] The present invention discloses the following technical effects:

[0026] The present invention provides a SNP site and a molecular genetic marker containing the SNP site, detects the polymorphism of the site in a Jiangxi local chicken breed (Ningdu yellow rooster) and analyzes its relationship with testicular traits. As a result, it is found that the SNP site is significantly correlated with the testicular traits of Ningdu yellow chicken.

[0027] The present invention provides a new molecular marker for identifying the testicular traits of Ningdu yellow chickens, can be used for early selection of individuals with excellent testicular traits, provides a molecular marker-assisted selection basis for the breeding of Ningdu yellow chickens with excellent testicular traits, and has important practical application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0029] Figure 1 The results of sequencing typing. DETAILED DESCRIPTION

[0030] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0031] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0032] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0033] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0034] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0035] Example 1: Using the genotype of the chr11:18863652 site to select breeding roosters

[0036] 1. Sample collection and preparation

[0037] (1) Incubate 200 Ningdu yellow eggs and identify the sex of the eggs on the day of birth;

[0038] (2) Blood was collected from 70 male individuals.

[0039] 2. DNA Extraction

[0040] The genomic DNA was extracted using the phenol-chloroform extraction method (Osper F et al., 1998), and the specific steps are as follows:

[0041] (1) Take 30 μL of whole blood and place it in a 1.5 mL centrifuge tube. Add 470 μL of 1× SET buffer, 12.5 μL of 20% SDS, and 6 μL of 10 mg / mL proteinase K, mix well, and place in a 55°C water bath overnight.

[0042] (2) Take out the sample and put it into a 1.5 mL centrifuge tube, add 500 μL of saturated phenol, shake gently for 20 min, and centrifuge at 10,000 rpm for 10 min;

[0043] (3) Take the supernatant, add 500 μL of saturated phenol again, shake gently for 20 min, and centrifuge at 10,000 rpm for 10 min;

[0044] (4) Take the supernatant, add 500 μL of chloroform-isoamyl alcohol (volume ratio of 23:1), shake gently for 20 min, and centrifuge at 10,000 rpm for 10 min;

[0045] (5) Take the supernatant, add 1 mL of ice-cold anhydrous ethanol (-20°C), shake back and forth to precipitate DNA, centrifuge at 10,000 rpm for 10 min, and then pour off the ethanol;

[0046] (6) Wash the DNA once with 1 mL of 75% ethanol, pour off the ethanol, and dry it in a 50°C drying oven;

[0047] (7) After the DNA is completely dried, add 300 μL of sterilized double distilled water to dissolve it and place it in a 50°C water bath overnight to dissolve the DNA;

[0048] (8) Store in a -20℃ refrigerator for future use.

[0049] 3. Target site typing

[0050] Dissolve the synthesized primers in 1×TE to a concentration of 10 pmol, add the primers in group 1 together, mix well, and centrifuge.

[0051] Prepare PCR amplification system, the PCR amplification system is shown in Table 1.

[0052] Table 1 PCR amplification system

[0053] Components Dosage DNA samples 1-2 μL 2×PCRmix 7.5μL Mixed primers 2μL (1μL each for upstream primer F and downstream primer R) <![CDATA[H2O]]> Make up to 15 μL

[0054] The PCR amplification primers are shown in Table 2.

[0055] Table 2 PCR amplification primers

[0056] name sequence SEQ ID NO. Upstream primer F AAGACAGACGCAAAGAAGGCAC 1 Downstream primer R TCGTGCTTGGGGAAGGTCAG 2

[0057] The prepared PCR master tube was divided into PCR tubes, centrifuged, 2 μL of DNA sample was added to each well, centrifuged, and placed on the PCR instrument. The PCR amplification conditions are shown in Table 3.

[0058] Table 3 PCR amplification conditions

[0059]

[0060] 4 Sequencing typing

[0061] The amplified PCR product was sent to a biological company for sequencing, and the sequence was sequenced using downstream primer R. The SeqMan module of DNAStar software was used to read the experimental results and check the genotype of the target site.

[0062] 5 Results

[0063] (1) PCR product detection results

[0064] The sequence obtained by PCR amplification is shown in SEQ ID NO.3, specifically: AAGACAGACGCAAAGAAGGC ACGGAGATCCTCACCCTTTCCTCAGCAACGTCGTTCCCCGGTGCACCCAATGAAGGATG AGGGTTCTCCTCAGCCCTTTTGCTGCCCAGCGCCCACGTGAGCCGAGCAGGGGCAGCG CTGCCAAGGTGAAGGTCTACAACGGGAGCCGTGTTGGGTCAGCACTCAAACGAG

T

[0065] According to the information of the chicken genome, the site with the mutation on SEQ ID NO.3 is named chr11:18863652, that is, the site is located at the position of 18863652bp on chicken chromosome 11, and there is a T or C mutation. The chicken gene version number is: GRCg6a (GCF_000002315.6).

[0066] (2) Sequencing and typing

[0067] Use chromas software to view the peak graph. Figure 1 As shown. Figure 1 It can be seen that there are two typing results in the test samples, namely GG and AG.

[0068] (3) Result determination

[0069] According to the typing results, the individuals with genotypes GG and AG were numbered and raised to 22 weeks of age. The slaughter experiment data showed that the testicular traits of the individuals with GG genotype (the genotype obtained by upstream primer F was CC) were significantly different from those of the individuals with AG genotype (the genotype obtained by upstream primer F was TC), and the AG genotype was superior to the GG genotype. Therefore, the individuals with genotype AG were selected as breeder roosters. This result was consistent with the predicted result (Table 4).

[0070] Table 4 Statistical results of traits

[0071] Characteristics P-value AG / TC GG / CC Left testicle weight (g) 0.002 <![CDATA[20.9±1.3 A ]]> <![CDATA[14.7±1.4 B ]]> Right testicle weight (g) 0.004 <![CDATA[19.3±1.4 A ]]> <![CDATA[12.6±1.5 B ]]> Total testicular weight (g) 0.002 <![CDATA[40.3±2.5 A ]]> <![CDATA[27.3±2.8 B <!-- 4 -->]]> Left testicular index 0.003 <![CDATA[0.01±0.0007 A ]]> <![CDATA[0.008±0.0007 B ]]> Right testicular index 0.006 <![CDATA[0.012±0.0008 A ]]> <![CDATA[0.007±0.0007 B ]]> Total testicular mass index 0.003 <![CDATA[0.022±0.001 A ]]> <![CDATA[0.015±0.0015 B ]]>

[0072] Note: The formula for calculating testicular index is testicular weight / body weight.

[0073] In summary, the molecular markers provided by the present invention can be used to identify chicken testicular traits, can be used to screen breeding roosters, and can be used for breeding.

[0074] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. Application of SNP loci in identifying chicken testicular traits, characterized in that: The SNP site is located at the position of 18863652bp on chicken chromosome 11, and its polymorphism is T / C.

2. The use according to claim 1, characterized in that: The chicken is Ningdu yellow chicken; And / or, the chicken testicle traits include chicken testicle size and / or chicken testicle index.

3. A SNP molecular marker associated with chicken testicular traits, characterized in that: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.3, and there is a T / C base mutation at the 192nd position of the nucleotide sequence.

4. The SNP molecular marker according to claim 3, characterized in that: The chicken is Ningdu yellow chicken; And / or, the chicken testicle traits include chicken testicle size and / or chicken testicle index.

5. A primer set for detecting the SNP molecular marker according to claim 3 or 4, characterized in that: The primer set includes an upstream primer F having a nucleotide sequence as shown in SEQ ID NO.1 and a downstream primer R having a nucleotide sequence as shown in SEQ ID NO.

2.

6. A detection reagent or detection kit for SNP molecular markers according to claim 3 or 4, characterized in that: Comprising the primer set of claim 5.

7. Use of the SNP molecular marker according to claim 3 or 4, the primer set according to claim 5, or the detection reagent or detection kit according to claim 6 in identifying chicken testicular traits and / or chicken breeding.

8. The use according to claim 7, characterized in that: The chicken is Ningdu yellow chicken; And / or, the chicken testicle traits include chicken testicle size and / or chicken testicle index.

9. A method for detecting chicken testicle traits, characterized in that: The following steps are involved: Using the DNA of the chicken to be tested as a template, PCR amplification is performed using the primer set of claim 5; Detecting the genotype of the chicken to be tested at the SNP molecular marker described in claim 3 or 4, and determining the chicken testicular traits according to the genotype; When the genotype is TC or AG, the testicular traits of the tested chicken are judged to be good; when the genotype is CC or GG, the testicular traits of the tested chicken are judged to be poor.

10. The use according to claim 9, characterized in that: The chicken is Ningdu yellow chicken; And / or, the chicken testicle traits include chicken testicle size and / or chicken testicle index.

Images