Molecular marker for identifying or assisting in identifying sedimentation value of wheat flour and application of molecular marker

Abstract

The invention discloses a molecular marker for identifying or assisting in identifying a wheat flour sedimentation value and application of the molecular marker, and particularly discloses application of a substance for detecting polymorphism or genotype of SNP1 in a wheat genome in identifying or assisting in identifying the wheat flour sedimentation value. The SNP1 is an SNP site in a wheat genome, the nucleotide variety of the SNP1 is C or T, and the SNP1 is represented by Y and is the 1557th nucleotide of SEQ ID No.1. A dCAPS marker is developed by utilizing an SNP1 site, and 130 parts of wheat materials are scanned. Correlation analysis is carried out on phenotypic data of the genotype and the sedimentation value, it is found that the marker is remarkably related to the sedimentation value of wheat flour, and it is indicated that the marker is a molecular marker for effectively screening wheat with different sedimentation values. The dCAPS marker is good in repeatability, convenient to detect and low in cost, and has a better application prospect in molecular marker-assisted selection and molecular design breeding for improving the quality of wheat.

Description

Technical Field

[0001] The invention relates to a molecular marker for identifying or assisting in identifying the sedimentation value of wheat flour in the field of biotechnology and an application thereof. Background Art

[0002] Wheat is an important food crop. With the improvement of people's living standards, their diet has become more colorful, and the requirements for the quality of wheat are also increasing. The goal of wheat breeding has changed from high yield to high yield and high quality. How to further improve the quality of wheat under the premise of high yield is an urgent problem to be solved in current breeding.

[0003] Wheat quality can be divided into nutritional quality and processing quality. Among them, edible quality in processing quality is the main focus of wheat quality breeding. Wheat edible quality is mainly related to the physical and chemical properties of dough, which can be measured by multiple parameters such as SDS-sedimentation value (SDS-SV), gluten content, tensile area, and stability time. SDS-SV is significantly correlated with the baking quality of wheat flour and is an important indicator for evaluating flour protein quality (Axford et al. 1979). Past studies have found that SDS-SV of wheat flour is controlled by multiple genes. Conti et al. found that Glu-B1 is a stable site that controls SDS-SV (Conti et al. 2011). The SDS-sedimentation value of the high molecular weight glutenin subunit gene Glu-A1 loss-of-function mutant is significantly reduced (Yang et al. 2014). The alleles Glu-1 of wheat high molecular weight glutenin subunit (HMW-GS) and Glu-3 of low molecular weight glutenin subunit (LMW-GS) have important control effects on sedimentation value, and 1BL / 1RS translocation has a significant negative effect on SDS sedimentation value (Liu Li et al., 2004). The allele variation of Pinb-D1b gene that controls hardness in wheat positively regulates SDS-SV (Würschum et al. 2016). In addition, the team led by Yao Yingyin of China Agricultural University used the near-isogenic line population constructed by the low SDS-SV parent ND3331 and the high SDS-SV parent Zang1817 to identify 10 QTLs controlling SDS-SV. Among them, the effects of 4 major loci on SDS-SV were related to high molecular weight glutenin subunit 1Ax1, 1B / 1R ectopic lines, Pina-D1 and Pinb-D1. It was found that Pinb-D1p carried by Zang1817 was an excellent allele of high SDS-SV (Changet al. 2022). As mentioned in the review, SDS-SV is mainly regulated by wheat quality genes. Therefore, the excavation and utilization of genes controlling wheat SDS-SV not only provides new gene resources for molecular marker-assisted breeding and transgenic breeding, but also helps to improve the speed and level of wheat quality breeding, which is of great significance for high-yield and high-quality wheat breeding.

[0004] References

[0005] 1. Liu Li, Zhou Yang, He Zhonghu, et al. (2004) Effects of Glu-1 and Glu3 allelic variation on wheat processing varieties. Acta Agronomica Sinica, 30:959-968.

[0006] 2. Axford DEW, Mcdermott EE, Redman DG. (1979) Note on sodium dodecylsulfate test of breadmaking quality; comparison with pelshenke and zelenytest. Cereal Chem, 56:582–584.

[0007] 3. Chang SY, Chen Q, Yang T, et al. (2022) Pinb-D1p is an elite allele for improving end-use quality in wheat (Triticum aestivum L.). Theor Appl Genet, 135:4469–4481.

[0008] 4. Conti V, Roncallo PF, Beaufort V, et al. (2011) Mapping of main and epistatic effect QTLs associated to grain protein and gluten strength using aRIL population of durum wheat. J Appl Genet, 52:287–298.

[0009] 5. Würschum T, Leiser WL, Kazman E, et al. (2016) Genetic control of protein content and sedimentation volume in European winter wheatcultivars. Theor Appl Genet, 129:1685–1696

[0010] 6. Yang Y, Li S, Zhang K, et al. (2014) Efficient isolation of ionbeaminduced mutants for homoeologous lociin common wheat and comparison of the contributions of Glu-1loci to gluten functionality. Theor Appl Genet, 127:359–372. Summary of the invention

[0011] The technical problem to be solved by the invention is how to identify the sedimentation value of wheat flour.

[0012] In order to solve the above technical problems, the present invention provides any application of the following A1-A3 and the method of A4:

[0013] A1. Use of a substance for detecting the polymorphism or genotype (i.e., allele) of SNP1 in a wheat genome in identifying or assisting in identifying the sedimentation value of wheat flour; the SNP1 is a SNP site in the wheat genome, the nucleotide type of which is C or T, represented by Y, and is the 1557th nucleotide of SEQ ID No.1;

[0014] A2. Use of a substance for detecting the polymorphism or genotype (i.e., allele) of SNP1 in the wheat genome in the preparation of a product for identifying or assisting in identifying the sedimentation value of wheat flour; the SNP1 is a SNP site in the wheat genome, the nucleotide type of which is C or T, represented by Y, and is the 1557th nucleotide of SEQ ID No.1;

[0015] A3. Use of a substance for detecting the polymorphism or genotype (i.e., allele) of the SNP1 in the wheat genome in wheat breeding or in the preparation of wheat breeding products; the SNP1 is a SNP site in the wheat genome, its nucleotide type is C or T, represented by Y, and is the 1557th nucleotide of SEQ ID No.1.

[0016] The breeding objectives include breeding wheat with high flour sedimentation value or low flour sedimentation value.

[0017] A4. A method for identifying or assisting in identifying the sedimentation value of wheat flour, comprising detecting the genotype of the wheat to be tested, and identifying or assisting in identifying the sedimentation value of the wheat flour according to the genotype of the wheat to be tested; the genotype is the genotype of SNP1 in the wheat genome; the SNP1 is a SNP site in the wheat genome, the nucleotide type of which is C or T, represented by Y, and is the 1557th nucleotide of SEQ ID No.1.

[0018] The wheat flour sedimentation value may be an SDS-sedimentation value.

[0019] In the method described in A4, the sedimentation value of wheat flour identified or assisted in identification based on the genotype of the wheat to be tested may be that the sedimentation value of the wheat flour to be tested with a genotype of TT is higher or is a candidate higher than the sedimentation value of the wheat flour to be tested with a genotype of CC.

[0020] Another technical problem to be solved by the present invention is how to carry out wheat breeding.

[0021] In order to solve the above technical problems, the present invention provides the following technical solutions:

[0022] Application of the methods described in B1 and A4 in wheat breeding.

[0023] The breeding objectives include breeding wheat with high SDS-sedimentation values.

[0024] B2. A method for wheat breeding, comprising: detecting the polymorphism of the SNP1 in the wheat genome, and selecting wheat in which the SNP1 in the wheat genome is homozygous for TT as a parent for breeding; the purpose of the breeding includes breeding wheat with a high SDS-sedimentation value.

[0025] Any of the following products C1-C3 containing a composition for detecting the polymorphism or genotype (ie, allele) of SNP1 in the wheat genome also falls within the scope of protection of the present invention:

[0026] C1. Products for detecting single nucleotide polymorphisms or genotypes associated with wheat flour sedimentation value;

[0027] C2. Products that identify or assist in identifying the sedimentation value of wheat flour;

[0028] C3. Products used for wheat breeding.

[0029] In the above applications, methods and products, the SNP1 is a SNP site in the wheat genome, and its nucleotide type is C or T, represented by Y, which is the 1557th nucleotide of SEQ ID No.1. The polymorphism or genotype (i.e., allele) of the SNP1 in the wheat genome can be specifically the nucleotide type of the SNP1. The genotype of the SNP1 in the wheat genome can be CC or TT. The CC is the homozygous type of the SNP1 in the wheat genome being C, and the TT is the homozygous type of the SNP1 in the wheat genome being T.

[0030] In the above applications, methods and products, the breeding objectives of the breeding include wheat flour sedimentation value, and specifically the wheat breeding can be to cultivate wheat varieties with high wheat flour sedimentation value.

[0031] In the above applications, methods and products, the composition for detecting the polymorphism or genotype (i.e., allele) of SNP1 in the wheat genome can be a reagent and / or instrument required for determining the polymorphism or genotype of SNP1 by at least one of the following methods: DNA sequencing, restriction fragment length polymorphism, single-strand conformation polymorphism, denaturing high performance liquid chromatography and SNP chip. Among them, the SNP chip includes a chip based on nucleic acid hybridization reaction, a chip based on single base extension reaction, a chip based on allele-specific primer extension reaction, a chip based on "one-step" reaction, a chip based on primer ligation reaction, a chip based on restriction endonuclease reaction, a chip based on protein DNA binding reaction, and a chip based on fluorescent molecule DNA binding reaction.

[0032] In the above applications, methods and products, the composition for detecting the polymorphism or genotype (i.e., allele) of SNP1 in the wheat genome is any one of the following D1-D6:

[0033] D1, containing a PCR primer pair P1 and XbaI enzyme for amplifying a wheat genomic DNA fragment including the SNP1 and replacing the A at position 1555 of SEQ ID No.1 in the amplified product with T;

[0034] D2, a PCR reagent containing the PCR primer pair P1 described in D1 and XbaI enzyme;

[0035] D3, a kit containing the PCR primer pair P1 described in D1 or the PCR reagent described in D2 and XbaI enzyme;

[0036] D4, containing a PCR primer pair P2 for amplifying a wheat genomic DNA fragment including the SNP1; D5, a PCR reagent containing the PCR primer pair P2 described in D4;

[0037] D3. A kit containing the PCR primer pair P2 described in D4 or the PCR reagent described in D5.

[0038] In the above applications, methods and products, the PCR primer pair P1 may be a primer pair consisting of a single-stranded DNA having a nucleotide sequence of SEQ ID No.2 and a single-stranded DNA having a nucleotide sequence of SEQ ID No.3.

[0039] In the above applications, methods and products, the PCR primer pair P2 may be a primer pair consisting of a single-stranded DNA having a nucleotide sequence of SEQ ID No.4 and a single-stranded DNA having a nucleotide sequence of SEQ ID No.5.

[0040] In the above applications, methods and products, the product may be a reagent or a kit or a system, and the system may include a combination product of a reagent or a kit, an instrument and analysis software.

[0041] The present invention also protects a DNA molecule whose nucleotide sequence is SEQ ID No.1.

[0042] The present invention is based on population genetics and association analysis, and a gene that controls the sedimentation value of wheat flour is identified in a natural population through genome-wide association analysis (GWAS). By analyzing the polymorphism of the gene and the promoter region sequence in different wheat materials, a SNP site (C / T) is identified at -444bp in its promoter region. The dCAPS marker is developed using the SNP site, and 130 wheat materials are scanned. The genotype and the phenotypic data of the sedimentation value are subjected to association analysis, and it is found that the marker is significantly correlated with the sedimentation value of wheat flour, indicating that the marker is an effective molecular marker for screening wheat with different sedimentation values. The dCAPS marker has good repeatability, convenient detection, low cost, and has good application prospects in molecular marker-assisted selection and molecular design breeding for improving wheat quality. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 The present invention provides the gene controlling the sedimentation value of wheat flour and the mutation site information and marker development results of its 2kb promoter region in Example 1 of the present invention. Figure 1 The upper part shows the variation information of the gene and its 2 kb promoter region; Figure 1 The lower part shows the development and verification of dCAPS markers, where the boxed T in Hap_C (nucleotide type is C) and Hap_T (nucleotide type is T) indicates the introduced variant site, the arrow points to the SNP site of the present invention, and the XbaI restriction site is underlined. Lanes 1-8 are: Jimai 22, Shi 4185, Beijing 8, Xiaoyan 6, Chuanmai 42, Zhoumai 22, Xinong 6028, Jinmai 47; Lanes 9-16 are: Zhengmai 366, Lumai 15, Jimai 20, Wenmai 6, Lumai 14, Yumai 41, Zhongmai 175, Yannong 19.

[0044] Figure 2 This is the result of SNP-444 marker association analysis of 130 wheat varieties in Example 1 of the present invention. The mean sedimentation value of the material with nucleotide type T (Hap_T) is significantly higher than that of the material with nucleotide type C (Hap_C). Capital letters indicate P<0.05. DETAILED DESCRIPTION

[0045] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0046] The experimental methods in the following examples are all conventional methods unless otherwise specified.

[0047] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0048] Example 1. Development of SNP markers

[0049] 16 wheat materials with known genotypes from different ecological zones (Jimai 22, Shi 4185, Beijing 8, Xiaoyan 6, Chuanmai 42, Zhoumai 22, Xinong 6028, Jinmai 47, Zhengmai 366, Lumai 15, Jimai 20, Wenmai 6, Lumai 14, Yumai 41, Zhongmai 175, Yannong 19) were selected for target gene fragment amplification and first-generation sequencing. The specific primers for the gene and promoter region that control the sedimentation value of wheat flour consisted of MYB44-DF and MYB44-DR:

[0050] F: 5'-AGCCTCCAATTCAATGATGCTAGTG-3' (as shown in SEQ ID No. 4, which is identical to the sequence of positions 1469-1493 of SEQ ID No. 1);

[0051] R: 5'-CCTCGTCTCCGGCCAGAAAT-3' (as shown in SEQ ID No. 5).

[0052] The experiment used La-Taq enzyme, the concentration of template DNA (16 genomic DNAs of wheat materials with known genotypes were used as template DNA) was uniformly adjusted to 50 ng / μL, and the PCR amplification system was as follows:

[0053] Table 1 The first round of PCR amplification system

[0054] system content DNA 50ng La-Taq 0.1μL 2×GC buffer 5μL Upstream primer (10 μM) 0.25μL Downstream primer (10 μM) 0.25μL <![CDATA[ddH 2 The]]> Make up to 10 μL

[0055] The PCR amplification procedure was as follows: denaturation at 95°C for 3 min; denaturation at 95°C for 30 sec, annealing at 61°C for 30 sec, and extension at 72°C (1 kb min -1 ), 30 cycles; 72°C extension for 5 min, and 12°C reaction termination.

[0056] The amplified product is 1480 bp, which is the first round PCR product.

[0057] The sequencing results were spliced ​​and aligned, and the sequence variation information of the gene coding region and the upstream 2kb promoter region in 16 wheat materials with known genotypes was analyzed. Combined with the published wheat pan-genome data, detailed SNP site information was obtained, and it was found that there was only one SNP site in the promoter region. The SNP corresponds to a gene coding region and the upstream 2kb promoter region of the Chinese Spring genome at -444, called SNP1, and its nucleotide is C or T, represented by Y, corresponding to the 1557th position of SEQ ID No.1 in the sequence table. SEQ ID No.1 is the nucleotide sequence of the upstream 2kb of the gene coding region, and its ATG at positions 2001-2003 represents the start codon of the gene coding region that controls the sedimentation value of wheat flour.

[0058] SEQ ID No.1:

[0059]

[0060] A dCAPS marker was developed for this SNP locus and named SNP-444. Figure 1 , a single base T mutation needs to be introduced upstream of the SNP site to form the recognition site "TCTAGA" of the endonuclease XbaI. For this purpose, the dCAPS marker primers of SNP-444 were designed, consisting of SNP_-444-XbaI-F and SNP_-444-XbaI-R. The bases marked in italics are the introduced mutation sites:

[0061] SNP_-444-XbaI-F: GTTAATTTTACAGCTAGTGGTGATC (as shown in SEQ ID No. 2, combined with positions 1532-1556 of SEQ ID No. 1, and the A corresponding to position 1555 of SEQ ID No. 1 in the amplified product is replaced by T);

[0062] SNP_-444-XbaI-R: AGCAGGCATATGATCCATCTATA (as shown in SEQ ID No. 3, reverse complementary to positions 1634-1656 of SEQ ID No. 1).

[0063] Second round of PCR amplification: dilute the first round of PCR products 10 times, the primer pair consists of SNP_-444-XbaI-F and SNP_-444-XbaI-R, and then use 2×Mix for the second round of PCR amplification. The system is shown in Table 2:

[0064] Table 2 Second round PCR amplification system

[0065] system content First round PCR dilution product 1μL 2×Mix 5μL Upstream primer (10 μM) 0.2μL Downstream primer (10 μM) 0.2μL <![CDATA[ddH 2 The]]> 3.6μL

[0066] The PCR amplification program was as follows: denaturation at 95°C for 3 min; denaturation at 95°C for 30 sec, annealing at 56°C for 30 sec, extension at 72°C for 10 sec, 35 cycles; extension at 72°C for 5 min, and termination of the reaction at 12°C.

[0067] The amplified product is the sequence of positions 1532-1656 of SEQ ID No.1, wherein the A corresponding to position 1555 of SEQ ID No.1 is replaced by T.

[0068] The second round of amplification products were subjected to restriction digestion reaction: XbaI single digestion was used, and the reaction system is shown in Table 3:

[0069] Table 3 Enzyme digestion system

[0070]

[0071]

[0072] Reaction procedure: 37℃ constant temperature water bath, enzyme digestion for 4h.

[0073] Agarose gel electrophoresis: The digested products were electrophoresed on 3% agarose gel, and then photographed and the genotype of the material was determined based on the band type. The results are shown in Figure 1 In the band, the second-round amplification product of the material whose nucleotide of the SNP is T has the XbaI enzyme recognition site "TCTAGA" and is cut to form two bands, while the second-round PCR product of the material whose nucleotide of the SNP is C does not have the XbaI enzyme recognition site and cannot be cut, thereby distinguishing the two allelic variations.

[0074] Example 2: Functional verification of SNP-444

[0075] The function of SNP-444 was verified using 130 wheat natural population materials in Table 4 (the genotype of the SNP site was homozygous). Specifically, a primer pair consisting of MYB44-DF and MYB44-DR and a primer pair consisting of SNP_-444-XbaI-F and SNP_-444-XbaI-R were used. Two rounds of PCR amplification (refer to the two-round PCR amplification system and reaction procedure in Example 1) were used to extract genomic DNA from the wheat materials. The amplified products were subjected to single enzyme digestion with XbaI enzyme and then electrophoresed on 3% agarose gel. The second-round amplification products of the materials whose nucleotide of the SNP is T have the XbaI enzyme recognition site "TCTAGA" and are cut to form two bands, while the second-round PCR products of the materials whose nucleotide of the SNP is C have no XbaI enzyme recognition site and cannot be cut, thereby distinguishing the two allelic variations.

[0076] Flour Sedimentation Value (SDS-SV): Sodium dodecyl sulfate-sedimentation value.

[0077] The flour sedimentation values ​​(SDS-SV) of the 130 portions of wheat in Table 4 were determined as follows:

[0078] 1) Preparation of SDS-lactic acid mixed solution: weigh 20g SDS, put it into a beaker, add 20mL lactic acid solution (lactic acid: water = 1:8), dilute to 1L with pure water, mix thoroughly and set aside.

[0079] 2) Bromophenol blue solution: Add 50 mg of bromophenol blue to 1 L of pure water and mix thoroughly for later use.

[0080] 3) Take 20g of wheat grains and grind them into whole wheat flour using a grinder.

[0081] 4) Weigh 2 g into a 35 mL measuring cylinder, add 16.7 mL of 10 mg / kg bromophenol blue solution, and shake for 5 minutes.

[0082] Three replicates were performed for each material.

[0083] 5) Add 16.7 mL of lactic acid-SDS working solution, shake on a shaker for 5 minutes, then stand upright for 5 minutes and read the volume of the sediment.

[0084] 6) The results are calculated based on a flour moisture content of 14% (m / m) using the following formula:

[0085] Sedimentation value (mL) = measured value (100-14) / (100-sample moisture %)

[0086] The differentiation results were combined with the flour sedimentation value (SDS-SV) data of Shunyi in 2019 for correlation analysis, see Table 4:

[0087] Table 4 Nucleotide type information of 130 wheat samples

[0088]

[0089]

[0090] The genotype of nucleotide type T is the homozygous type of SNP1 being T, that is, TT, and the genotype of nucleotide type C is the homozygous type of SNP1 being C, that is, CC.

[0091] The 130 wheat materials in the table are from the National Crop Germplasm Resources Platform (https: / / www.cgris.net / query / croplist.php#).

[0092] There are two genotypes of SNP sites in the test results, namely CC or TT (no heterozygous type): genotype CC is the homozygous type of SNP C, its nucleotide type is C (Hap_C), and it is a low flour sedimentation value type (the average SDS-sedimentation value is low); genotype TT is the homozygous type of SNP T, its nucleotide type is T (Hap_T), and it is a high flour sedimentation value type (the average SDS-sedimentation value is high).

[0093] The statistical results showed that the average sedimentation value of the material with nucleotide type C (Hap_C) was 20.034 mL, while the average sedimentation value of the material with nucleotide type T (Hap_T) was 21.757 mL, reaching a significant difference level (P = 0.036) (see Figure 2 ). The above results show the effectiveness of the marker and it can be used as a functional marker for screening the sedimentation value of wheat flour.

[0094] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. Application of a substance for detecting the polymorphism or genotype of SNP1 in the wheat genome in identifying or assisting in identifying the sedimentation value of wheat flour; the SNP1 is a SNP site in the wheat genome, the nucleotide type of which is C or T, represented by Y, and is the 1557th nucleotide of SEQ ID No.

1.

2. Application of a substance for detecting the polymorphism or genotype of SNP1 in the wheat genome in the preparation of a product for identifying or assisting in identifying the sedimentation value of wheat flour; the SNP1 is a SNP site in the wheat genome, the nucleotide type of which is C or T, represented by Y, and is the 1557th nucleotide of SEQ ID No.

1.

3. Application of a substance for detecting the polymorphism or genotype of the SNP1 in the wheat genome in wheat breeding or in the preparation of wheat breeding products; the SNP1 is a SNP site in the wheat genome, its nucleotide type is C or T, represented by Y, and is the 1557th nucleotide of SEQ ID No.

1.

4. A method for identifying or assisting in identifying the sedimentation value of wheat flour, characterized in that: The method comprises detecting the genotype of the wheat to be tested, and identifying or assisting in identifying the sedimentation value of wheat flour according to the genotype of the wheat to be tested; the genotype is the genotype of SNP1 in the wheat genome; the SNP1 is a SNP site in the wheat genome, the nucleotide type of which is C or T, represented by Y, and is the 1557th nucleotide of SEQID No.

1.

5. Application of the method according to claim 4 in wheat breeding.

6. A product containing the substance for detecting the polymorphism or genotype of SNP1 in the wheat genome as claimed in claim 1, wherein the product is any one of C1-C3: C1. Products for detecting single nucleotide polymorphisms or genotypes associated with wheat flour sedimentation value; C2. Products that identify or assist in identifying the sedimentation value of wheat flour; C3. Products used for wheat breeding.

7. The use according to any one of claims 1 to 3 and 5, the method according to claim 4 or the product according to claim 6, characterized in that: The wheat breeding is to cultivate wheat with high wheat flour sedimentation value or low wheat flour sedimentation value.

8. The use according to any one of claims 1 to 3, 5 and 7, the method according to claim 4 or 7 or the product according to claim 6 or 8, characterized in that: The substance for detecting the polymorphism or genotype of SNP1 in the wheat genome is any one of the following D1-D6: D1, containing a PCR primer pair P1 and XbaI enzyme for amplifying a wheat genomic DNA fragment including the SNP1 and replacing the A at position 1555 of SEQ ID No. 1 in the amplified product with T; D2, a PCR reagent containing the PCR primer pair P1 described in D1 and XbaI enzyme; D3, a kit containing the PCR primer pair P1 described in D1 or the PCR reagent described in D2 and XbaI enzyme; D4, containing a PCR primer pair P2 for amplifying a wheat genomic DNA fragment including the SNP1; D5, a PCR reagent containing the PCR primer pair P2 described in D4; D3. A kit containing the PCR primer pair P2 described in D4 or the PCR reagent described in D5.

9. The nucleotide sequence is a DNA molecule of SEQ ID No.1.

Images