Application of a Pto-C3H35 gene haplotype in evaluating the lignin content of poplars

Abstract

The present invention provides an application of a Pto-C3H35 gene haplotype in evaluating the lignin content of poplars, belonging to the field of molecular marker technology. The Pto-C3H35 gene haplotype described in the present invention is determined based on the nucleotides of SNP1, InDel1, InDel2, InDel3 and SNP2. The present invention provides a primer set and a kit for determining the gene haplotype, as well as a method for determining the gene haplotype. By determining the genotype combination of the above five sites, the lignin content of the poplar can be accurately judged, and excellent plants with low lignin content can be accurately and efficiently screened in the early growth stage of the poplar. The system is applied to the breeding of new varieties of industrial timber poplar plantations, effectively shortening the breeding cycle.

Description

Technical Field

[0001] The invention provides an application of a Pto-C3H35 gene haplotype in evaluating the lignin content of poplars, belonging to the technical field of molecular markers. Background Art

[0002] Populus tomentosa is a native tree species unique to my country, widely distributed in the Yellow River Basin and the North China Plain. With its tall trunk, rapid growth, high-quality wood, drought resistance, and strong environmental adaptability, Populus tomentosa is a major fast-growing timber and landscaping species in northern my country, and an excellent afforestation species. Furthermore, Populus tomentosa wood is of excellent quality, making it an ideal raw material for papermaking in my country. Lignin, a major component of wood, is tightly cross-linked with cellulose and hemicellulose in secondary cell walls, preventing the release and utilization of wood fibers. Therefore, reducing lignin content is an effective strategy for increasing the industrial value of wood products.

[0003] Caffeic acid is a key metabolite in the lignin biosynthesis pathway. It is a universal precursor for the synthesis of three lignin monomers and a crucial hub for directing carbon flow from the common phenylpropanoid pathway to the specific lignin biosynthesis pathway. Therefore, caffeic acid can be used as an important metabolic indicator for evaluating lignin content. In the traditional breeding process of new poplar varieties, the selection of low-lignin poplar varieties can only be achieved through destructive xylem sampling and phenotyping. However, destructive sampling can cause damage to the plant's xylem, especially in young poplars, resulting in slowed growth and even death. Therefore, in the breeding process of new varieties, it is difficult to select Populus tomentosa lignin content characteristics using traditional physiological and biochemical methods during the early growth stages of poplars.

[0004] With the continuous advancement of modern molecular breeding technology, the development of key molecular markers related to lignin and the identification of the genetic effects of their combination on tree lignin have made it possible to quickly and accurately screen new forest tree varieties with low lignin content. This technology has important application prospects in the assessment of wood quality in the seedling stage, but currently little research is conducted in this area. Summary of the Invention

[0005] The present invention provides an application of a Pto-C3H35 gene haplotype in evaluating the lignin content of poplars, which can quickly screen poplar varieties with target lignin content.

[0006] The present invention provides a primer set for detecting the lignin content of poplars, including a primer set for detecting the haplotype of the Pto-C3H35 gene of poplars;

[0007] The nucleotide sequence of the Pto-C3H35 gene is shown in SEQ ID No. 1.

[0008] Preferably, the Pto-C3H35 gene haplotype is determined based on the nucleotides of SNP1, InDel1, InDel2, InDel3 and SNP2;

[0009] The SNP1 is SEQ ID No. 1, wherein the nucleotide at position 702 is T or G;

[0010] The InDel1 is SEQ ID No. 1, wherein the nucleotide at position 705 is CA or lacks CA;

[0011] The InDel2 is SEQ ID No. 1, wherein the nucleotide at position 708 is TTAGAA or TTAGAA is missing;

[0012] The InDel3 is SEQ ID No. 1, wherein the nucleotide at position 718 is A or lacks A;

[0013] The SNP2 is SEQ ID No. 1, and the nucleotide at position 768 is T or C.

[0014] Preferably, the primer set for detecting the SNP1, InDel1, InDel2 and InDel3 genotypes of the Pto-C3H35 gene includes Pto-C3H35-702-TF, Pto-C3H35-702-GF and Pto-C3H35-702-R, and the nucleotide sequences are shown in SEQ ID No. 2 to SEQ ID No. 4, respectively;

[0015] The primer set for detecting the SNP2 genotype includes Pto-C3H35-768-TF, Pto-C3H35-768-CF and Pto-C3H35-768-R, and the nucleotide sequences are shown in SEQ ID No. 5 to SEQ ID No. 7, respectively.

[0016] The present invention provides a kit for detecting the lignin content of poplar, comprising the above primer set.

[0017] The present invention provides a method for detecting the lignin content of poplars, comprising using poplar genomic DNA as a template, performing PCR amplification using the above primer set or the primer set in the above kit, and evaluating the lignin content of the poplars according to the genotype of the amplified product.

[0018] Preferably, if an amplification product is obtained when Pto-C3H35-702-TF and Pto-C3H35-702-R are subjected to PCR amplification, an amplification product is not obtained when Pto-C3H35-702-GF and Pto-C3H35-702-R are subjected to PCR amplification, an amplification product is obtained when Pto-C3H35-768-TF and Pto-C3H35-768-R are subjected to PCR amplification, and no amplification product is obtained when Pto-C3H35-768-CF and Pto-C3H35-768-R are subjected to PCR amplification, then the genotype combination of the sample is TT-D1D1-I2I2-I3I3-TT;

[0019] If PCR amplification products are obtained from Pto-C3H35-702-TF and Pto-C3H35-702-R, no amplification products are obtained from Pto-C3H35-702-GF and Pto-C3H35-702-R, no amplification products are obtained from Pto-C3H35-768-TF and Pto-C3H35-768-R, and amplification products are obtained from Pto-C3H35-768-CF and Pto-C3H35-768-R, then the genotype combination of the sample is TT-D1D1-I2I2-D3D3-CC;

[0020] If no amplification product is obtained when PCR amplification is performed on Pto-C3H35-702-TF and Pto-C3H35-702-R, an amplification product is obtained when PCR amplification is performed on Pto-C3H35-702-GF and Pto-C3H35-702-R, an amplification product is obtained when PCR amplification is performed on Pto-C3H35-768-TF and Pto-C3H35-768-R, and no amplification product is obtained when PCR amplification is performed on Pto-C3H35-768-CF and Pto-C3H35-768-R, then the genotype combination of the sample is GG-I1I1-D2D2-I3I3-TT;

[0021] If an amplification product is obtained when Pto-C3H35-702-TF and Pto-C3H35-702-R are subjected to PCR amplification, an amplification product is obtained when Pto-C3H35-702-GF and Pto-C3H35-702-R are subjected to PCR amplification, an amplification product is obtained when Pto-C3H35-768-TF and Pto-C3H35-768-R are subjected to PCR amplification, and no amplification product is obtained when Pto-C3H35-768-CF and Pto-C3H35-768-R are subjected to PCR amplification, then the genotype combination of the sample is TG-D1I1-D2I2-D3I3-TT.

[0022] Preferably, when the genotype combination is GG-I1I1-D2D2-I3I3-TT, the poplar has a low lignin content.

[0023] Preferably, when the genotype combination is TT-D1D1-I2I2-D3D3-CC, the poplar has a high lignin content.

[0024] Preferably, the PCR amplification procedure includes: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 58°C for 15 s, and extension at 72°C for 45 s, for 34 cycles; and complete extension at 72°C for 5 min.

[0025] The present invention also provides application of the primer set, the kit or the method in molecular marker-assisted breeding of poplars.

[0026] Beneficial effect: The present invention provides a method for evaluating the haplotype of the Pto-C3H35 gene, and an application of evaluating poplar lignin based on the method, wherein the nucleotide sequence of the Pto-C3H35 gene is shown in SEQ ID No. 1; the haplotype of the Pto-C3H35 gene is determined according to the nucleotides of SNP1, InDel1, InDel2, InDel3, and SNP2, wherein the SNP1 is the nucleotide at position 702 of SEQ ID No. 1, and the nucleotide is T or G; the nucleotide after position 705 of the InDel1 is CA (i.e., insertion type Insertion1, I1) or CA is deleted (i.e., deletion type Deletion1, D1), the nucleotide after position 708 of the InDel2 is TTAGAA (i.e., insertion type Insertion2, I2) or TTAGAA is deleted (i.e., deletion type Deletion2, D2); the InDel3 is SEQ ID No. The nucleotide after position 718 of No.1 is A (i.e., insertion type Insertion3, I3) or deletion A (i.e., deletion type Deletion3, D3), and the SNP2 is the nucleotide after position 768 of SEQ ID No.1, and the nucleotide is C or T.

[0027] Based on the strategy of genome-wide association analysis of metabolites, the present invention relies on the germplasm resource population of Populus tomentosa, uses the mixed linear model in TASSEL software, takes population structure and kinship as covariates, and detects SNP sites significantly associated with caffeic acid metabolites in the xylem of Populus tomentosa at the genome-wide level. SNP1 (P = 5.51 × 10 -10 ) and SNP2 (P = 5.00 × 10 -8) were significantly associated with caffeic acid content. Gene annotation showed that SNP1 was located in the promoter region of the Pto-C3H35 gene. Using the information of all SNPs and InDels in and within the Pto-C3H35 gene promoter, candidate gene-based association analysis revealed that, in addition to the two SNPs significantly associated with caffeic acid content, three InDels located in the Pto-C3H35 promoter region (InDel1: P = 5.05 × 10 -9 ; InDel2: P = 4.50 × 10 -7 ; InDel3: P = 1.35 × 10 -7 ) also had a significant correlation with caffeic acid content. Haplotype analysis of the above-mentioned associated loci using LDBlockShow software revealed that SNP1, InDel1, InDel2, InDel3 and SNP2 showed a high degree of linkage relationship (R 2 >0.8), forming a stable haplotype module and generating four genotype combinations (TT-D1D1-I2I2-I3I3-TT, TT-D1D1-I2I2-D3D3-CC, GG-I1I1-D2D2-I3I3-TT, TG-D1I1-D2I2-D3I3-TT). Among them, SNP1 is located at position 702 in the promoter region of the Pto-C3H35 gene, and three genotypes, TT, TG and GG, exist in the Populus tomentosa germplasm resource population. InDel1 is located after base 705 in the promoter region of the Pto-C3H35 gene, and three genotypes, D1D1, D1I1 and I1I1, exist in the Populus tomentosa germplasm resource population. InDel2 is located after base 708 in the promoter region of the Pto-C3H35 gene, and three genotypes, I2I2, D2I2 and D2D2, exist in the Populus tomentosa germplasm resource population. InDel3 is located at position 718 in the promoter region of the Pto-C3H35 gene, and three genotypes, D3D3, D3I3 and I3I3, exist in the Populus tomentosa germplasm resource population. SNP2 is located at position 768 in the promoter region of the Pto-C3H35 gene, and two genotypes, TT and CC, exist in the Populus tomentosa germplasm resource population. According to the correlation of phenotypic data of 300 Populus tomentosa plants, the caffeic acid content in the xylem of Populus tomentosa was significantly positively correlated with the lignin content (r = 0.63, P = 6.21 × 10 -27 ); Therefore, the caffeic acid content in the xylem of Populus tomentosa can be used as the best indicator for evaluating lignin content. By measuring the phenotypic contribution of the haplotype combinations of the above five loci to caffeic acid content, it is possible to accurately determine the effects of different haplotype combinations on the lignin content of poplars. This allows for accurate and efficient screening of superior plants with low lignin content in the early stages of poplar growth, which can be applied to the breeding of new poplar varieties in industrial timber plantations, effectively shortening the breeding cycle. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 This is the LD linkage map of the Pto-C3H35 gene haplotype block, including two SNPs and three InDels;

[0029] Figure 2 This is a diagram showing the genotype effect of different genotype combinations in the Pto-C3H35 gene haplotype module on caffeic acid content. DETAILED DESCRIPTION

[0030] The present invention provides a primer set and a kit for determining the haplotype of a Pto-C3H35 gene, as well as an application of the kit in evaluating the lignin content of a poplar. The nucleotide sequence of the Pto-C3H35 gene is shown in SEQ ID No. 1. The haplotype of the Pto-C3H35 gene is determined based on the nucleotides of SNP1, InDel1, InDel2, InDel3, and SNP2. The SNP1 is the nucleotide at position 702 of SEQ ID No. 1, and the nucleotide is T or G. The InDel1 is the nucleotide after position 705 of SEQ ID No. 1 is CA (i.e., insertion type Insertion 1, I1) or CA is deleted (i.e., deletion type Deletion 1, D1). The InDel2 is the nucleotide after position 708 of SEQ ID No. 1 is TTAGAA (i.e., insertion type Insertion 2, I2) or TTAGAA is deleted (i.e., deletion type Deletion 2, D2). The InDel3 is the nucleotide after position 709 of SEQ ID No. 1 is TTAGAA (i.e., insertion type Insertion 2, I2) or TTAGAA is deleted (i.e., deletion type Deletion 2, D2). The nucleotide after position 718 of No.1 is A (i.e., insertion type Insertion3, I3) or deletion A (i.e., deletion type Deletion3, D3), and the SNP2 is the nucleotide after position 768 of SEQ ID No.1, and the nucleotide is C or T.

[0031] The nucleotide sequence represented by SEQ ID No. 1 in the present invention is as follows, wherein the first underlined uppercase base T is the site before SNP1 mutation, the underlined uppercase base CA is the insertion sequence of InDel1, the underlined lowercase base ttagaa is the deletion sequence of InDel2, the underlined lowercase base a is the deletion base of InDel3, and the second underlined uppercase base T is the site before SNP2 mutation:

[0032] aacgtggagatgcgggggatcgaaccccgtgcctctcgcatgcaaagcgagcctctaccatttgagctacatccccgtaggcaaatggttccttaacatataaaaaaataattaaattgccttttgttctttaaattcaacttagcaggcgatcaattctagttc atgctctgtcatccatggctgcaaatataattcaagtcaatgtatggtcatggaaccacaatcttgcctctagctgtataacatgttcgagttcattgttattcacgtagttttattctttattgtcttaattaaagtgagttaagactgataactgacatgttctca tttaacaattccaaattcaataataaagagatcaaaaataatttcctattttcaaaatttttttttttttttctttcaaactaattttattgatattttaagattattgatatatcaatatcaaaaatttttgtaaaaaaatcttatttcaaaacatt ttataacaaaaatattataaaaaatatagttataacaataccaatattattaacttcatcataaaggatagttttttaaaaaaaataatatatgtctctctaataaggtggagtcattgaagataagacaagtgattactcttacaaaaagaccatggtttt T ttt CA t ttagaa heart a attttcaaactttcttgtatttgtttgtcattagaaaagttggttaa T

[0033] The present invention provides a primer set for detecting the lignin content of poplar, including a primer set for simultaneously detecting SNP1 and InDel (InDel1, InDel2 and InDel3): Pto-C3H35-702-TF, the nucleotide sequence of which is shown in SEQ ID No. 2; Pto-C3H35-702-GF, the nucleotide sequence of which is shown in SEQ ID No. 3; Pto-C3H35-702-R, the nucleotide sequence of which is shown in SEQ ID No. 4;

[0034] Primer set for detecting SNP2: Pto-C3H35-768-TF, nucleotide sequence shown in SEQ ID No.5; Pto-C3H35-768-CF, nucleotide sequence shown in SEQ ID No.6; Pto-C3H35-768-R, nucleotide sequence shown in SEQ ID No.7.

[0035] The primer set of the present invention can be used to accurately determine the genotype of the site to be tested through four PCRs, which greatly improves the detection efficiency compared with conventional PCR (site-by-site detection).

[0036] The present invention also provides a kit for detecting the lignin content of poplars, comprising the above primer set. The kit provided by the present invention can accurately and quickly determine the lignin content of poplars.

[0037] The present invention also provides a method for rapidly detecting the lignin content of poplars, by designing primers for the nucleotide sequence of the haplotype module for PCR amplification, and detecting the presence of the amplified product and the size of the amplified fragment to determine the genotype of the site to be tested, and then determining the lignin content of the poplar. The primer design requirement is that the last base at the 3' end of the forward primer is a functional site corresponding to the SNP. At the same time, in order to ensure the specificity of the amplified product, the last base at the 3' end of the forward primer is modified with a locked nucleic acid (LNA). The above-mentioned primer set can accurately and quickly determine the genotype of the haplotype related to the lignin content of the poplar, and then determine the lignin content of the poplar by combining the determined genotypes, thereby accurately and efficiently screening for superior white poplar plants with low lignin content in the early growth stage of the poplar, effectively shortening the breeding cycle.

[0038] The present invention has no special requirements for the extraction method of the genomic DNA of the test sample, and a conventional plant genome extraction method in the art can be used. The present invention has no special restrictions on the determination method of the SNP (SNP1) at position 702 of the Pto-C3H35 gene promoter, the InDel (InDel1) after the 705th base, the InDel (InDel2) after the 708th base, the InDel (InDel3) after the 718th base, and the SNP (SNP2) at position 768, and can be achieved by using SNP and InDel genotype detection methods well known to those skilled in the art. As an practicable method, the present invention is implemented by a PCR amplification method.

[0039] The genotype of the plant is identified by PCR amplification, and the method for detecting the amplified product is agarose gel electrophoresis or sequencing, preferably agarose gel electrophoresis. In the present invention, the size of the amplified products of Pto-C3H35-702-TF and Pto-C3H35-702-R is between 75bp-84bp (affected by the genotypes of InDel1, InDel2, and InDel3), the size of the amplified products of Pto-C3H35-702-GF and Pto-C3H35-702-R is between 75bp-84bp (affected by the genotypes of InDel1, InDel2, and InDel3), the size of the amplified products of Pto-C3H35-768-TF and Pto-C3H35-768-R is 65bp, and the size of the amplified products of Pto-C3H35-768-CF and Pto-C3H35-768-R is 65bp. If the target band does not exist in the agarose gel electrophoresis results, it indicates that the corresponding amplification product was not obtained.

[0040] Based on the amplification results, the genotype combination of the test sample can be directly determined. If a product is obtained when PCR amplification is performed on Pto-C3H35-702-TF and Pto-C3H35-702-R, no product is obtained when PCR amplification is performed on Pto-C3H35-702-GF and Pto-C3H35-702-R, and a product is obtained when PCR amplification is performed on Pto-C3H35-768-TF and Pto-C3H35-768-R, but no product is obtained when PCR amplification is performed on Pto-C3H35-768-CF and Pto-C3H35-768-R, then the genotype combination of the sample is TT-D1D1-I2I2-I3I3-TT.

[0041] If PCR amplification products are obtained from Pto-C3H35-702-TF and Pto-C3H35-702-R, no amplification products are obtained from Pto-C3H35-702-GF and Pto-C3H35-702-R, no amplification products are obtained from Pto-C3H35-768-TF and Pto-C3H35-768-R, and amplification products are obtained from Pto-C3H35-768-CF and Pto-C3H35-768-R, then the genotype combination of the sample is TT-D1D1-I2I2-D3D3-CC;

[0042] If no amplification product is obtained when PCR amplification is performed on Pto-C3H35-702-TF and Pto-C3H35-702-R, an amplification product is obtained when PCR amplification is performed on Pto-C3H35-702-GF and Pto-C3H35-702-R, an amplification product is obtained when PCR amplification is performed on Pto-C3H35-768-TF and Pto-C3H35-768-R, and no amplification product is obtained when PCR amplification is performed on Pto-C3H35-768-CF and Pto-C3H35-768-R, then the genotype combination of the sample is GG-I1I1-D2D2-I3I3-TT;

[0043] If an amplification product is obtained when Pto-C3H35-702-TF and Pto-C3H35-702-R are subjected to PCR amplification, an amplification product is obtained when Pto-C3H35-702-GF and Pto-C3H35-702-R are subjected to PCR amplification, an amplification product is obtained when Pto-C3H35-768-TF and Pto-C3H35-768-R are subjected to PCR amplification, and no amplification product is obtained when Pto-C3H35-768-CF and Pto-C3H35-768-R are subjected to PCR amplification, then the genotype combination of the sample is TG-D1I1-D2I2-D3I3-TT.

[0044] Among the four haplotype combinations provided herein, the poplar xylem associated with GG-I1I1-D2D2-I3I3-TT has the lowest caffeic acid content, indicating the lowest lignin content in the poplar xylem; the poplar xylem associated with TT-D1D1-I2I2-D3D3-CC has the highest caffeic acid content, indicating the highest lignin content in the poplar xylem. The poplar described herein is preferably Populus tomentosa. While the tissue from which genomic DNA is sampled is not particularly limited, the xylem is preferred.

[0045] The 702nd base (SNP1) and the 768th base (SNP2) of the Pto-C3H35 gene described in the present invention are based on a strategy of genome-wide association analysis. Relying on the Populus tomentosa germplasm resource population, a compressed mixed linear model in the TASSEL software is used to detect SNP sites significantly associated with the caffeic acid content of Populus tomentosa at the genome-wide level. The InDel1, InDel2, and InDel3 are based on all SNP and InDel variations of the Pto-C3H35 gene (including the upstream 2kb promoter region), and a candidate gene association analysis strategy is used to detect InDels significantly associated with caffeic acid content. The SNP and InDel sites show a high degree of linkage relationship (R 2 >0.8), forming a stable haplotype module and generating four genotype combinations (TT-D1D1-I2I2-I3I3-TT, TT-D1D1-I2I2-D3D3-CC, GG-I1I1-D2D2-I3I3-TT, TG-D1I1-D2I2-D3I3-TT). The significance threshold of the SNPs and InDels associated with caffeic acid content in the present invention was P < 1 × 10 -6 .

[0046] Among them, SNP1 is located at position 702 in the promoter region of the Pto-C3H35 gene, and three genotypes, TT, TG and GG, exist in the Populus tomentosa germplasm resource population. InDel1 is located after base 705 in the promoter region of the Pto-C3H35 gene, and three genotypes, D1D1, D1I1 and I1I1, exist in the Populus tomentosa germplasm resource population. InDel2 is located after base 708 in the promoter region of the Pto-C3H35 gene, and three genotypes, I2I2, D2I2 and D2D2, exist in the Populus tomentosa germplasm resource population. InDel3 is located at position 718 in the promoter region of the Pto-C3H35 gene, and three genotypes, D3D3, D3I3 and I3I3, exist in the Populus tomentosa germplasm resource population. SNP2 is located at position 768 in the promoter region of the Pto-C3H35 gene, and two genotypes, TT and CC, exist in the Populus tomentosa germplasm resource population. By measuring the genotype combination of the above five loci, the lignin content of poplar trees can be accurately determined, and superior plants with low lignin content can be accurately and efficiently screened in the early growth stages of poplar trees. This can be applied to the breeding of new industrial timber poplar varieties, effectively shortening the breeding cycle.

[0047] After determining the genotype combination of the above-mentioned SNP and InDel sites, the present invention judges the lignin content of the poplar according to the genotype combination of the above-mentioned sites: when the genotype of SNP1 is GG, the genotype of InDel1 is I1I1, the genotype of InDel2 is D2D2, the genotype of InDel3 is I3I3, and the genotype of SNP2 is TT, that is, when the genotype combination of the haplotype is GG-I1I1-D2D2-I3I3-TT, the lignin content of the xylem of the poplar sample is the lowest; when the genotype of SNP1 is TT, the genotype of InDel1 is D1D1, the genotype of InDel2 is I2I2, the genotype of InDel3 is D3D3, and the genotype of SNP2 is CC, that is, when the genotype combination of the haplotype is TT-D1D1-I2I2-D3D3-CC, the lignin content of the xylem of the poplar sample is the highest.

[0048] The present invention also provides an application of the application or the primer set or the kit in poplar breeding. The present invention can quickly and accurately determine the genotype of the SNP and InDel of the poplar sample to be tested, and then judge the lignin content of the poplar by determining the genotype combination, thereby accurately and efficiently screening for superior Populus tomentosa plants with low lignin content in the early stages of poplar growth, effectively shortening the breeding cycle. By detecting the genotype of the SNP and InDel sites, the present invention can screen for poplar samples with a genotype combination of GG-I1I1-D2D2-I3I3-TT for subsequent breeding operations in order to obtain poplar varieties with low lignin content.

[0049] All primers of the present invention were synthesized by relevant biological companies, and unless otherwise specified, the chemical reagents used were conventional commercial reagents, and the technical means used were conventional technical means well known to those skilled in the art.

[0050] To further illustrate the present invention, the application of a Pto-C3H35 gene haplotype provided by the present invention in evaluating the lignin content of poplar will be described in detail below in conjunction with examples, but they should not be construed as limiting the scope of protection of the present invention.

[0051] Example 1

[0052] 1. Primer set for detecting Pto-C3H35 gene haplotype

[0053] The primer set includes: a primer set for identifying the genotype of the 172nd base (SNP1) of the nucleotide sequence shown in SEQ ID No. 1, an InDel sequence after position 705 (InDel1), an InDel sequence after position 708 (InDel2), and an InDel sequence after position 718 (InDel3): Pto-C3H35-702-TF and Pto-C3H35-702-R, the amplification product is between 75 bp and 84 bp, and Pto-C3H35-702-GF and Pto-C3H35-702-R, the amplification product is between 75 bp and 84 bp; a primer set for identifying the nucleotide sequence shown in SEQ ID No. The primer sets for the genotype at position 768 (SNP2) of the nucleotide sequence shown in No. 1 are: Pto-C3H35-768-TF and Pto-C3H35-768-R, amplifying a 65-bp product; and Pto-C3H35-768-CF and Pto-C3H35-768-R, amplifying a 65-bp product. The specific nucleotide sequences of these primer sets are shown in SEQ ID Nos. 2 to 7.

[0054] 2. Using the above primer set, identify the genotypes of the SNPs and InDels of 30 individuals in the Populus tomentosa hybrid population, and then determine the lignin content of the samples, as follows:

[0055] 1) Thirty individuals were randomly selected from the hybrid population germplasm bank of Populus tomentosa planted in Guanxian County, Shandong Province. After removing the bark, two xylem samples (approximately 300 mg) were scraped with a file and immediately frozen in liquid nitrogen. One sample was sent to a biotechnology company for targeted metabolomics analysis to measure caffeic acid metabolite content. Lignin content in the other sample was determined using the Klason method. The results are shown in Table 1.

[0056] 2) Collect the corresponding poplar leaves and immediately freeze them in liquid nitrogen (-196°C);

[0057] 3) Genomic DNA from leaf samples was extracted using the FastPure Universal Plant Total RNA Isolation Kit (Vazyme China, Nanjing, China);

[0058] 4) Using a locked nucleic acid modification method, the promoter region of the Pto-C3H35 gene in the genomic DNA of the Populus tomentosa leaf sample was determined at base 702, the InDel following base 705, the InDel following base 708, the InDel following base 718, and base 768. PCR amplification was performed using the primer set described in Example 1 and the genomic DNA obtained in step 3) as a template.

[0059] PCR amplification was performed using 2× Phanta Max Master Mix (Dye Plus) (Vazyme China, Nanjing, China), and the reaction system and procedure were set according to the instructions. The reaction system was as follows: 2× PhantaMax Master Mix (Dye Plus) 25 μL, ddH O 19 μL, genomic DNA template 2 μL, and 2 μL each of upstream and downstream primers;

[0060] The amplification program was as follows: pre-denaturation at 95°C for 3 min; 34 cycles of denaturation at 95°C for 15 s, annealing at 58°C for 15 s, and extension at 72°C for 45 s; and complete extension at 72°C for 5 min.

[0061] After PCR amplification is completed, the amplified product is detected by agarose gel electrophoresis and the results are judged.

[0062] The genotypes of the SNPs and InDels and the corresponding caffeic acid and lignin contents of the candidate samples are shown in Table 1.

[0063] Table 1 Genotypes and caffeic acid contents of five predetermined loci of the tested Populus tomentosa individuals

[0064]

[0065] According to the results in Table 1, the relative content of caffeic acid in the 30 strains was 2021014.7175±747927.9977, the lignin content was 0.2340±0.05516%, and the phenotypic correlation coefficient was r=0.97 (P=2.7×10 -19When the genotype combination of base 702, InDel after base 705, InDel after base 708, InDel after base 718, and base 768 in the promoter region of Pto-C3H35 was GG-I1I1-D2D2-I3I3-TT, the caffeic acid and lignin contents of the candidate poplar individuals were the lowest, as reflected in that the caffeic acid content of the candidate individuals (783292.7220±103465.7606) was 61.24% lower than the overall caffeic acid content (2021014.7175±747927.9977), and the lignin content (0.1390±0.006919%) was 40.58% lower than the overall lignin content (0.2340±0.05516%). When the genotype combination of base 702, InDel after base 705, InDel after base 708, InDel after base 718, and base 768 in the Pto-C3H35 promoter region was TT-D1D1-I2I2-D3D3-CC, the caffeic acid and lignin contents of the candidate poplar individuals were the highest, as reflected in the 44.09% higher caffeic acid content (2912154.0624±179786.0762) of the candidate individuals compared with the overall caffeic acid content (2021014.7175±747927.9977), and the lignin content (0.2979±0.009008%) was 27.30% higher than the overall lignin content (0.2340±0.05516%).

[0066] It can be seen that the present invention can accurately and quickly determine the haplotype that is significantly correlated with the lignin content of poplars, and then judge the lignin content of poplars through the determined genotype combination, thereby accurately and efficiently screening superior plants with low lignin content in the early growth stage of poplars, effectively shortening the breeding cycle of poplar varieties with excellent wood quality.

[0067] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. An application of a Pto-C3H35 gene haplotype in evaluating the lignin content of Populus tomentosa, characterized in that: The nucleotide sequence of the Pto-C3H35 gene is shown in SEQ ID NO: 1, and the haplotype of the Pto-C3H35 gene is determined based on the nucleotides of SNP1, InDel1, InDel2, InDel3, and SNP2, wherein the SNP1 is located at position 702 of SEQ ID No. 1, and the nucleotide is T or G; The InDel1 is an insertion type I1 in which the nucleotide after position 705 of SEQ ID No. 1 is CA, or a deletion type D1 in which CA is missing; The InDel2 is located in SEQ ID No.

1. The nucleotide after position 708 is TTAGAA, which is an insertion type I2, and the deletion of TTAGAA is a deletion type D2; The InDel3 is located in SEQ ID No.

1. The nucleotide after position 718 is A, which is an insertion type I3, and the deletion type D3 is missing A. The SNP2 is located at position 768 of the sequence shown in SEQ ID NO: 1, and the nucleotide is T or C; When the genotype combination of the Pto-C3H35 gene haplotype is GG-I1I1-D2D2-I3I3-TT, the caffeic acid content and lignin content in the xylem of the poplar sample are the lowest; When the genotype combination of the Pto-C3H35 gene haplotype is TT-D1D1-I2I2-D3D3-CC, the caffeic acid content and the lignin content in the xylem of the poplar sample are the highest.

2. The application according to claim 1, characterized in that For detection Pto-C3H35 The primer sets for the SNP1, InDel1, InDel2, and InDel3 genotypes of the gene include Pto-C3H35-702-TF, Pto-C3H35-702-GF, and Pto-C3H35-702-R, and the nucleotide sequences are shown in SEQ ID No. 2 to SEQ ID No. 4, respectively; The primer set for detecting the SNP2 genotype includes Pto-C3H35-768-TF, Pto-C3H35-768-CF, and Pto-C3H35-768-R, and the nucleotide sequences are shown in SEQ ID No. 5 to SEQ ID No. 7, respectively.

Images