Molecular marker and primer pair for identifying tobacco wildfire pathogen No.3 physiological race and application of molecular marker and primer pair

Abstract

The invention discloses a molecular marker and a primer pair for identifying tobacco wildfire pathogen No.3 physiological race and application of the molecular marker and the primer pair. The invention firstly discloses a primer pair composed of primers as shown in SEQ ID NO.1 and SEQ ID NO.2 and a molecular marker as shown in SEQ ID NO.3, wherein the primer pair is used for identifying the physiological race 3 of the tobacco wildfire pathogenic bacteria. The invention further discloses application of the primer pair and the molecular marker in identification of the tobacco wildfire pathogen No.3 physiological race. The molecular marker for identifying the physiological race of the wildfire pathogenic bacteria No.3 developed by the invention is in a specific deletion state in the physiological race of the wildfire pathogenic bacteria No.3, the rapid and accurate identification of the physiological race of the wildfire pathogenic bacteria No.3 is realized by detecting whether the molecular marker exists in different tobacco wildfire pathogenic bacteria, the operation is simple and feasible, the workload is greatly reduced, and the identification efficiency is improved. The method is of great significance to promotion of tobacco disease-resistant breeding work and effective prevention and control of wildfire hazards, and has a wide application prospect.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and more specifically to molecular markers, primer pairs and applications thereof for identifying physiological race 3 of tobacco pyroximate. Background Art

[0002] Tobacco wildfire is one of the main bacterial diseases in tobacco leaf production. The disease can occur throughout the tobacco growth period, especially in the seedling stage, and the disease at this stage can easily cause devastating losses. In recent years, wildfire has gradually become the main disease of tobacco leaf production in China's northeast tobacco-growing areas, and diseases have been reported from time to time in other tobacco-growing areas in China. The pathogenic bacteria of tobacco wildfire is Pseudomonas syringae pv. tabaci, which belongs to the genus Pseudomonas syringae, is Gram-negative, grows well on King's B medium, and can produce green fluorescence. Based on the existing tobacco resistance identification host distinction, there are currently four physiological subspecies of wildfire bacteria, namely physiological subspecies 0, 1, 2 and 3. Tobacco researchers have always identified the physiological subspecies by inoculating different wildfire bacteria strains in the field and observing the pathological manifestations of each strain on different disease-resistant tobacco varieties. This conventional identification method is costly, time-consuming and labor-intensive, and usually relies on the researchers' experience to judge the test results, which is inevitably biased. In 2021, the Tobacco Science Research Institute of Heilongjiang Province Company of China National Tobacco Corporation developed a molecular marker (CN 113930530 B) that can preliminarily distinguish the physiological subspecies of tobacco wildfire pathogens. This marker can preliminarily distinguish the four physiological subspecies into subspecies 0, 3 and subspecies 1, 2, and preliminarily improve the efficiency of wildfire pathogen physiological subspecies identification. However, this marker still cannot achieve accurate identification of physiological subspecies 3.

[0003] The first prerequisite for breeding disease-resistant tobacco varieties is to deeply analyze the pathogen. Physiological race 3 plays an important role in the spread and harm of wildfire bacteria, but the existing identification methods cannot quickly and accurately identify it, which seriously restricts the breeding of disease-resistant varieties and the effective prevention and control of diseases.

[0004] Therefore, it is necessary to provide a specific molecular marker for rapid and accurate identification of physiological race 3 of tobacco pyroximate to solve the above problems. Summary of the invention

[0005] One object of the present invention is to provide molecular markers and primer pairs for rapid and accurate identification of physiological race 3 of tobacco pyrophora syringae.

[0006] Another object of the present invention is to provide the use of the above-mentioned molecular markers and primer pairs in identifying or assisting in identifying the physiological race 3 of the tobacco pyrophora to be tested.

[0007] In order to achieve the above object, the present invention adopts the following technical solutions:

[0008] The present invention first provides a primer pair for identifying or assisting in identifying the physiological race 3 of the tobacco pyrophora to be detected, wherein the primer pair consists of an upstream primer HopE1-F and a downstream primer HopE1-R:

[0009] The upstream primer HopE1-F is a single-stranded DNA molecule shown in SEQ ID NO.1; the downstream primer HopE1-R is a single-stranded DNA molecule shown in SEQ ID NO.2.

[0010] A kit comprising the above primer pair is also within the protection scope of the present invention, wherein the kit is a kit for identifying or assisting in identifying the physiological race 3 of the tobacco pyrophosphate bacterium to be tested.

[0011] The preparation method of the kit of the present invention comprises the steps of individually packaging each primer of the primer pair.

[0012] The present invention further provides the use of the above primer pair or kit in any of the following:

[0013] A1) preparing a product for identifying or assisting in identifying the physiological race 3 of the tobacco pyroximate to be tested;

[0014] A2) Identify or assist in identifying the physiological race 3 of the tobacco pyrolyticus spp. to be tested;

[0015] A3) preparing a product for identifying or assisting in identifying whether the tobacco pyroximate to be tested is pyroximate physiological race 3;

[0016] A4) Identify or assist in identifying whether the tested tobacco pyrophora syringae is physiological race 3 of pyrophora syringae.

[0017] The present invention further provides a method for identifying or assisting in identifying whether a tested tobacco pyrophora syringae is physiological race 3 of pyrophora syringae, comprising the following steps:

[0018] Using the tobacco pyroximate pathogen to be tested as a template, the above primer pair or kit is used to perform a PCR reaction to obtain a PCR product;

[0019] If a band with a size of 500-750bp does not appear in the PCR product, the tobacco pyrophosphate bacterium to be tested is determined as or is a candidate for physiological species 3 of pyrophosphate bacterium; if a band with a size of 500-750bp appears in the PCR product, the tobacco pyrophosphate bacterium to be tested is determined as or is a candidate for physiological species 3 of non-pyrophosphate bacterium.

[0020] In a specific embodiment of the present invention, the 500-750 bp band in the above method can specifically be a 636 bp band.

[0021] The parameters of the PCR reaction of the present invention are as follows: 95°C for 5 minutes; 95°C for 40 seconds, 58°C for 40 seconds, 72°C for 1 minute, 33 cycles; 72°C for 5 minutes.

[0022] The present invention further provides a molecular marker for identifying or assisting in identifying the physiological race 3 of the tobacco pyrophora to be tested, wherein the molecular marker is a DNA molecule shown in SEQ ID NO.3.

[0023] The application of the above molecular markers in any of the following also falls within the protection scope of the present invention:

[0024] A1) preparing a product for identifying or assisting in identifying the physiological race 3 of the tobacco pyroximate to be tested;

[0025] A2) Identify or assist in identifying the physiological race 3 of the tobacco pyrolyticus spp. to be tested;

[0026] A3) preparing a product for identifying or assisting in identifying whether the tobacco pyroximate to be tested is pyroximate physiological race 3;

[0027] A4) Identify or assist in identifying whether the tested tobacco pyrophora syringae is physiological race 3 of pyrophora syringae.

[0028] The present invention further provides a method for identifying or assisting in identifying whether a tested tobacco pyrophora syringae is a physiological race 3 of pyrophora syringae, comprising the following steps:

[0029] The genomic DNA of the tobacco pyrophosphate bacterium to be tested is detected for the presence of the above-mentioned molecular marker. If the above-mentioned molecular marker is not present, the tobacco pyrophosphate bacterium to be tested is or is a candidate for physiological species 3 of pyrophosphate bacterium; if the above-mentioned molecular marker is present, the tobacco pyrophosphate bacterium to be tested is or is a candidate for physiological species 3 of non-pyrophosphate bacterium.

[0030] The beneficial effects of the present invention are as follows:

[0031] Based on genome sequencing of different wildfire pyroxine physiological races and comparison of effector proteins of the type III secretion system of Pseudomonas syringae, the present invention successfully developed a molecular marker for identifying wildfire pyroxine physiological race 3. The molecular marker is specifically absent in wildfire pyroxine physiological race 3. By detecting the presence or absence of the molecular marker in different tobacco wildfire pyroxine bacteria, rapid and accurate identification of wildfire pyroxine physiological race 3 is achieved. The operation is simple and easy, which greatly reduces the workload. It is of great significance to the promotion of tobacco disease-resistant breeding and the effective prevention and control of wildfire disease hazards, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] The specific implementation modes of the present invention are further described in detail below in conjunction with the accompanying drawings.

[0033] Figure 1 This is an agarose gel result diagram of PCR identification of physiological races of tobacco wildfire pathogen; wherein, M represents a DNA molecular weight marker, and WF1~WF5 are PCR products of the tobacco wildfire pathogen strains to be tested.

[0034] Figure 2 These are the pathological reaction diagrams of wildfire strains WF1, WF2, and WF5 on the leaves of tobacco varieties RW, B21, and LJ911 in tobacco pathology experiments; left: wildfire strain WF5, upper right: wildfire strain WF2, lower right: wildfire strain WF1; arrows indicate necrotic spots. DETAILED DESCRIPTION

[0035] In order to more clearly illustrate the present invention, the present invention is further described below in conjunction with preferred embodiments and accompanying drawings. Similar components in the accompanying drawings are represented by the same reference numerals. It should be understood by those skilled in the art that the content specifically described below is illustrative rather than restrictive, and should not be used to limit the scope of protection of the present invention.

[0036] Example 1 Method for Identifying Physiological Race 3 of Psora syringae Pseudomonas syringae Using PCR Primer Pairs or Molecular Markers

[0037] 1. Discovery of molecular markers and PCR primer design

[0038] First, the whole genome of each physiological subspecies of Pseudomonas syringae was sequenced, and the genomes of each physiological subspecies were compared with the database of type III secretion system effector proteins of Pseudomonas syringae, and 20-30 type III secretion system effector proteins of each physiological subspecies were screened. By comparing the type III secretion system effector proteins of each physiological subspecies, an effector protein HopE1 was screened that only exists in physiological subspecies 0 and 1, but is missing in physiological subspecies 3, and the sequence of its complete protein coding region is shown in SEQ ID NO.3 (i.e., the molecular marker for identifying physiological subspecies 3 of Pseudomonas syringae is the DNA molecule shown in SEQID NO.3).

[0039] Based on the above sequence, PCR primers were designed to amplify the complete protein coding region of the HopE1 gene. The PCR primer sequences (from 5' to 3') are:

[0040] Upstream primer HopE1-F: TTAGTCAATCACATGCGCTTGG (SEQ ID NO. 1);

[0041] Downstream primer HopE1-R: ATGAATAGAGTTTCCGGTAGCTC (SEQ ID NO. 2).

[0042] The size of the PCR product obtained by PCR reaction was 636 bp.

[0043] 2. PCR testing

[0044] Thaw the bacterial suspension of five wildfire disease strains, WF1, WF2, WF3, WF4 and WF5, stored in a -80℃ freezer on ice. Use a micropipette to transfer 10μL of each bacterial suspension to a PCR reaction tube, centrifuge at 10,000 rpm for 1 minute, then remove the supernatant with a micropipette, and use the remaining bacterial precipitate as the test sample.

[0045] Use a micropipette to add 5μL of Premix Ex Taq HotStart Version and 1μL of upstream and downstream PCR primers (concentration of 10μM) to the PCR reaction tube containing the sample to be tested, add double distilled water to make up the total volume of the reaction solution to 10μL, and mix the reaction solution by pipetting. Put each reaction tube into the PCR instrument for PCR reaction, and set the PCR reaction parameters to 95℃ for 5 minutes; 95℃ for 40 seconds, 58℃ for 40 seconds, 72℃ for 1 minute, 33 cycles; 72℃ for 5 minutes, and obtain the PCR products of the five tobacco wildfire strains to be tested, WF1, WF2, WF3, WF4 and WF5, respectively.

[0046] 3. Nucleic acid electrophoresis detection and result determination

[0047] Nucleic acid electrophoresis detection: Prepare 1% agarose gel and add nucleic acid colorimetric reagent. Mix the PCR products of the five tobacco wildfire disease strains WF1, WF2, WF3, WF4 and WF5 to be tested with the loading buffer and spot onto the agarose gel. Place the agarose gel in TAE buffer for electrophoresis. Set the electrophoresis voltage to a constant 120 volts and perform electrophoresis for 30 minutes. Take out the electrophoresed agarose gel and place it in a gel imager for development.

[0048] Result determination: If a band with a size of 500-750bp (specifically 636bp) does not appear in the PCR product of the tobacco wildfire disease strain to be tested (that is, the molecular marker shown in SEQ ID NO.3 does not exist in the genomic DNA of the tobacco wildfire disease strain to be tested), the tobacco wildfire disease strain to be tested is determined to be physiological race 3 of wildfire disease bacteria; if a band with a size of 500-750bp (specifically 636bp) appears in the PCR product of the tobacco wildfire disease strain to be tested (that is, the molecular marker shown in SEQ ID NO.3 exists in the genomic DNA of the tobacco wildfire disease strain to be tested), the tobacco wildfire disease strain to be tested is determined to be not physiological race 3 of wildfire disease bacteria.

[0049] The results are as follows Figure 1As shown, based on the electrophoresis test results, WF4 and WF5 were identified as physiological species 3 of P. pyroxithrum, and WF1, WF2 and WF3 were identified as non-physiological species 3.

[0050] Example 2 Method for Identifying Physiological Race 3 of Tobacco Pyrocaulifera Using Tobacco Pathology Test

[0051] The tobacco pathology test was conducted by inoculating the tested tobacco wildfire disease strain into tobacco used as the host tobacco for resistance identification to verify the determination result of "the method for identifying the physiological subspecies 3 of tobacco wildfire disease pathogen using PCR primer pairs or molecular markers in Example 1".

[0052] 1. Resistance identification host tobacco preparation

[0053] Three tobacco varieties, RW, Burley 21 (B21), and Longjiang 911 (LJ911), were transplanted into pots after seedling raising and transplanting. When the tobacco plants grew to the cluster stage, they could be inoculated with wildfire pathogens.

[0054] Among them, tobacco variety RW is a disease-resistant tobacco variety, which can resist physiological species 0 and 1 of wildfire pathogen; tobacco variety B21 is a disease-resistant tobacco variety, which is only resistant to physiological species 0; tobacco variety LJ911 is a susceptible tobacco variety, which serves as a susceptible control.

[0055] 2. Preparation of wildfire disease strain inoculum

[0056] Take out the frozen bacterial liquids of three wildfire disease strains WF1, WF2, and WF5 from the -80℃ refrigerator, take 50μL of each bacterial liquid and add it to a culture bottle containing 50mL of liquid LB medium. Put the culture bottle into a temperature-controlled shaker, shake the bacterial liquid at 28℃ and 180 rpm for 16 hours, centrifuge at 5000 rpm for 10 minutes, pour out the supernatant, and resuspend the obtained bacterial precipitate with sterilized PBS solution; centrifuge at 5000 rpm for 10 minutes, pour out the supernatant, and resuspend the obtained bacterial precipitate with sterilized PBS solution to prepare a bacterial liquid mother liquid with a concentration of 0.1OD. The bacterial liquid mother liquid is diluted 10 times with a sterilized PBS solution, and finally an inoculum with a concentration of 0.001OD is prepared for standby use.

[0057] 3. Wildfire bacteria inoculation

[0058] Each tobacco variety was inoculated with each wildfire disease strain by injection, and the specific method was as follows:

[0059] Select two fully expanded leaves at the upper leaf position of the tobacco varieties RW, B21, and LJ911 at the cluster stage as inoculated leaves, and pierce holes on both sides of the leaf veins with a 1mL syringe needle. Use a needleless syringe to absorb the inoculation solution, press the hole position on the front of the leaf with your fingers, and inject the inoculation solution into the leaf from the back of the leaf for injection inoculation, forming an injection area with a diameter greater than 1 cm. Three wildfire strains WF1, WF2, and WF5 were injected into the same leaf, and one tobacco strain was injected with 2 leaves, 4 strains of each tobacco variety were repeated, and each strain was repeated 8 times in total.

[0060] 4. Identification of physiological races of Pseudomonas syringae psoriasiformis

[0061] One week after inoculation, the pathological reactions of each wildfire disease strain on the leaves of each tobacco variety were observed and photographed, and the results were identified.

[0062] The results are as follows Figure 2 As shown, the wildfire strain WF1 can infect the susceptible tobacco variety LJ911 (brown necrotic spots appear with yellow halos), but cannot infect the two resistant tobacco varieties, and is determined to be the physiological race 0 of the wildfire; the wildfire strain WF2 can infect the resistant tobacco variety B21, but cannot infect the resistant tobacco variety RW, and is determined to be the physiological race 1 of the wildfire; the wildfire strain WF5 cannot infect the resistant tobacco variety B21, but can infect the resistant tobacco variety RW, and is determined to be the physiological race 3 of the wildfire.

[0063] In summary, the wildfire disease strain WF1 is the wildfire disease strain 0, the wildfire disease strain WF2 is the wildfire disease strain 1, and the wildfire disease strain WF5 is the wildfire disease strain 3. This is consistent with the judgment result of "the method for identifying the tobacco wildfire disease strain 3 using PCR primer pairs or molecular markers in Example 1", which verifies the accuracy of "the method for identifying the tobacco wildfire disease strain 3 using PCR primer pairs or molecular markers in Example 1".

[0064] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not limitations on the implementation methods of the present invention. For ordinary technicians in the relevant field, other different forms of changes or modifications can be made based on the above description. It is impossible to list all the implementation methods here. All obvious changes or modifications derived from the technical solution of the present invention are still within the protection scope of the present invention.

Claims

1. A primer pair for identifying or assisting in identifying the physiological race 3 of the tobacco pyrolyticus spp. to be tested, characterized in that: The primer pair consists of an upstream primer HopE1-F and a downstream primer HopE1-R: The upstream primer HopE1-F is a single-stranded DNA molecule shown in SEQ ID NO.1; the downstream primer HopE1-R is a single-stranded DNA molecule shown in SEQ ID NO.

2.

2. A kit for identifying or assisting in identifying the physiological race 3 of the tobacco pyrolyticus spp. to be tested, characterized in that: The kit comprises the primer pair according to claim 1.

3. Use of the primer pair according to claim 1 or the kit according to claim 2 in any of the following: A1) preparing a product for identifying or assisting in identifying the physiological race 3 of the tobacco pyroximate to be tested; A2) Identify or assist in identifying the physiological race 3 of the tobacco pyrolyticus spp. to be tested; A3) preparing a product for identifying or assisting in identifying whether the tobacco pyroximate to be tested is pyroximate physiological race 3; A4) Identify or assist in identifying whether the tested tobacco pyrophora syringae is physiological race 3 of pyrophora syringae.

4. A method for identifying or assisting in identifying whether a tested tobacco pyrophora syringae is a physiological race 3 of pyrophora syringae, characterized in that: The steps include: Using the tobacco pyrocatecholoma virus to be tested as a template, using the primer pair described in claim 1 or the kit described in claim 2 to perform a PCR reaction to obtain a PCR product; If the PCR product does not contain a band with a size of 500-750 bp, the tested tobacco pyrophora syringae is determined to be or is a candidate for physiological race 3 of pyrophora syringae; If the PCR product shows a band with a size of 500-750 bp, the tobacco pyrophosphate bacterium to be tested is determined to be or is a candidate for being a physiological race 3 of the non-pyrophosphate bacterium.

5. The method according to claim 4, characterized in that The 500-750 bp band is a band with a size of 636 bp.

6. A molecular marker for identifying or assisting in identifying the physiological race 3 of the tobacco pyrolyticus spp. to be tested, characterized in that: The molecular marker is the DNA molecule shown in SEQ ID NO.

3.

7. Use of the molecular marker according to claim 6 in any of the following: A1) preparing a product for identifying or assisting in identifying the physiological race 3 of the tobacco pyroximate to be tested; A2) Identify or assist in identifying the physiological race 3 of the tobacco pyrolyticus spp. to be tested; A3) preparing a product for identifying or assisting in identifying whether the tobacco pyroximate to be tested is pyroximate physiological race 3; A4) Identify or assist in identifying whether the tested tobacco pyrophora syringae is physiological race 3 of pyrophora syringae.

8. A method for identifying or assisting in identifying whether a tested tobacco pyroximate is pyroximate physiological race 3, characterized in that: The method comprises the following steps: Detecting whether the molecular marker of claim 6 exists in the genomic DNA of the tested tobacco pyrophora syringae. If the molecular marker of claim 6 does not exist, the tested tobacco pyrophora syringae is or is a candidate for physiological race 3 of pyrophora syringae. If the molecular marker according to claim 6 is present, the tobacco pyrophora spp. to be detected is or is a candidate for being a physiological race 3 of the non-pyrophora spp.

Images