SNP (Single Nucleotide Polymorphism) genetic marker associated with boar semen quality character and application thereof

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) genetic marker associated with pig semen quality traits and application of the SNP genetic marker. The SNP genetic marker is located in a promoter region of a pig ANXA5 gene, and a nucleotide sequence of the genetic marker is shown as SEQ ID NO.1 in a table; three SNP (single nucleotide polymorphism) sites are respectively arranged on the sequence, namely a base Y at the 169bp of the sequence is C or T, a base M at the 171bp of the sequence is C or A, and a base K at the 740bp of the sequence is G or T. Three SNP loci in an ANXA5 gene promoter region are all related to the sperm motility of the boar and are in a linkage imbalance state through correlation analysis, further haplotype analysis is carried out to divide the three SNP loci into three haplotypes, and after correlation analysis is carried out, it is found that the sperm motility traits of the boar have significant differences. According to the haplotype, boars with high semen quality characters can be screened out, and the economic benefits of live pig breeding are improved.

Description

Technical Field

[0001] The present invention relates to the technical field of pig genetic marker screening and application, and in particular to a SNP genetic marker associated with pig semen quality traits and an application thereof. Background Art

[0002] In modern pig production, the widespread use of artificial insemination makes the quality of boar semen extremely important. The quality of boar semen will directly affect the number of piglets born by sows, and thus affect the economic benefits of pig farming. Boar semen quality includes semen volume, sperm density, sperm motility and sperm deformity rate. The heritability of boar semen quality traits is low, and conventional breeding methods are slow to progress. The application of molecular marker-assisted breeding can largely solve this problem.

[0003] The AnnexinA5 (ANXA5) gene belongs to the AnnexinA family, which consists of structurally related proteins that bind to phospholipids in a calcium-dependent manner. ANXA5 has been shown to be widely expressed in the reproductive system of humans and rodents, including the testis (Li et al., 2011), epididymis (Guyonnet et al., 2011), sperm (Munuce et al., 2019), Leydig cells and Sertoli cells (Giambanco et al., 1991). The mutation rate in the promoter region of ANXA5 is increased in human oligospermia patients, among which the prevalence of haplotype M2 is higher (Lavorato et al., 2019). ANXA5 has also been shown to be significantly associated with rabbit sperm concentration, motility and morphology (Arruda-Alencar et al., 2012). et al. identified porcine ANXA5 as a candidate gene affecting reproductive traits in Yorkshire boars through GWAS analysis ( et al., 2017). The above studies all indicate that the ANXA5 gene plays an important role in reproduction, especially in boar semen quality traits.

[0004] Currently, no molecular markers have been reported to identify the effects of the ANXA5 gene on semen quality. Summary of the invention

[0005] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a SNP genetic marker associated with pig semen quality traits and its application. The present invention identifies the correlation between SNP molecular markers and boar semen quality traits through population trait association analysis. The SNP molecular marker is located in the promoter region of the ANXA5 gene and has three SNP sites, which verifies the ANXA5 gene polymorphism and provides a new genetic marker, genotyping and selection method for marker-assisted selection of pigs, laying the foundation for molecular improvement of semen quality.

[0006] To achieve the above purpose, the technical solution designed by the present invention is as follows:

[0007] The present invention provides a SNP genetic marker associated with pig semen quality traits, wherein the SNP genetic marker is located in the promoter region of the pig ANXA5 gene, and the nucleotide sequence of the genetic marker is shown in Table SEQ ID NO.1; there are three SNP sites on the sequence, namely

[0008] In the above sequence, base Y at the 169th bp is C or T, base M at the 171st bp is C or A, and base K at the 740th bp is G or T.

[0009] AGAAACTGACCCAAGGCAGAAGTTTTGAAATTTCCTAAGTAAGCTACCA

[0010] AAGAGCTATATATATTTAAGAGGCCATGTAGAAACCACTATTGACTTTTTT

[0011] TTAACTTAAAAATAAACTTAAGAAATGGCTCTCAAAGCTTCAAGCTTCCT

[0012] CTATACAAGGGTCAAAGAYGMGCTGTCCTTTACCTCAGTGACAGTCTCTT

[0013] AAAGACATCCATGCACCTCTAAGTGTGAGTACAAGGTGAGGCCCCGATC

[0014] CCCAGAGGTCACGGAGGGGAGTGAGGCCCCAAGCACCCGAAACCTAGA

[0015] GTCCTGATTAGCTCCCCCCGCTGCGCAAAGGCCAGGCGGTCACCCGGGA

[0016] CGGCGCGGAAGCGTGTCCCTACTGAGTTCCAAAGTGGCCACGACCCGG

[0017] CCCCACCCCAGCTGCCGGGACGCAGACTGGCCGCTCCCCACGCAGGGCG

[0018] CAGTGAGGCCACGGCCGGGCGGGGCAGGGCGGGGCCCGCCGGGACGGG

[0019] GCGGGGTCGGTGGTGTTTCCGTTGCTTGGAGCCGACAGAAAGTAGCTGC

[0020] TTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCCGCGCGCCGCCGCCC

[0021] CGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGGTGAGTGAGCGCT

[0022] CGCCTAGCCCGCAGAGGGGAGCGGGAACGCTGGGTTAGAGCGGATACT

[0023] CTGCTGAGAGCTCCTTCGGAGCTGCGGAGAGGGCGGGTCTGCAGCGGG

[0024] GCGCGGGGKCTCCGTGGGCCCTGCGGCAGGGAAGTCTGGCTAGCTGAA

[0025] CCAGCTGTCACTCTCTTCTCTTGCAGTCCTGCATCAGTCACCTTTTCCTG

[0026] ACCTGGGCAGTCGCTATGGCACAGGTAAGGCTGTGCGCCCTCGCGCAAC

[0027] GCTCGGATTTAGCAATTTTGTAAACTGCTCAGAGTTCTAGAGTTTGTTGG

[0028] AAAACCAGAAGAGTTTAGGAGTAAAACTCAGTCTGCCTTCCGAAAATCTT

[0029] TAATATTGTTTCCGCTTTGCATCCCCAACTCCTGTCCTTCTGCTTTCCGAGGAGTGT,

[0030] Furthermore, the genetic markers are incompletely linked (the first two SNPs are completely linked), and in the sequence, the dominant alleles at 169bp, 171bp, and 740bp are T, A, and T, respectively; and the dominant genotypes are CT, CA, and GT, respectively.

[0031] The present invention also provides an application of the above-mentioned SNP genetic marker in marker-assisted selection of pig semen quality traits.

[0032] The present invention also provides a primer pair for amplifying the above-mentioned SNP genetic marker, wherein the primer pair is:

[0033] Upstream primer: 5'-AGAAACTGACCCAAGGCAGAAGTT-3', as shown in SEQ ID NO.2;

[0034] Downstream primer: 5'-ACACTCCTCGGAAAGCAGAAGGAC-3', as shown in SEQ ID NO.3.

[0035] The present invention also provides a method for detecting SNPs associated with pig semen quality traits, wherein the method uses the above-mentioned primer pair for amplification and sequencing comparison to complete the detection.

[0036] The present invention also provides a method for constructing a haplotype combination, the method adopts the above method to detect three SNP sites, and then constructs three haplotype combinations based on the characteristics of incomplete linkage, namely H1H1: TATTAT; H1H2: TATCCG; H2H2: CCGCCG; according to the association between the haplotype combination and the pig semen quality traits, the haplotype H1H2 has higher boar sperm motility.

[0037] The present invention also provides an application of the primer pair in identifying boars with high-quality semen.

[0038] The present invention also provides a kit for identifying a boar with high-quality semen, the kit comprising the above primer pair.

[0039] Furthermore, the kit also includes PCRmix.

[0040] The present invention also provides a method for identifying a boar with high-quality semen, comprising the following steps:

[0041] 1) Extract genomic DNA from the semen of the sample to be tested and set aside

[0042] 2) Using the above genomic DNA as a template, PCR amplification was performed using the kit described in claim 6

[0043] 3) Using single nucleotide polymorphism detection, the genotypes of bases 169, 171 and 740 in the promoter region of the ANXA5 gene of the individual were identified and formed into haplotypes, and correlation analysis was performed with semen quality traits. When the individual haplotype was H1H2 (TATCCG), it was considered that the sample to be tested had good sperm motility; or, when the individual haplotype was H1H1 or H2H2, it was considered that the sperm motility of the sample to be tested was not high.

[0044] Beneficial effects of the present invention:

[0045] The three SNP sites located in the promoter region of the ANXA5 gene in the present invention are all related to boar sperm motility through association analysis and are in a linkage disequilibrium state. Further haplotype analysis divides them into three haplotypes, and association analysis finds that there are significant differences in boar sperm motility traits. The above haplotypes can screen out boars with higher semen quality traits and improve the economic benefits of pig farming. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] Figure 1 The agarose gel electrophoresis pattern of the PCR product in Example 1 is shown.

[0047] Description of the accompanying drawings: agarose gel concentration is 1.2%; lane M is DNA Marker DL2000; lanes 1-8 are amplified fragments of the primers shown in SEQ ID NO: 2 and SEQ ID NO: 3 in the sequence listing in the genome of different Duroc pigs, and the fragment size is 1034 bp.

[0048] Figure 2 From top to bottom, they are the sequencing map of the g.102387770T>C site in Example 1, the sequencing map of the g.102387772A>C site in Example 1 of the present invention, and the sequencing map of the g.102388341T>G site in Example 1 of the present invention.

[0049] Figure 3 : is a schematic diagram of the linkage disequilibrium analysis in Example 3,

[0050] Among them, the g.102387770T>C (rs343104241) locus and the g.102387772A>C (rs328765480) locus are completely linked. DETAILED DESCRIPTION

[0051] The present invention is further described in detail below in conjunction with specific embodiments so that those skilled in the art can understand.

[0052] Example 1 Acquisition of porcine ANXA5 gene fragment and establishment of polymorphism detection method

[0053] 1. Extraction of pig genomic DNA

[0054] The experimental pig breed of this embodiment is Duroc pig, and each pig has semen quality traits including semen volume, semen density, sperm motility and sperm deformity rate. The animal tissue genomic DNA extraction kit of Beijing Qingke Biotechnology Co., Ltd. is used to extract pig genomic DNA and the concentration and purity of the extracted DNA are tested.

[0055] 2. Obtaining the SNP genetic marker detection fragment of the porcine ANXA5 gene

[0056] A pair of primers was designed based on the SNP genetic marker detection sequence (as shown in SEQ ID NO: 1) in the promoter region sequence of the porcine ANXA5 gene (accession number ENSSSCG00000009097) to amplify the fragment of the polymorphic site. The primers are as follows:

[0057] Upstream primer: 5'-AGAAACTGACCCAAGGCAGAAGTT-3'

[0058] Downstream primer: 5'-ACACTCCTCGGAAAGCAGAAGGAC-3'

[0059] The target fragment with a length of 1034 bp was obtained by PCR amplification. The PCR reaction system is as follows: the total system is 25 μl, including 1 μl of template DNA, 0.5 μl of upstream and downstream primers, 12.5 μl of PCR Mix, and finally 10.5 μl of deionized water to a total volume of 25 μl; the PCR reaction procedure is as follows: pre-denaturation at 95°C for 5 min; then denaturation at 95°C for 30 s, annealing at 63°C for 30 s, and extension at 72°C for 1 min, for a total of 35 cycles, and finally extension at 72°C for 5 min. The PCR product was stored at 4°C. The PCR product was detected by 1.2% agarose gel electrophoresis, and the detection results are shown in the attached figure. Figure 1 shown.

[0060] 3. Direct sequencing to detect molecular markers in amplified fragments

[0061] The amplified PCR products were sent to Beijing Qingke Biotechnology Co., Ltd. for DNA sequencing. The sequencing results were compared and analyzed using the Benchling website to obtain the ANXA5 genotyping data of the above samples ( Figure 2 ).

[0062] Example 2 Association analysis of pig semen quality traits using genetic markers screened by the present invention

[0063] In order to determine whether the polymorphism of the promoter region of the porcine ANXA5 gene is related to the quality of porcine semen, the single marker variance analysis was performed using the GLM procedure of SAS statistical software (SAS Institute Inc, Version 9.4). At the same time, the REG procedure was used to calculate the gene additive effect and dominant effect, and a significance test was performed. The model used was:

[0064] Y ij =μ+G i +F j +e ij

[0065] Y ij is the phenotypic value of the trait, μ is the mean value, G i is the genotype effect (including gene additive effect and dominant effect); F j is the comprehensive effect of the pig farm; ij is the residual effect.

[0066] Association analysis between different genotypes and semen quality traits was performed in Duroc pigs, and the statistical analysis results are shown in Table 1.

[0067] Table 1 Statistical analysis of three SNPs in the promoter region of porcine ANXA5 gene and semen quality traits of Duroc pigs

[0068]

[0069] Note: The above values ​​are the least squares mean and standard error; lowercase letters indicate significant differences; μ: mean; SE: standard error.

[0070] As can be seen from Table 1, in Duroc pigs, the sperm motility CT genotype of g.102387770T>C was significantly higher than the TT genotype (P<0.05); the sperm motility CA genotype of g.102387772A>C was significantly higher than the AA genotype (P<0.05); the sperm motility GT genotype of g.102388341T>G was significantly higher than the TT genotype (P<0.05).

[0071] Example 3 Linkage disequilibrium analysis and haplotype analysis of pig semen quality traits using screened SNP genetic markers

[0072] To determine the association between the three SNPs in the promoter region of the porcine ANXA5 gene, linkage disequilibrium analysis was performed using Haploview software. The results are shown in the attached figure. Figure 3As shown, g.102387770T>C (rs343104241) and g.102387772A>C (rs328765480) are completely linked. Two haplotypes were constructed using Haploview software, namely H1 (TAT), H2 (CCG), H3 (CCT), and H4 (TAG). The frequencies of H3 and H4 haplotypes were less than 1%, so they were not considered. There were three haplotype combinations when the H1 and H2 haplotypes were combined. The three haplotype combinations were associated with boar semen quality traits. The statistical analysis results are shown in Table 2.

[0073] Table 2 Statistical analysis of haplotype combinations in the promoter region of porcine ANXA5 gene and semen quality traits of Duroc pigs

[0074]

[0075] Note: The above values ​​are the least squares mean and standard error; lowercase letters indicate significant differences; μ: mean; SE: standard error.

[0076] As shown in the results in Table 2, the H1H2 (TATCCG) haplotype combination is significantly higher than the H2H2 (CCGCCG) haplotype combination in terms of semen motility traits.

[0077] The invention identifies the promoter region SNP polymorphism of ANXA5 gene in Duroc pig population and analyzes its correlation with semen volume, sperm density, sperm motility and sperm deformity rate. In Duroc pig population, g.102387770T>C, g.102387772A>C and g.102388341T>G loci are significantly correlated with sperm motility, wherein the CT genotype in g.102387770T>C, the CA genotype in g.102387772A>C and the GT genotype in g.102388341T>G may be genotypes that are beneficial to improving sperm motility. Further haplotype analysis shows that the H1H2 (TATCCG) haplotype has higher boar sperm motility. Therefore, in the actual process of boar breeding, boars with the ANXA5 promoter region H1H2 (TATCCG) haplotype can be screened to obtain boar individuals with better semen quality traits. Therefore, the present invention can be used to guide the auxiliary selection of early screening of boars, thereby reducing the production cost of pig farming and increasing economic benefits.

[0078] Although the above embodiments have been described in detail, they are only a part of the embodiments of the present invention, not all of them. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all belong to the protection scope of the present invention.

Claims

1. A SNP genetic marker associated with pig semen quality traits, characterized in that: The SNP genetic marker is located in the promoter region of the pig ANXA5 gene, and the nucleotide sequence of the genetic marker is shown in Table SEQ ID NO.1; there are three SNP sites on the sequence, namely, the base Y at the 169th bp of the above sequence is C or T, the base M at the 171st bp is C or A, and the base K at the 740th bp is G or T.

2. The genetic marker according to claim 1, characterized in that: The genetic markers are incompletely linked. In the sequence, the dominant alleles at the 169 bp, 171 bp, and 740 bp are T, A, and T, respectively; and the dominant genotypes are CT, CA, and GT, respectively.

3. Use of the SNP genetic marker according to claim 1 in marker-assisted selection of pig semen quality traits.

4. A primer pair for amplifying the SNP genetic marker according to claim 1, characterized in that: The primer pairs are respectively upstream primer: 5'-AGAAACTGACCCAAGGCAGAAGTT-3', Downstream primer: 5′-ACACTCCTCGGAAAGCAGAAGGAC-3′.

5. A method for detecting SNPs associated with pig semen quality traits, characterized in that: The method adopts the primer pair described in claim 4 for amplification and completes the detection by sequencing and comparison.

6. A method for constructing a haplotype combination, characterized in that: The method uses the method described in claim 5 to detect three SNP sites, and then constructs three haplotype combinations based on the characteristics of incomplete linkage, namely H1H1: TATTAT; H1H2: TATCCG; H2H2: CCGCCG; according to the association between the haplotype combination and the pig semen quality traits, haplotype H1H2 has higher boar sperm motility.

7. Use of the primer pair according to claim 4 in identifying boars with high-quality semen.

8. A kit for identifying boars with high-quality semen, characterized in that: The kit comprises the primer pair according to claim 4.

9. The kit according to claim 8, characterized in that: The kit also includes a PCRmix.

10. A method for identifying boars with high-quality semen, characterized in that: The following steps are involved: 1) Extract genomic DNA from the semen of the sample to be tested and set aside 2) Using the above genomic DNA as a template, PCR amplification was performed using the kit described in claim 6 3) Using single nucleotide polymorphism detection, the genotypes of the 169th, 171st and 740th bases in the promoter region of the ANXA5 gene of the individual were identified and the haplotype combination was formed, and the correlation analysis was performed with the semen quality traits. When the individual haplotype was H1H2, it was considered that the sample to be tested had good sperm motility; Or, when the individual haplotype is H1H1 or H2H2, it is considered that the sperm motility of the sample to be tested is not high.

Images