System and kit for diagnosing natural regression of neuroblastoma

Abstract

The invention discloses a system and a kit for diagnosing natural regression of neuroblastoma, and relates to the technical field of medical diagnosis. The system and the kit provided by the invention are used for diagnosing whether the tumor of the Ms-stage child neuroblastoma patient naturally fades or not on the basis of the reads values of the target miRNA mature body and the isomer thereof, have relatively high sensitivity and specificity, and can provide effective suggestions for whether surgical resection is needed or not for clinical treatment.

Description

Technical Field

[0001] The present invention relates to the technical field of medical diagnosis, and in particular to a system and a kit for diagnosing the spontaneous regression of neuroblastoma. Background Art

[0002] Among pediatric malignancies, neuroblastoma (NBL) is the most common extracranial solid tumor in children, characterized by its genetic complexity and diverse clinical behavior. It is well known that traditional tumor biopsy is the gold standard for diagnosing primary or metastatic tumors, which can reveal tumor biological characteristics and guide treatment decisions. However, there are significant challenges and risks in performing invasive biopsies in patients with NBL. In addition, due to the high heterogeneity of NBL, biopsies may not fully reflect the full characteristics of the disease. Especially in children, biopsies require repeated sedation and / or anesthesia. In order to address these issues, there has been a gradual shift to the study of non-invasive methods for evaluating and monitoring NBL (including prognosis and treatment monitoring).

[0003] Since NBL is a highly heterogeneous childhood tumor, its diagnosis faces many difficulties. The International Neuroblastoma Risk Group Staging System (INRGSS) is a widely used neuroblastoma staging system that can stage neuroblastoma before treatment begins. INRGSS divides NBL into the following four stages.

[0004] Among these four stages, the situation of NBL patients in Ms stage is quite special. Its main feature is that the patients have a good prognosis, and the tumors of some patients may regress naturally. However, how to identify patients whose tumors can regress naturally in the early stage of diagnosis and take active treatment plans for patients whose tumors cannot regress naturally and progress is currently a clinical difficulty.

[0005] In view of this, the present invention is proposed. Summary of the invention

[0006] The purpose of the present invention is to provide a system and a kit for diagnosing the spontaneous regression of neuroblastoma, which can be used to evaluate the spontaneous regression and progression risk of tumors in children with Ms stage neuroblastoma and has good diagnostic performance.

[0007] The present invention is achieved in that: In a first aspect, the present invention provides a system for diagnosing spontaneous regression of tumors in Ms-stage pediatric neuroblastoma patients, comprising: an information acquisition module, a calculation module, and a diagnosis module; The information acquisition module is used to execute the step of acquiring the reads value of the mature form of the target miRNA and its isomers in the sample to be tested; the isomers include the first isomer, the second isomer, the third isomer and the fourth isomer; The first isoform lacks 1 nucleotide at the 3' end relative to the mature form of its target miRNA; The second isoform lacks 2 nucleotides relative to the 3' end of its target miRNA mature form; The third isoform has one more nucleotide at the 3' end relative to the mature form of its target miRNA; The fourth isoform has 2 additional nucleotides relative to the 3' end of its target miRNA mature form; The sample to be tested is from a child neuroblastoma patient to be identified who is in the Ms stage; The calculation module is used to execute the step of substituting the reads value into the calculation model to calculate the threshold value; The diagnostic module is used to perform the step of determining the possibility of natural regression of the tumor in the pediatric neuroblastoma patient to be identified according to the threshold value; The target miRNA mature body includes at least one of the following 18 miRNA molecules: hsa-let-7i-5p, hsa-miR-122-5p, hsa-miR-143-3p, hsa-miR-145-5p, hsa-miR-146a-5p, hsa-miR-148b-3p, hsa-miR-223-3p, hsa-miR-26 b-5p, hsa-miR-27b-3p, hsa-miR-28-3p, hsa-miR-29a-3p, hsa-miR-30e-5p, hsa-miR-320a -3p, hsa-miR-34a-5p, hsa-miR-423-5p, hsa-miR-7-5p, hsa-miR-92a-3p, and hsa-miR-9a-3p.

[0008] The system of the present invention uses the reads values ​​of the above 18 target miRNA mature molecules and their isomers to diagnose whether the tumor of children with neuroblastoma in the Ms stage has naturally regressed, and has good diagnostic performance, with a sensitivity of 92.77% and a specificity of 95.81%. It can provide effective suggestions for clinical treatment on whether surgical resection is needed.

[0009] The different stages of the tumor are defined as follows: stage definition L1 Localized tumors, no radiographically defined risk factors, tumors that are localized and surgically resectable L2 Localized tumors with one or more radiographic risk factors that are difficult to completely remove even with surgery M phase Distant metastatic disease, where the cancer has spread to other parts of the body, such as bones, bone marrow, lymph nodes, etc. Ms period Localized tumors (stage L1 or L2) with specific metastases limited to the skin, liver, and / or bone marrow (less than 10% tumor cells in the bone marrow), and patients younger than 18 months Optionally, in some embodiments of the present invention, the mathematical formula of the calculation model in the calculation module is as follows or its equivalent modified formula: S=1.67×R1+2.34×R2+8.04×R3+4.76×R4+7.12×R5+1.45×R6+1.64×R7+9.31×R8+3.26×R9+7.1 8×R10+5.64×R11+5.07×R12+9.78×R13+2.06×R14+6.54×R15+6.03×R16+1.35×R17+1.69×R18; Among them, S represents the score value for identifying spontaneous tumor regression in children with neuroblastoma; R1-R18 represent the read ratios of the following target miRNA mature molecules and their corresponding isomers, respectively; hsa-let-7i-5p, hsa-miR-122-5p, hsa-miR-143-3p, hsa-miR-145-5p, hsa-miR-146a-5p, hsa-miR-148b-3p, hsa-miR-223-3p, hsa-miR -26b-5p, hsa-miR-27b-3p, hsa-miR-28-3p, hsa-miR-29a-3p, hsa-miR-30e-5p, hsa-miR-320 a-3p, hsa-miR-34a-5p, hsa-miR-423-5p, hsa-miR-7-5p, hsa-miR-92a-3p, and hsa-miR-9a-3p; The reads ratio of each target miRNA mature molecule to its corresponding isomer is calculated according to the following mathematical formula or its equivalent modified formula: Rn=(R second isomer / R target miRNA mature form+R first isomer / R target miRNA mature form) / (R third isomer / R target miRNA mature form+R fourth isomer / R target miRNA mature form); n is selected from any positive integer between 1 and 18.

[0010] It should be noted that the fixed coefficients (e.g., 1.67, 2.34, 1.69) in the mathematical formula of the above model can float within a certain range, such as ±3%. Therefore, in other embodiments, as long as the calculation model is within this range, it belongs to the protection scope of the present invention.

[0011] It should be noted that the sequencing reads of miRNA and its isoforms can be measured by common sequencing technologies or qRCR in this field, such as Illumina's iSeq100, MiniSeq, MiSeq, NextSeq550, NextSeq2000, and NovaSeq6000 sequencers based on PE150 or SE50 sequencing technologies; BGI's MGI sequencing platform is based on SE100, PE100, and PE150 sequencing technologies.

[0012] It should be noted that the methods for extracting and separating plasma small extracellular vesicles (exosomes) and enriching miRNA and its isoforms used in the present invention can be carried out using conventional techniques and kits in the art.

[0013] Optionally, in some embodiments of the present invention, the diagnosis module makes a judgment based on the S value in the following manner: If S>35.80, the tumor is judged to be unable to regress on its own and is at risk of progression; If S < 27.60, the tumor is judged to be regressing or remitting without intervention; If 27.60≤S≤35.80, no judgment is made. It is recommended to retest or combine other clinical indicators for judgment.

[0014] Optionally, in some embodiments of the present invention, the sample to be tested is from plasma exosomes of a pediatric neuroblastoma patient to be identified.

[0015] Alternatively, in some embodiments of the present invention, the nucleotide sequences of hsa-let-7i-5p, hsa-miR-122-5p, hsa-miR-143-3p, hsa-miR-145-5p, hsa-miR-146a-5p, hsa-miR-148b-3p, hsa-miR-223-3p, hsa-miR-26b-5p, hsa-miR-27b-3p, hsa-miR-28-3p, hsa-miR-29a-3p, hsa-miR-30e-5p, hsa-miR-320a-3p, hsa-miR-34a-5p, hsa-miR-423-5p, hsa-miR-7-5p, hsa-miR-92a-3p and hsa-miR-9a-3p are as shown in SEQ As shown in ID NO.1-18.

[0016] In another aspect, the present invention provides a kit for diagnosing tumor regression in children with neuroblastoma in the Ms stage, the kit comprising reagents for detecting the reads values ​​of mature forms of target miRNA and isoforms thereof; The target miRNA mature body includes at least one of the following 18 miRNA molecules: hsa-let-7i-5p, hsa-miR-122-5p, hsa-miR-143-3p, hsa-miR-145-5p, hsa-miR-146a-5p, hsa-miR-148b-3p, hsa-miR-223-3p, hsa-miR-26b- 5p, hsa-miR-27b-3p, hsa-miR-28-3p, hsa-miR-29a-3p, hsa-miR-30e-5p, hsa-miR-320a- 3p, hsa-miR-34a-5p, hsa-miR-423-5p, hsa-miR-7-5p, hsa-miR-92a-3p, and hsa-miR-9a-3p; The isoform lacks or increases 1-2 nucleotides relative to the 3' end of the mature miRNA of the target miRNA.

[0017] Optionally, in some embodiments of the present invention, the isomers include a first isomer, a second isomer, a third isomer and a fourth isomer; the first isomer lacks 1 nucleotide relative to the 3' end of its target miRNA mature body; the second isomer lacks 2 nucleotides relative to the 3' end of its target miRNA mature body; the third isomer increases 1 nucleotide relative to the 3' end of its target miRNA mature body; the fourth isomer increases 2 nucleotides relative to the 3' end of its target miRNA mature body.

[0018] Optionally, in some embodiments of the present invention, the test sample of the kit is derived from plasma exosomes of a childhood neuroblastoma patient in the Ms stage.

[0019] Optionally, in some embodiments of the present invention, the kit further comprises an instruction manual, which records the following calculation formula or an equivalent modified formula thereof: S=1.67×R1+2.34×R2+8.04×R3+4.76×R4+7.12×R5+1.45×R6+1.64×R7+9.31×R8+3.26×R9+7.1 8×R10+5.64×R11+5.07×R12+9.78×R13+2.06×R14+6.54×R15+6.03×R16+1.35×R17+1.69×R18; Among them, S represents the score value for identifying spontaneous tumor regression in children with neuroblastoma; R1-R18 represent the read ratios of the following target miRNA mature molecules and their corresponding isomers, respectively; hsa-let-7i-5p, hsa-miR-122-5p, hsa-miR-143-3p, hsa-miR-145-5p, hsa-miR-146a-5p, hsa-miR-148b-3p, hsa-miR-223-3p, hsa-miR -26b-5p, hsa-miR-27b-3p, hsa-miR-28-3p, hsa-miR-29a-3p, hsa-miR-30e-5p, hsa-miR-320 a-3p, hsa-miR-34a-5p, hsa-miR-423-5p, hsa-miR-7-5p, hsa-miR-92a-3p, and hsa-miR-9a-3p; The reads ratio of each target miRNA mature molecule to its corresponding isomer is calculated according to the following mathematical formula or its equivalent modified formula: Rn=(R second isomer / R target miRNA mature body + R first isomer / R target miRNA mature body) / (R third isomer / R target miRNA mature body + R fourth isomer / R target miRNA mature body); n is selected from any positive integer between 1 and 18; If S>35.80, the tumor is judged to be unable to regress on its own and is at risk of progression; If S < 27.60, the tumor is judged to be regressing or remitting without intervention; If 27.60≤S≤35.80, no judgment is made. It is recommended to retest or combine other clinical indicators for judgment.

[0020] Alternatively, in some embodiments of the present invention, the nucleotide sequences of hsa-let-7i-5p, hsa-miR-122-5p, hsa-miR-143-3p, hsa-miR-145-5p, hsa-miR-146a-5p, hsa-miR-148b-3p, hsa-miR-223-3p, hsa-miR-26b-5p, hsa-miR-27b-3p, hsa-miR-28-3p, hsa-miR-29a-3p, hsa-miR-30e-5p, hsa-miR-320a-3p, hsa-miR-34a-5p, hsa-miR-423-5p, hsa-miR-7-5p, hsa-miR-92a-3p and hsa-miR-9a-3p are as shown in SEQ ID NO.1-18, as shown in Table 1 below.

[0021] Table 1

[0022] The first isomer sequence of hsa-let-7i-5p (-1): UGAGGUAGUAGUUUGUGCUGU.

[0023] The second isoform sequence of hsa-let-7i-5p (-2): UGAGGUAGUAGUUUGUGCUG.

[0024] The third isoform sequence of hsa-let-7i-5p (+1): UGAGGUAGUAGUUUGUGCUGUU C .

[0025] The fourth isoform sequence of hsa-let-7i-5p (+2): UGAGGUAGUAGUUUGUGCUGUU CG . BRIEF DESCRIPTION OF THE DRAWINGS

[0026] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0027] Figure 1 This is a flow chart of diagnosis performed using the model of Example 1 in Example 2.

[0028] Figure 2 The ROC curve of the diagnosis using the model of Example 1 in Example 2 and the ROC curve of the diagnosis using the MYCN gene amplification results. DETAILED DESCRIPTION

[0029] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0030] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0031] Example 1

[0032] This example provides a diagnostic model for spontaneous tumor regression in patients with Ms stage NBL The reads of 18 mature miRNA molecules and their corresponding isomers in the plasma exosomes of patients with Ms stage NBL were detected, and the read values ​​were substituted into the following formula to calculate the S threshold: S= 1.67×[(R-2nt-hsa-let-7i-5p / Rripe hsa-let-7i-5p+R-1nt-hsa-let-7i-5p / Rripe hsa-let-7i- 5p) / (R1nt-hsa-let-7i-5p / Rripe hsa-let-7i-5p+R2nt-hsa-let-7i-5p / Rripe hsa-let-7i-5p)】 +2.34×

(R-2nt-hsa-miR-122-5p / Rmature hsa-miR-122-5p+R-1nt-hsa-miR-122-5p / Rmature hsa-miR-122 -5p) / (R1nt-hsa-miR-122-5p / Rmature hsa-miR-122-5p+R2nt-hsa-miR-122-5p / Rmature hsa-miR-122-5p)

(R-2nt-hsa-miR-143-3p / R mature hsa-miR-143-3p+R-1nt-hsa-miR-143-3p / R mature hsa-miR-143-3p) / (R1nt-hsa-miR-143-3p / R mature hsa-miR-143-3p+R2nt-hsa-miR-143-3p / R mature hsa-miR-143-3p)

(R-2nt-hsa-miR-145-5p / Rmature hsa-miR-145-5p+R-1nt-hsa-miR-145-5p / Rmature hsa-miR-145 -5p) / (R1nt-hsa-miR-145-5p / Rmature hsa-miR-145-5p+R2nt-hsa-miR-145-5p / Rmature hsa-miR-145-5p)

(R-2nt-hsa-miR-146a-5p / Rmature hsa-miR-146a-5p+R-1nt-hsa-miR-146a-5p / Rmature hsa-miR-146a -5p) / (R1nt-hsa-miR-146a-5p / Rmature hsa-miR-146a-5p+R2nt-hsa-miR-146a-5p / Rmature hsa-miR-146a-5p)

(R-2nt-hsa-miR-148b-3p / R mature hsa-miR-148b-3p+R-1nt-hsa-miR-148b-3p / R mature hsa-miR-148b-3p) / (R1nt-hsa-miR-148b-3p / R mature hsa-miR-148b-3p+R2nt-hsa-miR-148b-3p / R mature hsa-miR-148b-3p)

(R-2nt-hsa-miR-223-3p / R mature hsa-miR-223-3p+R-1nt-hsa-miR-223-3p / R mature hsa-miR-223-3p) / (R1nt-hsa-miR-223-3p / R mature hsa-miR-223-3p+R2nt-hsa-miR-223-3p / R mature hsa-miR-223-3p)

(R-2nt-hsa-miR-26b-5p / Rmature hsa-miR-26b-5p+R-1nt-hsa-miR-26b-5p / Rmature hsa-miR-26b -5p) / (R1nt-hsa-miR-26b-5p / Rmature hsa-miR-26b-5p+R2nt-hsa-miR-26b-5p / Rmature hsa-miR-26b-5p)

(R-2nt-hsa-miR-27b-3p / Rmature hsa-miR-27b-3p+R-1nt-hsa-miR-27b-3p / Rmature hsa-miR-27b -3p) / (R1nt-hsa-miR-27b-3p / Rmature hsa-miR-27b-3p+R2nt-hsa-miR-27b-3p / Rmature hsa-miR-27b-3p)

(R-2nt-hsa-miR-28-3p / R mature hsa-miR-28-3p+R-1nt-hsa-miR-28-3p / R mature hsa-miR-28-3p) / (R1nt-hsa-miR-28-3p / R mature hsa-miR-28-3p+R2nt-hsa-miR-28-3p / R mature hsa-miR-28-3p)

(R - 2nt - hsa - miR - 29a - 3p / R mature hsa - miR - 29a - 3p + R - 1nt - hsa - miR - 29a - 3p / R mature hsa - miR - 29a - 3p) / (R1nt - hsa - miR - 29a - 3p / R mature hsa - miR - 29a - 3p + R2nt - hsa - miR - 29a - 3p / R mature hsa - miR - 29a - 3p)

(R - 2nt - hsa - miR - 30e - 5p / R mature hsa - miR - 30e - 5p + R - 1nt - hsa - miR - 30e - 5p / R mature hsa - miR - 30e - 5p) / (R1nt - hsa - miR - 30e - 5p / R mature hsa - miR - 30e - 5p + R2nt - hsa - miR - 30e - 5p / R mature hsa - miR - 30e - 5p)

(R - 2nt - hsa - miR - 320a - 3p / R mature hsa - miR - 320a - 3p + R - 1nt - hsa - miR - 320a - 3p / R mature hsa - miR - 320a - 3p) / (R1nt - hsa - miR - 320a - 3p / R mature hsa - miR - 320a - 3p + R2nt - hsa - miR - 320a - 3p / R mature hsa - miR - 320a - 3p)

(R - 2nt - hsa - miR - 34a - 5p / R mature hsa - miR - 34a - 5p + R - 1nt - hsa - miR - 34a - 5p / R mature hsa - miR - 34a - 5p) / (R1nt - hsa - miR - 34a - 5p / R mature hsa - miR - 34a - 5p + R2nt - hsa - miR - 34a - 5p / R mature hsa - miR - 34a - 5p)

(R - 2nt - hsa - miR - 423 - 5p / R mature hsa - miR - 423 - 5p + R - 1nt - hsa - miR - 423 - 5p / R mature hsa - miR - 423 - 5p) / (R1nt - hsa - miR - 423 - 5p / R mature hsa - miR - 423 - 5p + R2nt - hsa - miR - 423 - 5p / R mature hsa - miR - 423 - 5p)

(R-2nt-hsa-miR-7-5p / Rmature hsa-miR-7-5p+R-1nt-hsa-miR-7-5p / Rmature hsa-miR-7 -5p) / (R1nt-hsa-miR-7-5p / Rmature hsa-miR-7-5p+R2nt-hsa-miR-7-5p / Rmature hsa-miR-7-5p)

(R-2nt-hsa-miR-92a-3p / Rmature hsa-miR-92a-3p+R-1nt-hsa-miR-92a-3p / Rmature hsa-miR-92a -3p) / (R1nt-hsa-miR-92a-3p / Rmature hsa-miR-92a-3p+R2nt-hsa-miR-92a-3p / Rmature hsa-miR-92a-3p)

(R-2nt-hsa-miR-9a-3p / Rmature hsa-miR-9a-3p+R-1nt-hsa-miR-9a-3p / Rmature hsa-miR-9a -3p) / (R1nt-hsa-miR-9a-3p / Rmature hsa-miR-9a-3p+R2nt-hsa-miR-9a-3p / Rmature hsa-miR-9a-3p)

[0033] In the formula: -2nt-hsa-let-7i-5p, representing a deletion of 2 nucleotides at the 3′ end relative to the mature hsa-let-7i-5p molecule; -1nt-hsa-let-7i-5p, representing a deletion of 1 nucleotide at the 3′ end relative to the mature hsa-let-7i-5p molecule; 1nt-hsa-let-7i-5p, representing an increase of 1 nucleotide at the 3′ end relative to the mature hsa-let-7i-5p molecule; 2nt-hsa-let-7i-5p, representing the addition of 2 nucleotides to the 3′ end of the mature hsa-let-7i-5p molecule; Other molecules containing the characters "-2nt, -1nt, 1nt, 2nt" should be understood similarly.

[0034] R-2nt-hsa-let-7i-5p, R-1nt-hsa-let-7i-5p, R mature hsa-let-7i-5p, R1nt-hsa-let-7i-5p, R2nt-hsa-let-7i-5p, represent the reads values ​​of mature hsa-let-7i-5p molecules and their isomers; other molecules are understood similarly.

[0035] Example 2

[0036] The model of Example 1 was used to perform risk management and auxiliary diagnosis for patients with Ms stage NBL. 286 patients based on INRGSS staging were enrolled and plasma exosome-derived miRNA sequencing and data analysis were completed, and a report was generated based on the model. The model determined that 161 patients' NBL could naturally regress or achieve remission without clinical intervention, and 75 patients' NBL could not naturally regress without clinical intervention and had a risk of tumor progression. The sequencing data of another 50 patients were not suitable for model analysis and were tested again within 3-6 months to generate a report. In the end, the data of 18 patients were still not suitable for model analysis, and these patients were no longer followed up. Patients in the group judged by the model to have natural regression and remission were followed up for up to 18 months, and MYCN amplification detection was performed at the end of the follow-up. Patients in the group judged by the model to be unable to spontaneously regress and at risk of progression were followed up for up to 24 months, and MYCN amplification detection was performed at the end of the follow-up. Finally, the number of patients with complete regression, partial remission, no change, and tumor progression of NBL in each group based on the model interpretation was counted. The interpretation results are as follows: Figure 1 As shown in the data, among the 268 valid data, 185 cases of spontaneous regression and remission were obtained for the Ms stage identification NBL model, and 83 cases were unable to spontaneously resolve and progress. Through follow-up, 189 cases were finally found to have achieved NBL regression without clinical intervention.

[0037] MYCN gene amplification (which can be achieved through existing technology) is the most critical molecular marker in NBL and is widely used in disease risk stratification, prognosis assessment and treatment strategy formulation. In the INRGSS system, MYCN amplification is the core indicator of high-risk stratification, and its association with poor prognosis, high-risk stratification and treatment selection has been verified through large-scale clinical studies and guideline consensus. In the embodiment of the present invention, as shown in Table 2 below, the clinical follow-up included the data statistics of MYCN gene amplification. Among the 83 NBL patients who were judged by the model to be at risk of progression, 58 were positive for MYCN gene amplification and 25 were negative for MYCN gene amplification. Among the 185 NBL patients who were judged by the model to be in the natural regression or remission group, 1 was positive for MYCN gene amplification and 184 were negative for MYCN gene amplification. Therefore, the sensitivity of MYCN gene amplification for high-risk diagnosis of NBL is 73.42%, and the specificity is 89.52%, while the sensitivity of predicting high-risk NBL in Ms stage by the model of Example 1 of the present invention is 92.77%, and the specificity is 95.81%, which are significantly higher than the high-risk stratification function of only the MYCN gene amplification indicator ( Figure 2 ).

[0038] Table 2

[0039] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A system for diagnosing spontaneous tumor regression in children with Ms stage neuroblastoma, characterized in that: It includes: an information acquisition module, a calculation module and a diagnosis module; The information acquisition module is used to execute the step of acquiring the reads value of the mature form of the target miRNA and its isomers in the sample to be tested; the isomers include the first isomer, the second isomer, the third isomer and the fourth isomer; The first isoform lacks 1 nucleotide at the 3' end relative to the mature form of its target miRNA; The second isoform lacks 2 nucleotides relative to the 3' end of its target miRNA mature form; The third isoform has one more nucleotide at the 3' end relative to the mature form of its target miRNA; The fourth isoform has 2 additional nucleotides relative to the 3' end of its target miRNA mature form; The sample to be tested is from a child neuroblastoma patient to be identified who is in the Ms stage; The calculation module is used to execute the step of substituting the reads value into the calculation model to calculate the threshold value; The diagnostic module is used to perform the step of determining the possibility of natural regression of the tumor in the pediatric neuroblastoma patient to be identified according to the threshold value; The target miRNA mature body includes at least one of the following 18 miRNA molecules: hsa-let-7i-5p, hsa-miR-122-5p, hsa-miR-143-3p, hsa-miR-145-5p, hsa-miR-146a-5p, hsa-miR-148b-3p, hsa-miR-223-3p, hsa-miR-26 b-5p, hsa-miR-27b-3p, hsa-miR-28-3p, hsa-miR-29a-3p, hsa-miR-30e-5p, hsa-miR-320a -3p, hsa-miR-34a-5p, hsa-miR-423-5p, hsa-miR-7-5p, hsa-miR-92a-3p, and hsa-miR-9a-3p.

2. The system according to claim 1, characterized in that The mathematical formula of the calculation model in the calculation module is as follows or its equivalent modified formula: S=1.67×R1+2.34×R2+8.04×R3+4.76×R4+7.12×R5+1.45×R6+1.64×R7+9.31×R8+3.26×R9+7.1 8×R10+5.64×R11+5.07×R12+9.78×R13+2.06×R14+6.54×R15+6.03×R16+1.35×R17+1.69×R18; Among them, S represents the score value for identifying spontaneous tumor regression in children with neuroblastoma; R1-R18 represent the read ratios of the following target miRNA mature molecules and their corresponding isomers, respectively; hsa-let-7i-5p, hsa-miR-122-5p, hsa-miR-143-3p, hsa-miR-145-5p, hsa-miR-146a-5p, hsa-miR-148b-3p, hsa-miR-223-3p, hsa-miR -26b-5p, hsa-miR-27b-3p, hsa-miR-28-3p, hsa-miR-29a-3p, hsa-miR-30e-5p, hsa-miR-320 a-3p, hsa-miR-34a-5p, hsa-miR-423-5p, hsa-miR-7-5p, hsa-miR-92a-3p, and hsa-miR-9a-3p; The reads ratio of each target miRNA mature molecule to its corresponding isomer is calculated according to the following mathematical formula or its equivalent modified formula: R n =(R 第二异构体 / R 目标miRNA成熟体 +R 第一异构体 / R 目标miRNA成熟体 ) / (R 第三异构体 / R 目标miRNA成熟体 + R 第四异构体 / R 目标miRNA成熟体 ); n is selected from any positive integer between 1 and 18.

3. The system according to claim 2, characterized in that The diagnosis module makes a judgment based on the S value in the following manner: If S>35.80, the tumor is judged to be unable to regress on its own and is at risk of progression; If S < 27.60, the tumor is judged to be regressing or remitting without intervention; If 27.60≤S≤35.80, no judgment is made. It is recommended to retest or combine other clinical indicators for judgment.

4. The system according to any one of claims 1 to 3, characterized in that: The sample to be tested is derived from plasma exosomes of a child neuroblastoma patient to be identified.

5. The system according to any one of claims 1 to 3, characterized in that: The nucleotide sequences of hsa-let-7i-5p, hsa-miR-122-5p, hsa-miR-143-3p, hsa-miR-145-5p, hsa-miR-146a-5p, hsa-miR-148b-3p, hsa-miR-223-3p, hsa-miR-26b-5p, hsa-miR-27b-3p, hsa-miR-28-3p, hsa-miR-29a-3p, hsa-miR-30e-5p, hsa-miR-320a-3p, hsa-miR-34a-5p, hsa-miR-423-5p, hsa-miR-7-5p, hsa-miR-92a-3p and hsa-miR-9a-3p are shown in SEQ ID NO.1-18, respectively.

6. A kit for diagnosing tumor regression in children with Ms stage neuroblastoma, characterized in that: The kit can detect reagents for the reads values ​​of the mature form of the target miRNA and its isoforms; The target miRNA mature body includes at least one of the following 18 miRNA molecules: hsa-let-7i-5p, hsa-miR-122-5p, hsa-miR-143-3p, hsa-miR-145-5p, hsa-miR-146a-5p, hsa-miR-148b-3p, hsa-miR-223-3p, hsa-miR-26b- 5p, hsa-miR-27b-3p, hsa-miR-28-3p, hsa-miR-29a-3p, hsa-miR-30e-5p, hsa-miR-320a- 3p, hsa-miR-34a-5p, hsa-miR-423-5p, hsa-miR-7-5p, hsa-miR-92a-3p, and hsa-miR-9a-3p; The isoform lacks or increases 1-2 nucleotides relative to the 3' end of the mature miRNA of the target miRNA.

7. The kit according to claim 6, characterized in that The isomers include a first isomer, a second isomer, a third isomer and a fourth isomer; The first isoform lacks 1 nucleotide at the 3' end relative to the mature form of its target miRNA; The second isoform lacks 2 nucleotides relative to the 3' end of its target miRNA mature form; The third isoform has one more nucleotide at the 3' end relative to the mature form of its target miRNA; The fourth isoform has two additional nucleotides at the 3' end relative to the mature form of its target miRNA.

8. The kit according to claim 6 or 7, characterized in that The detection samples of the kit are derived from plasma exosomes of childhood neuroblastoma patients in the Ms stage.

9. The kit according to claim 6 or 7, characterized in that The kit also includes an instruction manual, which records the following calculation formula or its equivalent modified formula: S=1.67×R1+2.34×R2+8.04×R3+4.76×R4+7.12×R5+1.45×R6+1.64×R7+9.31×R8+3.26×R9+7.1 8×R10+5.64×R11+5.07×R12+9.78×R13+2.06×R14+6.54×R15+6.03×R16+1.35×R17+1.69×R18; Among them, S represents the score value for identifying spontaneous tumor regression in children with neuroblastoma; R1-R18 represent the read ratios of the following target miRNA mature molecules and their corresponding isomers, respectively; hsa-let-7i-5p, hsa-miR-122-5p, hsa-miR-143-3p, hsa-miR-145-5p, hsa-miR-146a-5p, hsa-miR-148b-3p, hsa-miR-223-3p, hsa-miR -26b-5p, hsa-miR-27b-3p, hsa-miR-28-3p, hsa-miR-29a-3p, hsa-miR-30e-5p, hsa-miR-320 a-3p, hsa-miR-34a-5p, hsa-miR-423-5p, hsa-miR-7-5p, hsa-miR-92a-3p, and hsa-miR-9a-3p; The reads ratio of each target miRNA mature molecule to its corresponding isomer is calculated according to the following mathematical formula or its equivalent modified formula: R n =(R 第二异构体 / R 目标miRNA成熟体 +R 第一异构体 / R 目标miRNA成熟体 ) / (R 第三异构体 / R 目标miRNA成熟体 + R 第四异构体 / R 目标miRNA成熟体 ); n is selected from any positive integer between 1 and 18; If S>35.80, the tumor is judged to be unable to regress on its own and is at risk of progression; If S < 27.60, the tumor is judged to be regressing or remitting without intervention; If 27.60≤S≤35.80, no judgment is made. It is recommended to retest or combine other clinical indicators for judgment.

10. The kit according to claim 6 or 7, characterized in that The nucleotide sequences of hsa-let-7i-5p, hsa-miR-122-5p, hsa-miR-143-3p, hsa-miR-145-5p, hsa-miR-146a-5p, hsa-miR-148b-3p, hsa-miR-223-3p, hsa-miR-26b-5p, hsa-miR-27b-3p, hsa-miR-28-3p, hsa-miR-29a-3p, hsa-miR-30e-5p, hsa-miR-320a-3p, hsa-miR-34a-5p, hsa-miR-423-5p, hsa-miR-7-5p, hsa-miR-92a-3p and hsa-miR-9a-3p are shown in SEQ ID NO.1-18, respectively.

Images