SNP (Single Nucleotide Polymorphism) molecular marker related to drug resistance of eimeria maduramicin and application of SNP molecular marker

Abstract

The invention provides an SNP (Single Nucleotide Polymorphism) molecular marker related to drug resistance of eimeria maduramicin and application of the SNP molecular marker. The method comprises the following steps: hybridizing a chicken eimeria tenella maduramicin drug-resistant strain with a sensitive strain, and backcrossing the hybridized strain with the sensitive strain to construct a maduramicin drug-resistant introgression line strain. By means of a genome re-sequencing technology and a gene editing technology, polymorphic mutation exists in the 1255th nucleotide of the ETH20402100 gene, C corresponds to a maduramicin sensitive phenotype, and T corresponds to a maduramicin drug-resistant phenotype. Based on a PCR identification result of a field sample, the SNP molecular marker can accurately detect the drug resistance of maduramicin, and the result is consistent with a cage feeding experiment. The invention provides a primer for detection and a method for screening drug-resistant strains by combining a PCR (Polymerase Chain Reaction) technology, and the method is simple to operate, short in time consumption and low in cost, and can be widely applied to clinical detection of the drug resistance of chicken coccidiosis maduramicin and drug use guidance.

Description

Technical Field

[0001] The invention belongs to the technical field of coccidia drug resistance detection, and in particular relates to a SNP molecular marker related to maduramycin drug resistance of Eimeria and an application thereof. Background Art

[0002] Chicken coccidiosis is an obligate intestinal parasitic disease caused by Eimeria. The disease has the characteristics of high morbidity, strong infectivity and high mortality, causing huge economic losses to the poultry industry. Eimeria ) belongs to the phylum Apicomplexa. The seven species of Eimeria that have been discovered and recognized include Eimeria tenella, Eimeria toxicophila, Eimeria acervulina, Eimeria precocious, Eimeria giant, Eimeria brunneri and Eimeria malaise. Different species of Eimeria parasitize different parts of the intestine, mainly destroying intestinal epithelial cells, leading to digestion and absorption disorders, reduced feed conversion rate and decreased production performance. In severe cases, it can cause intestinal hemorrhagic lesions, leading to large-scale deaths of chickens, seriously affecting the economic benefits of the farm.

[0003] At present, the prevention and control of chicken coccidiosis mainly relies on drug treatment. Available anticoccidial drugs include two major categories: polyether ion carriers (such as monensin, salinomycin, maduramicin, narathromycin, lasalinomycin, etc.) and chemical synthesis (such as sulfaquinoxaline, sulfachloropyrazine, diclazuril, toltrazuril, butoxyquin methyl, benzyloxyquin methyl, clopidogrel, halofopyridine, etc.). Due to the limited types of anticoccidial drugs, long-term use leads to drug resistance, which is very common and poses a serious challenge to the prevention and control of coccidiosis. However, current research on coccidial resistance is mostly limited to epidemiological surveys or omics analysis of the differences between sensitive and resistant strains. There are few studies on the resistance mechanism of anticoccidial drugs, which limits the further advancement of scientific prevention and control.

[0004] Maduramicin is the first microgram-level potent polyether ion carrier anticoccidial drug. It is widely used in the prevention and treatment of coccidiosis in livestock and poultry due to its wide anticoccidial spectrum, strong effect, and low dosage. Maduramicin was registered by the U.S. Food and Drug Administration (FDA) in 1987 and entered the Chinese veterinary drug market in the mid-1990s. However, only a few years later, maduramicin-resistant strains were reported at home and abroad. Studies have shown that the prevalence rate of maduramicin-resistant strains in chickens in Guangdong Province is as high as 95.2%, which seriously weakens the prevention and treatment effect of the drug. The elucidation of the resistance mechanism of maduramicin is crucial for the development of rapid detection methods and guiding the rational use of drugs in clinical practice. However, the current understanding of the resistance mechanism is still insufficient, which has become an important obstacle to the rational use of clinical drugs.

[0005] At present, the detection method of maduramicin resistance mainly relies on cage feeding experiments, which has the disadvantages of being time-consuming, costly, and complicated to operate. Therefore, it is urgent to develop a rapid and simple detection method to guide clinical scientific drug use, assist in the scientific prevention and control of coccidiosis, and improve the production efficiency of farms. Summary of the invention

[0006] The present invention aims to provide a SNP molecular marker related to the maduramicin resistance of Eimeria and an application thereof, so as to facilitate rapid and accurate detection of the maduramicin resistance of chicken coccidia.

[0007] The present invention also provides a kit based on the SNP molecular marker and a detection method thereof, which are used for efficiently and low-costly screening of maduramicin-resistant strains of chicken coccidia, thereby guiding the scientific use of clinical anticoccidial drugs.

[0008] In order to achieve the purpose of the present invention, in a first aspect, the present invention provides a SNP molecular marker associated with maduramicin resistance of Eimeria, wherein the SNP molecular marker comprises a nucleotide sequence in which the polymorphism at position 1255 of the sequence shown in SEQ ID NO: 1 is C / T (N is C or T); Among them, the polymorphic site of the SNP molecular marker is C, corresponding to maduramicin sensitive insect strains, and the polymorphic site is T, corresponding to maduramicin resistant insect strains.

[0009] In a second aspect, the present invention provides a primer pair for amplifying the SNP molecular marker of claim 1, comprising: (1) A primer pair Et (SEQ ID NO: 2-3) suitable for detecting Eimeria tenella, specifically comprising: Et-F: ATGCCGACTTCCACGCTAGGC; Et-R:TCAGTCTGCTGTTGGCCCATC; and / or, (2) A primer pair En (SEQ ID NO: 4-5) suitable for detecting Eimeria toxicans, specifically comprising: En-F: ATGCAGACTTCCACGCTAGGGCC; En-R:TCAGTCTGCTGTTGACCCATCA; and / or, (3) Primer pair Ea (SEQ ID NO: 6-7) suitable for detecting Eimeria acervulina, specifically comprising: Ea-F: ATGGACCCAATGCCTCTCCGG; Ea-R: CTAATGATCGATTCTCTTAAC; and / or, (4) A primer pair Ep (SEQ ID NO: 8-9) suitable for detecting Eimeria precocidia, specifically comprising: Ep-F: ATGCACAGACCCGACAAGACGG; Ep-R:TCAGTCAGCTTGCTCAGCGGGA; and / or, (5) Primer pair Emwey (SEQ ID NO: 10-11) suitable for detecting Eimeria maxima, specifically comprising: Emwey-F:ATGCCTATCACAGACCATGAAC; Emwey-R:TCAGTCGGCCTGTTCATCAGTA; and / or, (6) A primer pair Eb (SEQ ID NO: 12-13) suitable for detecting Eimeria brunneri, specifically comprising: Eb-F:ATGCCGCCGGTTAACATCGAAG; Eb-R:TCAGTCTGCCTCTTGAGCGATA; and / or, (7) A primer pair Em (SEQ ID NO: 14-15) suitable for detecting Eimeria mitis, specifically comprising: Em-F: ATGCCGCCCCTAAATCTTGAC; Em-R:TCAGTCCACTTGTGTGCCGGT.

[0010] In a third aspect, the present invention provides a detection reagent or a kit containing the primer pair.

[0011] In a fourth aspect, the present invention provides a method for identifying the maduramicin resistance of Eimeria (including non-disease diagnosis and treatment purposes), the method comprising: extracting RNA of the Eimeria to be tested, reverse transcribing it into cDNA, and then using the cDNA as a template to perform PCR amplification using the primer pair or a detection reagent or kit containing the primer pair, and judging the maduramicin resistance of the Eimeria to be tested based on the PCR amplification results.

[0012] Preferably, the reaction program of the PCR amplification is: 95 °C for 3 min; 95 °C for 30 s, 55 °C for 30 s, 72 °C for 15 s, 30 cycles; 72 °C for 10 min.

[0013] Furthermore, the method for determining the maduramicin resistance of the Eimeria to be tested includes: analyzing the single nucleotide polymorphism of the SNP molecular marker in the PCR amplification product, and determining whether the Eimeria to be tested is a resistant or sensitive phenotype according to the polymorphic site.

[0014] If the base of the polymorphic site of the SNP molecular marker is C, the Eimeria to be tested is a maduramicin sensitive phenotype; if the base of the polymorphic site of the SNP molecular marker is T, the Eimeria to be tested is a maduramicin resistant phenotype.

[0015] In a fifth aspect, the present invention provides the use of the SNP molecular marker or the primer pair or a detection reagent or kit containing the primer pair in screening for maduramicin-resistant strains of chicken coccidia (including non-disease diagnosis and treatment purposes).

[0016] In a sixth aspect, the present invention provides the use of the SNP molecular marker or the primer pair or a detection reagent or kit containing the primer pair in guiding the use of anticoccidial drugs for chicken coccidia.

[0017] By means of the above technical solution, the present invention has at least the following advantages and beneficial effects: (I) The method for detecting maduramicin resistance of Eimeria provided by the present invention is applicable to seven species of Eimeria: tender, toxic, agglomerated, giant, precocious, Brucella and mild.

[0018] (ii) The SNP molecular marker provided by the present invention showed a high degree of accuracy in detecting maduramicin resistance, and its detection results were completely consistent with the identification results of traditional cage feeding experiments. Therefore, the marker can be used as a reliable basis for screening and detecting maduramicin-resistant insect strains.

[0019] (III) The method for detecting maduramicin resistance of coccidia provided by the present invention has the advantages of high accuracy, short time consumption, low cost, and simple and easy operation, and can be widely used in the scientific prevention and control of chicken coccidiosis and the improvement of production efficiency of farms. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 In the preferred embodiment of the present invention, the introgressed strains were analyzed by genome resequencing ΔSNP-index to locate the candidate interval of drug resistance genes. The red arrows point to the candidate interval of drug resistance genes located on chromosome 4.

[0021] Figure 2 This is a preferred embodiment of the present invention, in which PCR is used to detect the mutation site of the candidate gene, wherein M is a DNA marker, AL5000; Lane 1 is the H strain ETH2_0402700 ; Lane 2 is strain H ETH2_0402400 ; Lane 3 is strain H ETH2_0402100 ; Lane 4 is strain H ETH2_0402600 ; Lane 5 is MRR strain ETH2_0402700 ; Lane 6 is MRR strain ETH2_0402400 ; Lane 7 is MRR strain ETH2_0402100; Lane 8 is MRR strain ETH2_0402600 .

[0022] Figure 3 The figure is a gel electrophoresis diagram of the PCR amplification product in a preferred embodiment of the present invention, wherein M is a DNA marker, AL5000; Lane 1 is an amplification product using the Ea primer pair for detecting Eimeria acervulina as primers and the Eimeria acervulina cDNA as a template; Lane 2 is an amplification product using the Et primer pair for detecting Eimeria tenella as primers and the Eimeria tenella cDNA as a template.

[0023] Figure 4 This is the PCR detection of mutation sites in field samples in a preferred embodiment of the present invention, wherein M is a DNA marker, AL5000; lanes 1-11 represent field samples collected from different farms. DETAILED DESCRIPTION

[0024] The present invention aims to provide a SNP molecular marker associated with the maduramicin resistance of Eimeria, so as to facilitate rapid and accurate detection of the maduramicin resistance of chicken coccidia.

[0025] The present invention also provides a kit based on the SNP molecular marker and a detection method thereof, which are used for efficiently and low-costly screening of maduramicin-resistant strains of chicken coccidia, thereby guiding the scientific use of clinical anticoccidial drugs.

[0026] The present invention adopts the following technical solution: The present invention provides a SNP molecular marker associated with maduramicin resistance of Eimeria, which comprises a DNA fragment of a nucleotide sequence as shown in SEQ ID NO: 1. The DNA fragment has a polymorphism at position 1255, which is manifested as a change in base C or T: Among them, the polymorphic site of the SNP molecular marker is C, corresponding to maduramicin sensitive insect strains, and the polymorphic site is T, corresponding to maduramicin resistant insect strains.

[0027] The SNP molecular marker of the present invention can be rapidly detected by molecular biological techniques such as polymerase chain reaction (PCR), and provides a reliable molecular tool for screening of maduramicin resistance in chicken coccidia.

[0028] The present invention also provides a specific primer pair for amplifying the SNP molecular marker associated with the maduramicin resistance of Eimeria, comprising: The primer pair Et suitable for detecting Eimeria tenella has the following primer sequences (5′-3′): Et-F: ATGCCGACTTCCACGCTAGGC; Et-R:TCAGTCTGCTGTTGGCCCATC; and / or, The primer pair En suitable for detecting Eimeria toxicans, the primer sequence is as follows (5′-3′): En-F: ATGCAGACTTCCACGCTAGGGCC; En-R:TCAGTCTGCTGTTGACCCATCA; and / or, Primer pair Ea suitable for detecting Eimeria acervulina, the primer sequence is as follows (5′-3′): Ea-F: ATGGACCCAATGCCTCTCCGG; Ea-R: CTAATGATCGATTCTCTTAAC; and / or, The primer pair Ep suitable for detecting precocious Eimeria, the primer sequence is as follows (5′-3′): Ep-F: ATGCACAGACCCGACAAGACGG; Ep-R:TCAGTCAGCTTGCTCAGCGGGA; and / or, Primer pair Emwey suitable for detecting Eimeria maxima, the primer sequence is as follows (5′-3′): Emwey-F:ATGCCTATCACAGACCATGAAC; Emwey-R:TCAGTCGGCCTGTTCATCAGTA; and / or, Primer pair Eb suitable for detecting Eimeria brucei, the primer sequence is as follows (5′-3′): Eb-F:ATGCCGCCGGTTAACATCGAAG; Eb-R:TCAGTCTGCCTCTTGAGCGATA; and / or, Primer pair Em suitable for detecting Eimeria mitis, the primer sequence is as follows (5′-3′): Em-F: ATGCCGCCCCTAAATCTTGAC; Em-R:TCAGTCCACTTGTGTGCCGGT.

[0029] The present invention also provides a kit for detecting the maduramicin resistance of Eimeria, wherein the kit comprises the primer pair and is used for rapidly and accurately detecting whether chicken coccidia have maduramicin resistance.

[0030] Specifically, the kit can select a suitable primer pair according to the species of coccidia to be detected, and the kit also contains deionized water and PCR tubes. Other components such as DNA polymerase, marker, and loading buffer are commonly used laboratory reagents.

[0031] The present invention also provides a method for using the kit for detecting maduramicin resistance of Eimeria, comprising the steps of extracting cDNA of a sample of an insect strain to be tested by a conventional method, and performing PCR amplification using the kit using the extracted cDNA as a template, and judging the maduramicin resistance of the insect strain according to the PCR amplification result.

[0032] Specifically, in the detection method, the PCR reaction program is 95 °C for 3 min; 95 °C for 30 s, 55 °C for 30 s, 72 °C for 15 s, 30 cycles; 72 °C for 10 min.

[0033] The method for judging whether chicken coccidia are resistant to maduramicin according to the sequence of the PCR amplification product is as follows: if the nucleotide sequence corresponding to the 1255th position of the sequence shown in SEQ ID NO:1 in the amplification product is C, the chicken coccidia to be tested is a maduramicin-sensitive strain; if the nucleotide sequence corresponding to the 1255th position of the sequence shown in SEQ ID NO:1 in the amplification product is T, the chicken coccidia to be tested is a maduramicin-resistant strain.

[0034] The method for detecting maduramicin resistance of Eimeria provided by the invention is applicable to seven types of Eimeria, namely tender, toxic, pile-shaped, giant, precocious, Brucella and mild.

[0035] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0036] The instruments, equipment and reagents involved in the following examples include: PCR instrument, centrifuge, metal bath, 37 °C constant temperature shaker, 28 °C constant temperature shaker, gel electrophoresis instrument, and gel imager are conventional instruments and equipment; RNA extraction kit was purchased from Beijing Quanshijin Co., Ltd.; The reverse transcription kit was purchased from Novazon Biotech Co., Ltd.; pEASY-Blunt Simple Cloning Vector and competent cells Trans1-T1 were purchased from Beijing Quanshijin Biotechnology Co., Ltd.; DNA molecular standard marker was purchased from Beijing Adele Biotechnology Co., Ltd. Q5 high-fidelity DNA polymerase was purchased from NEB; Percoll was purchased from Cytiva; Glass beads were purchased from Sigma; CTAB digestion solution and TAE buffer were prepared according to conventional recipes.

[0037] Example 1 Construction of an Eimeria strain introgressing maduramycin-resistant gene This example uses Eimeria tenella as the research object, and uses genetic hybridization and backcrossing strategies to construct a drug-resistant gene introgression strain. The specific method is as follows: 1. Determination of the drug resistance of parental strains: The experiment was divided into two groups, each group included 5 coccidia-free AA broilers. The first group was inoculated with the laboratory-preserved drug-resistant strain of Eimeria tenella (MRR strain), and the second group was inoculated with the Houghton strain of Eimeria tenella (H strain). Each chicken was infected with 50,000 oocysts, and maduramicin (concentration of 5 ppm) was added to the feed. The drug was fed 2 days before inoculation. The feces were cleaned on the 5th day, and fresh feces from each group were collected every day from the 6th day to the 12th day according to the "five-point sampling method" and tested by saturated salt water flotation method. If the oocysts can be detected, the strain is determined to be resistant; if the oocysts cannot be detected, the strain is determined to be sensitive.

[0038] 2. Hybridization of resistant and sensitive parents: Inoculate three 3-week-old AA broilers with 500 fresh MRR strain oocysts and 5,000 fresh H strain oocysts. Collect fecal oocysts on days 6-9 and mark them as F1 generation. Infect three 4-week-old AA broilers with 10,000 F1 generation oocysts per chicken, add 5 ppm maduramicin to the feed, collect fecal oocysts on days 6-9 and mark them as F2 generation. F2 generation oocysts are resistant to maduramicin. The experiment was designed with three replicate groups.

[0039] 3. Backcrossing and selfing of hybrid offspring strains: Inoculate 500 F2 generation oocysts and 5,000 fresh H strain oocysts from 3 3-week-old AA broilers at the same time. Collect fecal oocysts from days 6-9 and record them as BC1F1 generation. Infect 3 4-week-old AA broilers with 10,000 BC1F1 generation oocysts per chicken, add 5 ppm maduramicin to the feed, collect fecal oocysts from days 6-9, and mark them as BC1F2 generation. Repeat the above backcrossing and selfing process twice to obtain drug-resistant gene introgression strains (F1, F2, BC1F1, BC1F2, BC2F1, BC2F2).

[0040] Example 2 Identification of SNP molecular markers associated with drug resistance 1. Preparation of DNA template: Collect and purify the oocysts of the maduramicin resistance gene introgression strain according to the laboratory standard operation. Add glass beads with a diameter of 1 mm to the oocyst suspension, fully crush it and centrifuge to retain the precipitate; add 500 mL CTAB lysis buffer and 40 μL proteinase K to the precipitate, blow off the precipitate, and place the centrifuge tube in a 55 ℃ metal bath for digestion for 2-3 h. After the suspension is restored to room temperature, add 20 μL RNase to the suspension, and place the centrifuge tube in a 37 ℃ metal bath for further digestion for 30 min. After returning to room temperature, add an equal volume of DNA extraction solution, shake the centrifuge tube vigorously, and take the upper aqueous phase after centrifugation. After transferring the liquid to a new centrifuge tube, add an equal volume of pre-cooled isopropanol, repeatedly invert and mix evenly, and let it stand in a -20 ℃ refrigerator for more than 30 minutes. Centrifuge at 4 ℃ to retain the precipitate, wash the precipitate twice with 75% ethanol, and add 50 ℃ preheated enzyme-free water to dissolve the DNA precipitate after sufficient evaporation. The DNA sample is stored at -80 ℃.

[0041] 2. Genome resequencing: The samples were commissioned to Beijing Novogene Technology Co., Ltd. for sequencing and library construction. The sequencing depth of a single sample was 100x. After the genomes of all the introgressed strains were extracted, the DNA samples were tested. After the test was qualified, they were randomly interrupted using a Covaris ultrasonic crusher, and then the entire library preparation was completed through end repair, A-tailing, sequencing adapters, purification, PCR amplification and other steps. After the library was constructed, Qubit 2.0 was used for preliminary quantification and library dilution, and then the insert fragments of the library were detected using Agilent 2100. After the insert fragment size met expectations, the effective concentration of the library was accurately quantified using the Q-PCR method to ensure the quality of the library. After the library was qualified, different libraries were pooled to flowcell according to the requirements of effective concentration and target data volume, and after cBOT clustering, Illumina high-throughput sequencing platform HiSeq PE150 was used for sequencing.

[0042] 3. Bioinformatics analysis: After filtering the data, quality control is performed, and high-quality clean reads are aligned to the reference genome to extract reliable SNP marker information. Set parameters, call SNPs and generate VCF files. Use the QTLseqr software package to perform ΔSNP-index analysis and locate candidate intervals of drug resistance genes on chromosomes ( Figure 1 ), and then the mutant genes in the interval were annotated using SnpEff software.

[0043] 4. Candidate gene PCR detection: To ensure the reliability of high-throughput sequencing results and avoid false positives caused by sequencing errors, high-fidelity DNA polymerase is used to amplify genes in the candidate interval. Prepare 1.0% agarose gel, set the electrophoresis conditions to 120 V voltage, and run the electrophoresis for 15 min. After the electrophoresis is completed, the results are observed using gel imaging ( Figure 2 ). The target band was cut from the gel, and the target band was recovered and purified using a DNA gel recovery kit, and the target band was connected to the pEASy-BluntSimple cloning Vector (purchased from Beijing Quanshijin Biotechnology Co., Ltd.). Subsequently, it was transformed into the competent cell Trans1-T1 (purchased from Beijing Quanshijin Biotechnology Co., Ltd.). After coating the ampicillin-resistant plate and culturing overnight, a single clone was picked for PCR identification, and the positive clone was selected and commissioned to Beijing Qingke Biotechnology Co., Ltd. for sequencing. The single clone with the correct sequencing result was selected by sequence comparison.

[0044] 5. Gene editing overexpression to verify the function of candidate genes: The anchored maduramicin resistance candidate gene was verified by overexpression strategy. An overexpression vector was constructed in vitro, and the 5'MIC2-DHFR-EYFP-3'Actin sequence fragment, 5'Actin fragment and 3'Actin-vector backbone fragment were amplified from the laboratory overexpression vector, and the candidate gene was amplified from the candidate gene T vector for multi-fragment connection. The bacterial liquid PCR positive single clone was picked and sequenced by Beijing Qingke Biological Co., Ltd. The sporozoites of the maduramicin sensitive insect strain of Eimeria tenella were extracted by Percoll method, and the constructed candidate gene linearized plasmids were transfected into the sporozoites respectively. The transfected sporozoites were inoculated into 1-week-old AA broilers through the cloaca, and the positive oocysts of mCherry after transfection were screened by flow cytometry. The flow cytometry oocyst sorting and passage process were repeated until the luminescence rate of the positive insect strain was greater than 90%. That is, the candidate gene overexpression strain was obtained. Specific primers were designed to identify the candidate gene overexpression strain.

[0045] Verify the function of candidate genes based on CRISPR / Cas9 gene replacement: construct a gene replacement framework in vitro, amplify the 5' and 3' homologous arms of the candidate gene from the genome of the drug-resistant strain, design gRNA for the candidate gene, amplify the U6 promoter, Scaffold sequence, mCherry fluorescent gene and 3'Actin fragment from the existing vectors in the laboratory, and connect multiple fragments to obtain a homologous recombination vector. Take the Cas9 basic strain of Eimeria tenella constructed in the early stage of the laboratory, extract the sporangium using the Percoll method, and transfect the homologous recombination vector into the sporangium. The transfection, positive strain screening and enrichment methods are the same as above. Design primers to amplify the 5' and 3' homologous regions respectively to perform PCR identification on the positive cloned strains.

[0046] Based on the above experimental results, coccidia ETH2_0402100 Mutations in this gene (Gene ID: 25249721) are associated with maduramicin resistance. ETH2_0402100 There is a SNP mutation at the 1255th nucleotide position of the gene. C at this position corresponds to the maduramicin-sensitive phenotype, and T corresponds to the maduramicin-resistant phenotype (Table 1).

[0047] Table 1 Sequence comparison results of sensitive and resistant strains

[0048] Example 3 Design of detection primers for SNP molecular markers associated with maduramicin resistance in Eimeria In this example, amplification primers are designed for the SNP sites found in Example 2.

[0049] Taking Eimeria tenella as an example, the present invention found that Eimeria tenella ETH2_ 0402100 The gene contains multiple intron sequences. In order to efficiently and specifically amplify the DNA fragment containing the above SNP site, the template used should be the reverse transcribed cDNA sample. Therefore, primers are subsequently designed for the cDNA sequence.

[0050] Will ETH2_0402100 After blast comparison of the gene sequence, it was found that the gene was relatively conserved among different species of Eimeria. Therefore, seven pairs of amplification primers for the gene of seven species of Eimeria were designed in this example, and Beijing Qingke Biotechnology Co., Ltd. was commissioned to synthesize the primers. The specific primer sequences are shown in Table 2.

[0051] Table 2 PCR amplification primers for seven chicken coccidia genes

[0052] According to the instructions of RNA extraction kit and reverse transcription kit, RNA of seven species of Eimeria were extracted and reverse transcribed into cDNA. Using cDNA as template, PCR amplification was performed using the primers in Table 2. The specific PCR reaction system and procedure are as follows: PCR reaction system: 1 μL each of upstream and downstream primers (10 μmol / L), 1 μL of cDNA template, 1uL of dNTP solution, 10 μL of 5× reaction buffer, 0.5 μL of Q5 enzyme (20 U / mL), and deionized water to make up to 50 μL system.

[0053] PCR reaction program: pre-denaturation at 98 °C for 30 s; denaturation at 98 °C for 15 s, annealing at 65 °C for 30 s, extension at 72 °C for 30 s, 35 cycles; final extension at 72 °C for 10 min.

[0054] After PCR amplification, target fragments of length shown in Table 2 can be obtained. The electrophoresis detection results of some amplified fragments are as follows: Figure 3 shown.

[0055] Example 4 Detection of Maduramicin Resistance in Mixed Chicken Coccidia Samples Collected in the Field Based on SNP Molecular Markers Fecal samples were randomly collected from 11 chicken farms in different counties of four cities in Zhejiang Province. Maduramicin resistance detection was performed using the maduramicin resistance SNP molecular markers involved in Example 2 and Example 3. The specific method is as follows: 1. Preparation of DNA template: The isolated field samples were orally inoculated into coccidia-free chickens. The feces were cleaned on the 5th day after inoculation, and the oocysts of 6-9 days were collected. The sporulation and purification processes were all performed according to laboratory standard operations. The subsequent preparation of DNA samples was referred to Example 2.

[0056] 2. PCR amplification system and reaction conditions Select ETH2_0402100 Specific primers FastNGS-F: 5'-GGTAGTTGGCAATTCCTTGAG-3', FastNGS-R: 5'-CTCCATCGATACCAGAGCAGTC-3' were designed for the fragment containing the mutation site of about 200-300 bp in the gene. The 5' end of the forward primer was added with the adapter primer read 1: 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-3', and the 5' end of the reverse primer was added with the adapter primer read 2: 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-3. The reaction system and procedure were the same as those in Example 3.

[0057] 3. PCR product sequencing The amplified PCR products were entrusted to Beijing Qingke Biotechnology Co., Ltd. for FastNGS amplicon sequencing.

[0058] 4. Bioinformatics Analysis After the DNA sample is tested, the PCR-free library is first constructed, and then the library is quality controlled. After the library is tested, the Illumina platform is used for sequencing. After the sequencing data quality is evaluated, data splicing is performed to detect short sequence SNP / Indel.

[0059] 5. Cage-feeding Experiment to Evaluate Drug Resistance Maduramicin 5 ppm was added to the feed two days before inoculation. Four field samples were selected and orally inoculated into chickens. The feces were cleaned on the 5th day after inoculation. The feces were collected by the "five-point sampling method" from the 6th to the 12th day and tested by the saturated saline flotation method. Microscopic examination was performed to determine whether oocysts were excreted and whether the samples had a Maduramicin resistance phenotype.

[0060] 6. Detection of Maduramicin Resistance SNP Sites The PCR products of the field samples were sequenced by FastNGS amplicon sequencing to detect short sequence SNPs. The results are shown in Table 3.

[0061] Table 3 Mutation frequency of target sites in field samples detected by amplicon sequencing

[0062] We collected chicken feces samples from 11 farms and extracted the coccidia genome for PCR amplification. The results showed that the target fragment could be amplified in 8 farms ( Figure 4 ). The PCR products of these eight fields were sequenced by FastNGS amplicon sequencing, and the results showed that maduramicin resistance gene mutations of different frequencies were detected in seven fields (Table 3), indicating that maduramicin resistance occurred in these seven fields.

[0063] At the same time, the maduramicin resistance of four field samples was evaluated through cage feeding experiments, and the results showed that all field mixed insect strains showed resistance to maduramicin. This result is completely consistent with the detection result based on SNP molecular markers, which further verifies the accuracy and reliability of the detection method of the present invention. Therefore, the PCR detection method based on SNP molecular markers provided by the present invention can accurately reflect whether the insect strain has a maduramicin resistance phenotype. This method is not only suitable for the detection of maduramicin resistance of purebred Eimeria tenella, but can also be effectively applied to the detection of clinical samples (mixed insect strains), showing wide applicability and clinical value.

[0064] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements can be made based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. A SNP molecular marker associated with maduramycin resistance in Eimeria, characterized in that: The SNP molecular marker contains a nucleotide sequence in which the polymorphism at position 1255 is C / T as shown in SEQ ID NO: 1; Among them, the polymorphic site of the SNP molecular marker is C, corresponding to maduramicin sensitive insect strains, and the polymorphic site is T, corresponding to maduramicin resistant insect strains.

2. A primer pair for amplifying the SNP molecular marker according to claim 1, characterized in that: include: (1) Primer pairs Et suitable for detecting Eimeria tenella include: Et-F: ATGCCGACTTCCACGCTAGGC; Et-R:TCAGTCTGCTGTTGGCCCATC; and / or, (2) Primer pairs En suitable for detecting Eimeria toxicans, specifically including: En-F: ATGCAGACTTCCACGCTAGGGCC; En-R:TCAGTCTGCTGTTGACCCATCA; and / or, (3) Primer pairs Ea suitable for detecting Eimeria acervulina include: Ea-F: ATGGACCCAATGCCTCTCCGG; Ea-R: CTAATGATCGATTCTCTTAAC; and / or, (4) Primer pairs Ep suitable for detecting Eimeria precocidia include: Ep-F: ATGCACAGACCCGACAAGACGG; Ep-R:TCAGTCAGCTTGCTCAGCGGGA; and / or, (5) Primer pairs Emwey suitable for detecting Eimeria maxima, specifically including: Emwey-F:ATGCCTATCACAGACCATGAAC; Emwey-R:TCAGTCGGCCTGTTCATCAGTA; and / or, (6) Primer pairs Eb suitable for detecting Eimeria brucei, specifically including: Eb-F:ATGCCGCCGGTTAACATCGAAG; Eb-R:TCAGTCTGCCTCTTGAGCGATA; and / or, (7) Primer pairs Em suitable for detecting Eimeria mitis, specifically comprising: Em-F: ATGCCGCCCCTAAATCTTGAC; Em-R: TCAGTCCACTTGTGTGCCGGT.

3. A detection reagent or kit containing the primer pair according to claim 2.

4. A method for identifying maduramicin resistance of Eimeria, characterized in that: The method comprises: extracting RNA of the Eimeria to be tested, reverse transcribing it into cDNA, and then using the cDNA as a template to perform PCR amplification using the primer pair of claim 2 or the detection reagent or kit of claim 3, and judging the maduramicin resistance of the Eimeria to be tested according to the PCR amplification result; The method is for non-disease diagnosis and treatment purposes.

5. The method according to claim 4, characterized in that The reaction program of the PCR amplification was: 95 °C for 3 min; 95 °C for 30 s, 55 °C for 30 s, 72 °C for 15 s, 30 cycles; 72 °C for 10 min.

6. The method according to claim 4 or 5, characterized in that: The method for judging the maduramicin resistance of the Eimeria to be tested comprises: analyzing the single nucleotide polymorphism of the SNP molecular marker of claim 1 in the PCR amplification product, and judging whether the Eimeria to be tested is a resistant or sensitive phenotype according to the polymorphic site.

7. The method according to claim 6, characterized in that If the base of the polymorphic site of the SNP molecular marker is C, the Eimeria to be tested is a maduramicin sensitive phenotype; if the base of the polymorphic site of the SNP molecular marker is T, the Eimeria to be tested is a maduramicin resistant phenotype.

8. Use of the SNP molecular marker according to claim 1, the primer pair according to claim 2, or the detection reagent or kit according to claim 3 in screening for maduramicin-resistant strains of chicken coccidia; The applications are for non-disease diagnosis and treatment purposes.

Images