RNA aptamers binding to ASP7967 or analogs thereof

Abstract

The purpose of the present invention is to provide an RNA aptamer capable of binding to ASP7967 or an analogue thereof. The RNA aptamer of the present invention is an RNA aptamer capable of binding to ASP7967 or an analog thereof, comprising: a sequence:-X1-L1-X2-L2-X3-wherein X1 has the sequence Y1GY2GY3Y4Y5; l1 is a first stem-loop nucleotide sequence comprising a first stem region, a first loop region and a second stem region, wherein the first stem region and the second stem region are two or more base pairs long and are substantially complementary to each other; x2 is A, G, C or U, L2 is a second stem-loop nucleotide sequence comprising a third stem region, a second loop region and a fourth stem region wherein the third stem region and the fourth stem region are two or more base pairs long and substantially complementary to each other; and wherein the first base in the third stem region is G and the last base in the fourth stem region is C; x3 has a sequence UY6; y1, Y2, Y3, Y4, Y5 and Y6 are each independently A, G, C or U; or a sequence:-S1-X2-L2-X3-L3-X1-S2-wherein S1 and S2 are each independently A, G, C or U, and S1 and S2 are capable of forming a base pair or a wobble base pair with each other; l3 is a third stem-loop nucleotide sequence comprising a fifth stem region, a third loop region and a sixth stem region, wherein the fifth stem region and the sixth stem region are one or more base pairs long and are substantially complementary to each other; and X1, X2, X3 and L2 are as defined above; or a sequence:-S3-X3-L3-X1-L1-X2-S4-, wherein S3 is C and S4 is G; and X1, X2, X3, L1 and L3 are as defined above.

Description

Technical Field

[0001] The present invention relates to RNA aptamers that bind to ASP7967 or an analog thereof. Background Art

[0002] Chemical modulation of gene expression by small molecules enables precise control of the timing and level of gene expression in mammalian cells 1 Such gene switches are extremely valuable for basic research as well as for practical applications such as metabolic engineering and gene / cell therapy. 2 Although conventional gene switches based on protein transcription factors (such as Tet-ON and Tet-OFF systems) have shown excellent gene regulation 3,4 , but for many applications, there are some inherent disadvantages, such as the immunogenicity of foreign protein components, large gene size and the need to use engineered promoters.

[0003] Alternatively, riboswitches have emerged as a new class of gene switches that are independent of exogenous protein factors. 5-7 These riboswitches typically employ RNA aptamers that specifically bind to small molecules. The structural changes that typically accompany aptamer-ligand binding are exploited to regulate gene expression through a variety of mechanisms. 8 . Summary of the invention

[0004] Problem that the invention aims to solve

[0005] Although RNA aptamers that bind to various small molecules can be generated through systematic evolution of ligands by exponential enrichment (SELEX) 9 Aptamers are selected in vitro from random RNA sequences, but such aptamers do not always function in a cellular setting or as part of a riboswitch. Therefore, the small molecules and their cognate aptamers that have been used to design mammalian riboswitches are quite limited. 10 Theophylline and tetracycline and their aptamers discovered by SELEX have been widely used to synthesize mammalian riboswitches. 11-22 Similarly, we and others have used natural aptamers from bacterial guanine-responsive riboswitches to prepare mammalian riboswitches. 14,19,20,23-32 Recently, ciprofloxacin, hypoxanthine, (6R,S)-folinic acid, and cyclic di-GMP and their aptamers have been used to construct mammalian riboswitches. 16,33 It should be noted that most of these riboswitches require relatively high concentrations (~100 μM or higher) of small molecules to achieve maximal gene regulation 16,20,33 .

[0006] Therefore, additional small molecules and aptamers that function in mammalian cells are needed to expand the applications of riboswitches.

[0007] Therefore, an object of the present invention is to provide an RNA aptamer capable of binding to ASP7967 or an analog thereof.

[0008] Solutions for solving problems

[0009] To address the above issues, we have explored novel aptamer-ligand pairs that are compatible with applications in mammalian cells. We discovered the RNA aptamer AC17-4, which binds to the previously reported small molecule ASP2905. 34-36 and its analogue ASP7967( Figure 2a ), the dissociation constant (K D ) is ~50nM. The aptamer was combined with the self-cleaving ribozyme scaffold reported so far (circularly arranged pistol, CPP) 27 The riboswitch was combined to generate a riboswitch that activates gene expression in response to a small molecule in HEK293 cells. The riboswitch was then incorporated into an adeno-associated virus serotype 8 (AAV8) vector expressing human erythropoietin (hEPO) for in vivo regulation of hEPO expression using orally administered ASP7967.

[0010] Therefore, the present invention relates to the following:

[0011] (1) An RNA aptamer that binds to ASP7967 or an analog thereof, the aptamer comprising:

[0012] sequence:

[0013] -X 1 -L 1 -X 2 -L 2 -X 3 -

[0014] in

[0015] X 1 With sequence Y 1 GY 2 GY 3 Y 4 Y 5 ,

[0016] L 1 is a first stem-loop nucleotide sequence comprising a first stem region, a first loop region, and a second stem region, wherein the first stem region and the second stem region are 2 or more base pairs long and are substantially complementary to each other;

[0017] X 2 is A, G, C or U,

[0018] L 2is a second stem-loop nucleotide sequence comprising a third stem region, a second loop region, and a fourth stem region, wherein the third stem region and the fourth stem region are 2 or more base pairs long and are substantially complementary to each other; and wherein the first base in the third stem region is G and the last base in the fourth stem region is C;

[0019] X 3 With sequence UY 6 ;and

[0020] Y 1 , Y 2 , Y 3 , Y 4 , Y 5 and Y 6 are each independently A, G, C or U; or

[0021] sequence:

[0022] -S 1 -X 2 -L 2 -X 3 -L 3 -X 1 -S 2 -

[0023] in

[0024] S 1 and S 2 are each independently A, G, C or U, and S 1 and S 2 Able to form base pairs or wobble base pairs with each other;

[0025] L 3 is a third stem-loop nucleotide sequence comprising a fifth stem region, a third loop region, and a sixth stem region, wherein the fifth stem region and the sixth stem region are 1 or more base pairs long and are substantially complementary to each other; and

[0026] X 1 , X 2 , X 3 and L 2 as defined above; or

[0027] sequence:

[0028] -S 3 -X 3 -L 3 -X 1 -L 1 -X 2 -S 4 -

[0029] in

[0030] S 3 C and S 4 is G; and

[0031] X 1 , X 2 , X 3 , L 1 and L 3 As defined above.

[0032] (2) the RNA aptamer described in (1) above,

[0033] in

[0034] Y 2 Selected from A or U;

[0035] Y 3 Selected from A or U; and / or

[0036] Y 4 Select from G or C.

[0037] (3) the RNA aptamer described in (2) above,

[0038] in

[0039] Y 2 is A;

[0040] Y 3 is A; and / or

[0041] Y 4 For G.

[0042] (4) the RNA aptamer described in (1) above,

[0043] in

[0044] Y 1 and Y 6 Capable of forming base pairs or wobble base pairs with each other.

[0045] (5) the RNA aptamer described in (1) above,

[0046] in

[0047] Y 1 G and Y 6 is U; or

[0048] Y 1 U and Y 6 For G.

[0049] (6) the RNA aptamer described in (1) above,

[0050] in

[0051] The first stem region and the second stem region are 3 to 7 base pairs long and are substantially complementary to each other. (7) The RNA aptamer described in (1) above,

[0052] in

[0053] The first stem region and the second stem region are 5 base pairs long and are substantially complementary to each other.

[0054] (8) the RNA aptamer described in (1) above,

[0055] in

[0056] The first stem region has the sequence GACGG and the second stem region has the sequence CCGUC.

[0057] (9) the RNA aptamer described in (1) above,

[0058] in

[0059] The first loop region has 3 to 7 bases.

[0060] (10) the RNA aptamer described in (1) above,

[0061] in

[0062] The first loop region has the sequence AUU or UUCG.

[0063] (11) the RNA aptamer described in (1) above,

[0064] in

[0065] The third stem region and the fourth stem region have 1 to 5 base pairs and are substantially complementary to each other.

[0066] (12) the RNA aptamer described in (1) above,

[0067] in

[0068] The third stem region and the fourth stem region have 3 or 4 base pairs and are substantially complementary to each other

[0069] (13) the RNA aptamer described in (1) above,

[0070] in

[0071] The third stem region has the sequence GCG and the fourth stem region has the sequence CGC; or

[0072] The third stem region has the sequence GCGU and the fourth stem region has the sequence ACGC.

[0073] (14) the RNA aptamer described in (1) above,

[0074] in

[0075] The second loop region has 3 to 7 bases.

[0076] (15) the RNA aptamer described in (1) above,

[0077] in

[0078] The second loop region has the sequence AAUUCA or UUCG.

[0079] (16) The RNA aptamer described in (1) above, wherein the RNA aptamer comprises the sequence: -X 1 -L 1 -X 2 -L 2 -X 3 - and further includes X 1 The fifth stem region adjacent to the 5' end and X 3 The fifth stem region is adjacent to the 3' end of the first stem region, wherein the fifth stem region and the sixth stem region have 1 to 15 base pairs and are substantially complementary to each other, and wherein the fifth stem region and the sixth stem region form a double-stranded stem.

[0080] (17) the RNA aptamer described in (1) above,

[0081] in

[0082] The fifth stem region and the sixth stem region are 3 to 7 base pairs in length and are substantially complementary to each other.

[0083] (18) the RNA aptamer described in (1) above,

[0084] in

[0085] The fifth stem region and the sixth stem region are 4 base pairs long and are substantially complementary to each other.

[0086] (19) the RNA aptamer described in (1) above,

[0087] in

[0088] The fifth stem region has the sequence CUUG and the sixth stem region has the sequence CAAG.

[0089] (20) the RNA aptamer described in (1) above,

[0090] in

[0091] The third loop region has 3 to 7 bases.

[0092] (21) the RNA aptamer described in (1) above,

[0093] in

[0094] The third loop region has the sequence UUCG.

[0095] (22) the RNA aptamer described in (1) above,

[0096] in

[0097] S 1 C and S 2 is G; or

[0098] S 1 G and S 2 For C.

[0099] (23) The RNA aptamer described in (1) above, wherein the RNA aptamer comprises the sequence: -S 1 -X 2 -L 2 -X 3 -L 3 -X 1 -S 2 - and further comprises S 1 The 5' end of the seventh stem region is adjacent to the S 2 The seventh stem region is adjacent to the 3' end of the gene, wherein the seventh stem region and the eighth stem region have 1 to 15 base pairs and are substantially complementary to each other, and wherein the seventh stem region and the eighth stem region form a double-stranded stem.

[0100] (24) The RNA aptamer described in (1) above, wherein the RNA aptamer comprises the sequence: -S 3 -X 3 -L 3 -X 1 -L 1 -X 2 -S 4 - and further comprises S 3 The 5' end of the ninth stem region is adjacent to the S 4 The ninth stem region is adjacent to the 3' end of the ninth stem region, wherein the ninth stem region and the tenth stem region have 1 to 15 base pairs and are substantially complementary to each other, and wherein the ninth stem region and the tenth stem region form a double-stranded stem.

[0101] (25) the RNA aptamer described in (1) above,

[0102] The RNA aptamers are arranged circularly.

[0103] (26) the RNA aptamer described in (1) above,

[0104] Among them, the analog of ASP7967 is ASP2905.

[0105] (27) An RNA or DNA vector comprising the RNA aptamer described in (1) above or a DNA sequence that can be transcribed into the RNA aptamer described in (1) above.

[0106] (28) A riboswitch comprising the RNA aptamer described in (1) above.

[0107] (29) An RNA or DNA vector comprising the riboswitch described in (28) above or a DNA sequence that can be transcribed into the riboswitch described in (28) above.

[0108] (30) The RNA or DNA vector described in (29) above, further comprising a target sequence operably linked to the riboswitch or the DNA sequence, wherein the target sequence encodes a protein; or wherein the target sequence is siRNA, pre-miRNA, pri-miRNA, sgRNA, lncRNA, RNA aptamer, ribozyme, tRNA or rRNA; or a DNA sequence that can be transcribed into siRNA, pre-miRNA, pri-miRNA, sgRNA, lncRNA, RNA aptamer, ribozyme, tRNA or rRNA.

[0109] (31) An isolated polynucleotide comprising:

[0110] A riboswitch comprising an RNA aptamer capable of binding to ASP7967 or an analog thereof, or a DNA sequence capable of being transcribed into the riboswitch, and

[0111] The target sequence encoding the protein,

[0112] The riboswitch is operably linked to the target sequence such that expression of the protein is upregulated or downregulated in response to ASP7967 or an analog thereof.

[0113] (32) The polynucleotide described in (31) above, wherein the target sequence comprises a plurality of exons.

[0114] (33) The polynucleotide described in (32) above, wherein the target sequence comprises an alternatively spliced ​​exon flanked by a 5' intron and a 3' intron, wherein the alternatively spliced ​​exon comprises a stop codon, wherein when the alternatively spliced ​​exon is spliced ​​into the mRNA of the protein, the stop codon is in-frame with the protein.

[0115] (34) The polynucleotide described in (31) above, wherein the polynucleotide further comprises a 3'UTR containing a polyadenylation signal sequence, and wherein the riboswitch is inserted in the 3'UTR and on the 5' side of the polyadenylation signal sequence, and wherein the function of the polyadenylation signal sequence is regulated by the riboswitch.

[0116] (35) The polynucleotide described in (34) above, wherein the riboswitch further comprises a self-cleaving ribozyme.

[0117] (36) The polynucleotide described in (35) above, wherein the self-cleaving ribozyme is activated when the aptamer binds to ASP7967 or an analog thereof, or the self-cleaving ribozyme is inactivated when the aptamer binds to ASP7967 or an analog thereof.

[0118] (37) A kit for regulating protein expression, comprising

[0119] ASP7967 or its analogs, and

[0120] The polynucleotide described in (31) above or a vector comprising the polynucleotide described in (31) above.

[0121] (38) The kit described in (37) above,

[0122] The kit is used for treating a disease.

[0123] (39) The kit described in (38) above,

[0124] The disease is a central nervous system disease, cognitive impairment or KCNH 3 Related diseases.

[0125] (40) The kit described in (39) above,

[0126] The disease is ADHD, Parkinson's disease, Alzheimer's disease or schizophrenia.

[0127] (41) A method for regulating protein expression in vivo, the method comprising:

[0128] introducing the polynucleotide described in (31) above or a vector comprising the polynucleotide described in (31) above into a cell, and

[0129] ASP7967 or an analog thereof is contacted with the polynucleotide or the vector.

[0130] (42) A method for treating or preventing a disease, the method comprising:

[0131] introducing the polynucleotide described in (31) above or a vector comprising the polynucleotide described in (31) above into a subject, and

[0132] ASP7967 or an analog thereof is contacted with the subject.

[0133] (43) The method described in (42) above,

[0134] The disease is a central nervous system disease, cognitive impairment or KCNH 3 Related diseases.

[0135] (44) The method described in (43) above,

[0136] The disease is ADHD, Parkinson's disease, Alzheimer's disease or schizophrenia.

[0137] (45) A method for treating a disease, comprising:

[0138] ASP7967 or an analog thereof is administered to a subject receiving gene therapy using a vector comprising the polynucleotide described in (31) above.

[0139] (46) The method described in (45) above,

[0140] Wherein the target sequence encodes a protein selected from the group consisting of:

[0141] 4-1BB ligand, 5-helix, human CC chemokine, human L105 chemokine, human L105 chemokine designated as huL105_3, monokine induced by gamma interferon (MIG), part of CXCR4B protein, platelet basic protein (PBP), α1-antitrypsin, ACRP-30 homolog; complement component C1q C, adenoid-expressed chemokine (ADEC), aFGF; FGF-1, AGF, AGF protein, albumin, etoposide, angiostatin, anthrax vaccine, antibodies specific for brain degeneration protein, antistasin, anti-TGFβ family antibodies, antithrombin III, APM-1; ACRP-30; Famoxin, apo-lipoprotein species), arylsulfatase B, b57 protein, BCMA, β-thromboglobulin (β-TG), bFGF; FGF2, blood coagulation factors, BMP processing enzyme Furin, BMP-10, BMP-12, BMP-15, BMP-17, BMP-18, BMP-2B, BMP-4, BMP-5, BMP-6, BMP-9, bone morphogenetic protein-2, calcitonin, calpain-10a, calpain-10b, calpain-10c, cancer vaccines, carboxypeptidase, CC chemokine, MCP2, CCR5 variant, CCR7, CCR7, CD11a Mab, CD137; 4-1BB receptor protein, CD20 Mab, CD27, CD27L, CD30, CD30 ligand, CD33 immunotoxin, CD40, CD40L, CD52 Mab, Cerebus protein, Chemokine Eotaxin, Chemokine hIL-8, Chemokine hMCP1, Chemokine hMCP1a, Chemokine hMCP1b, Chemokine hMCP2, Chemokine hMCP3, Chemokine hSDF1b, Chemokine MCP-4, Chemokine TECK and TECK variants, Chemokine-like protein IL-8M1 full length and mature, Chemokine-like protein IL-8M10 full length and mature, Chemokine-like protein IL-8M3, Chemokine-like protein IL -8M8 full length and mature, chemokine-like protein IL-8M9 full length and mature, chemokine-like protein PF4-414 full length and mature, chemokine-like protein PF4-426 full length and mature, chemokine-like protein PF4-M2 full length and mature, cholera vaccine, chondroitin-like protein, c-kit ligand; SCF; mast cell growth factor; MGF; fibrosarcoma-derived stem cell factor, CNTF and its fragments, pro- and active forms of coagulation factors, collagen, complement C5Mab, connective tissue activation protein-III,CTAA16.88 Mab, CTAP-III, CTLA4-Ig, CTLA-8, CXC3, CXC3, CXCR3; CXC chemokine receptor 3, cyanovirin-N, Darbepoetin, exodus, huL105_7, DIL-40, Dnase, EDAR, EGF receptor Mab, ENA-78, endostatin, Eotaxin, epithelial neutrophil activation protein-78, EPO receptor ; EPOR, erythropoietin (EPO) and EPO mimetics, Eutropin, Exodus protein, factor IX, factor VII, factor VIII, factor X and factor XIII, FAS ligand inhibitory protein (DcR3), FasL, FasL, FasL, FGF, FGF-12; fibroblast growth factor homologous factor-1, FGF-15, FGF-16, FGF-18, FGF-3; INT-2, FGF-4; gelonin, HST-1; HBGF-4, FG F-5, FGF-6; heparin-binding secretory transforming factor-2, FGF-8, FGF-9; glial-activating factor, flt-1, flt-3 ligand, follicle-stimulating hormone alpha subunit, follicle-stimulating hormone beta subunit, follitropin, Fractalkine, fragment, myofibrillar troponin I, FSH, galactosidase, galectin-4, G-CSF, GDF-1, gene therapy, glioma-derived growth factor, glucagon, glucagon-like peptide, glucocerebrosidase, glucose oxidase, glucosidase enzyme, Glycodelin-A; progesterone-related endometrial protein, GM-CSF, gonadotropin, granulocyte chemoattractant protein-2 (GCP-2), granulocyte-macrophage colony-stimulating factor, growth hormone, growth-regulated oncogene-α (GRO-α), growth-regulated oncogene-β (GRO-β), growth-regulated oncogene-γ (GRO-γ), hAPO-4; TROY, hCG, hepatitis B surface antigen, hepatitis B vaccine, HER2 receptor Mab, hirudin, HIV gp120, HIV gp41, HIV inhibitory peptide, HIV inhibitory peptide, HIV inhibitory peptide, HIV protease inhibitory peptide, HIV-1 protease inhibitor, HPV vaccine, human 6CKine protein, human Act-2 protein, human adipogenesis inhibitory factor, human B cell stimulating factor-2 receptor, human β-chemokine H1305 (MCP-2), human CC chemokine DGWCC, human CC chemokine ELC protein, human CC-type chemokine interleukin C, human CCC3 protein, human CCF18 chemokine, human CC-type chemokine protein named SLC (secondary lymphoid chemokine),Human chemokine beta-8 short forms, human chemokine C10, human chemokine CC-2, human chemokine CC-3, human chemokine CCR-2, human chemokine Ckβ-7, human chemokine ENA-78, human chemokine eotaxin, human chemokine GROα, human chemokine GROα, human chemokine GROβ, human chemokine HCC-1, human chemokine HCC-1, human chemokine 1-309, human chemokine IP-10, human chemokine L105_3, human chemokine L10 5_7, human chemokine MIG, human chemokine MIG-β protein, human chemokine MIP-1α, human chemokine MIP1β, human chemokine MIP-3α, human chemokine MIP-3β, human chemokine PF4, human chemokine protein 331D5, human chemokine protein 61164, human chemokine receptor CXCR3, human chemokine SDF1α, human chemokine SDF1β, human chemokine ZSIG-35, human Chr19Kine protein, human CKβ-9, human CKβ-9, human CX3C 111 amino acid chemokine, human DNAX interleukin-40, human DVic-1 CC chemokine, human EDIRF I protein sequence, human EDIRFII protein sequence, human eosinophil CC type chemokine eotaxin, human eosinophil-expressed chemokine (EEC), human fast twitch skeletal muscle troponin C C), human fast-twitch skeletal muscle troponin I, human fast-twitch skeletal muscle troponin subunit C, human fast-twitch skeletal muscle troponin subunit I protein, human fast-twitch skeletal muscle troponin subunit T, human fast-twitch skeletal muscle troponin T, chemokines expressed by human fetal spleen, FSEC, human GM-CSF receptor, human gro-α chemokine, human gro-β chemokine, human gro-γ chemokine, human IL-16 protein, human IL-1RD10 protein sequence, human IL-1RD9, human IL-5 receptor α chain, human IL-6 receptor, human IL-8 receptor protein hIL8RA, human IL -8 receptor protein hIL8RB, human IL-9 receptor protein, human IL-9 receptor protein variant #3, human IL-9 receptor protein variant fragment, human IL-9 receptor protein variant fragment #3, human interleukin 1δ, human interleukin 10, human interleukin 10, human interleukin 18, human interleukin 18 derivative, human interleukin-1β precursor, human interleukin-1β precursor, human interleukin-1 receptor accessory protein, human interleukin-1 receptor antagonist beta, human interleukin-1 type-3 receptor, human interleukin-10 (progenitor), human interleukin-10 (progenitor),human interleukin-11 receptor, human interleukin-12 40kD subunit, human interleukin-12 beta-1 receptor, human interleukin-12 beta-2 receptor, human interleukin-12p35 protein, human interleukin-12p40 protein, human interleukin-12 receptor, human interleukin-13alpha receptor, human interleukin-13beta receptor, human interleukin-15, human interleukin-15 receptor from clone P1, human interleukin-17 receptor, human interleukin-18 protein (IL-18), human interleukin-3, human interleukin-3 receptor, human interleukin-3 variant, human interleukin-4 receptor, human interleukin-5, human interleukin-6, human interleukin- 7, human interleukin-7, human interleukin-8 (IL-8), human intracellular IL-1 receptor antagonist, human IP-10 and HIV-1gp120 hypervariable region fusion protein, human IP-10 and human Muc-1 core epitope (VNT) fusion protein, human liver and activation-regulated chemokine (LARC), human Lkn-1 full length and mature protein, human mammary gland-associated chemokine (MACK) protein full length and mature, human mature chemokine Ckβ-7, human mature gro-α, human mature gro-γ polypeptide for the treatment of sepsis, human MCP-3 and human Muc-1 core epitope (VNT) fusion protein, human MI10 protein, human MI1A protein, human monocyte chemoattractant factor hMCP-1 (Human monocyte chemoattractant factor hMCP-1), human monocyte chemoattractant factor hMCP-3, human monocyte chemoattractant proprotein (MCPP) sequence, human neuroattractant chemokine chemokine-like domain, human non-ELR CXC chemokine H174, human non-ELR CXC chemokine IP10, human non-ELR CXC chemokine Mig, human PAI-1 mutant, human protein with IL-16 activity, human protein with IL-16 activity, human secondary lymphoid tissue chemokine (SLC), human SISD protein, human STCP-1, human stromal cell-derived chemokine, SDF-1, human chemokine expressed by mixed lymphocyte reaction of T cells (TMEC), human thymus and activation-regulated cytokine (TARC), human thymus-expressed, human TNF-α, human TNF-α, human TNF-β (LT-α), human CC-type chemokine eotaxin 3 protein sequences, human type II interleukin-1 receptor, human wild-type interleukin-4 (hIL-4) protein, human ZCHEMO-8 protein, humanized anti-VEGF antibody and its fragments, humanized anti-VEGF antibody and its fragments, hyaluronidase, ICE 10kD subunit, ICE 20kD subunit, ICE 22kD subunit, iduronate-2-sulfatase,Iduronidase, IL-1α, IL-1β, IL-1 inhibitor (IL-1i), IL-1 maturation, IL-10 receptor, IL-11, IL-11, IL-12p40 subunit, IL-13, IL-14, IL-15, IL-15 receptor, IL-17, IL-17 receptor, II-17 receptor, II-17 receptor, IL-19, IL-li fragment, IL1-receptor antagonist, IL-21 (TIF ), IL-3-containing fusion proteins, IL-3 mutant proteins, IL-3 variants, IL-3 variants, IL-4, IL-4 mutant proteins, IL-4 mutant proteins Y124G, IL-4 mutant proteins Y124X, IL-4 mutant proteins, II-5 receptor, IL-6, II-6 receptor, IL-7 receptor clone, IL-8 receptor, IL-9 mature protein variant (Met117 type), immunoglobulins or immunoglobulin-based molecules or fragments of any of them (e.g., Small Modular ImmunoPharmaceutical, TM("SMIP") or dAb, Fab' fragment, F(ab')2, scAb, scFv or scFv fragment), including but not limited to plasminogen, influenza vaccine, inhibin alpha, inhibin beta, insulin, insulin-like growth factor, integrin Mab, inter-alpha trypsin inhibitor, inter-alpha trypsin inhibitor, interferon gamma-induced protein (IP-10), interferons (such as interferon alpha species and subspecies, interferon beta species and subspecies, interferon gamma species and subspecies), interferons (such as interferon alpha species and subspecies, interferon beta species and subspecies, interferon gamma species and subspecies), white blood cells Interleukin 6, Interleukin 8 (IL-8) receptor, Interleukin 8 receptor B, Interleukin-1α, Interleukin-2 receptor-associated protein p43, Interleukin-3, Interleukin-4 mutant protein, Interleukin-8 (IL-8) protein, Interleukin-9, Interleukin-9 (IL-9) mature protein (Thr117 type), Interleukins (such as IL0, IL11 and IL2), Interleukins (such as IL0, IL11 and IL2), Japanese encephalitis vaccine, Kalikrein inhibitor, Keratinocyte growth factor (Keratinocyte growth factor), Kunitz domain proteins (such as aprotinin, amyloid precursor protein and those described in WO03 / 066824, with or without albumin fusion), Kunitz domain proteins, aprotinin, amyloid precursor protein with or without albumin fusion, LACI, lactoferrin, potential TGF-beta binding protein II, leptin, liver expressed chemokine-1 (LVEC-1), liver expressed chemokine-2 (LVEC-2), LT-α, LT-β, ​​luteinizing hormone, Lyme Vaccine, Lymphotactin, macrophage derived chemokine analog MDC(n+1), macrophage derived chemokine analog MDC-eyfy, macrophage derived chemokine analog MDC-yl, macrophage derived chemokine, MDC, macrophage derived chemokine (MDC), Maspin;Proteinase inhibitor 5, MCP-1 receptor, MCP-1a, MCP-1b, MCP-3, MCP-4 receptor, M-CSF, melanoma inhibitory protein, membrane-bound protein, Met117 human interleukin 9, MIP-3α, MIP-3β, MIP-γ, MIRAP, modified Rantes, monoclonal antibody, MP52, mutant interleukin 6S176R, myofibrillar contractile protein troponin I, natriuretic peptide (Natriuretic peptide Peptide), nerve growth factor-β, nerve growth factor-β2, neuropilin-1, neuropilin-2, neurochemokine, neurotrophin-3, neurotrophin-4, neurotrophin-4a, neurotrophin-4b, neurotrophin-4c, neurotrophin-4d, neutrophil-activating peptide-2 (NAP-2), NOGO-66 receptor, NOGO-A, NOGO-B, NOGO-C, a new β-chemokine named PTEC, N-terminally modified chemokine GroHE K / hSDF-1α, N-terminally modified chemokine GroHEK / hSDF-1β, N-terminally modified chemokine met-hSDF-1α, N-terminally modified chemokine met-hSDF-1β, OPGL, osteogenic protein-1; OP-1; BMP-7, osteogenic protein-2, OX40; ACT-4, OX40L, oxytocin (neurohypophysis transporter I), parathyroid hormone, Patched, Patched-2, PDGF-D, Pertussis toxoid, pituitary-expressed chemokine (PGEC), placenta growth factor, placenta growth factor-2, plasminogen activator inhibitor-1; PAI-1, plasminogen activator inhibitor-2; PAI-2, plasminogen activator inhibitor-2;PAI-2, platelet-derived growth factor, platelet-derived growth factor Bv-sis, platelet-derived growth factor precursor A, platelet-derived growth factor precursor B, platelet Mab, platelet-derived endothelial cell growth factor (PD-ECGF), platelet-derived growth factor A chain, platelet-derived growth factor B chain, polypeptide for the treatment of sepsis, preproapolipoprotein "milano" variant, preproapolipoprotein "paris" variant, prothrombin, primate CC chemokine "ILINCK", primate CXC chemokine "IBICK", proinsulin, prolactin, prolactin 2, prosaptide, protease inhibitory peptide, protein C, protein S, prothrombin, prourokinase, RANTES, RANTES 8-68, RANTES 9-68, RANTES peptide, RANTES receptor, recombinant interleukin-16, resistin, restrictocin, retroviral protease inhibitor, ricin, rotavirus vaccine, RSV Mab, saporin, Sarcina, secretory and transmembrane polypeptides, secretory and transmembrane polypeptides, serum cholinesterase, serum protein, blood clotting factor factor), soluble BMP receptor kinase protein-3, soluble VEGF receptor, stem cell inhibitory factor, staphylococcal vaccine, stromal derived factor-1α, stromal derived factor-1β, substance P (tachykinin), T1249 peptide, T20 peptide, T4 endonuclease, TACI, Tarc, TGF-β1, TGF-β2, Thr117 human interleukin 9, thrombin, thrombopoietin, thrombopoietin derivative 1, thrombopoietin derivative 2, thrombopoietin derivative 3, thrombopoietin derivative 4, thrombopoietin derivative 5, thrombopoietin derivative 6, thrombopoietin derivative 7, thymus-expressed chemokine (TECK), thyroid stimulating hormone, tick anticoagulant peptide, Tim-1 protein, TNF-α precursor, TNF-R, TNF-RII; TNF p75 receptor; death receptor, tPA, transferrin, transforming growth factor β, troponin peptide, truncated monocyte chemoattractant protein 2 (6-76), truncated monocyte chemoattractant protein 2 (6-76), truncated RANTES protein (3-68), tumor necrosis factor, urate oxidase, urokinase, vasopressin (neurotropin transporter II), VEGF R-3;flt-4, VEGF receptor; KDR; flk-1, VEGF-110, VEGF-121, VEGF-138, VEGF-145, VEGF-162, VEGF-165, VEGF-182, VEGF-189, VEGF-206, VEGF-D, VEGF-E; VEGF-X, von Willebrand factor, wild-type monocyte chemoattractant protein 2, wild-type monocyte chemoattractant protein 2, ZTGF-β9, β; (T87Q) -globin, SMN1, chimeric antigen receptor, RPE65, F8, HGF, LPL, p53, apoe2, arylsulfatase A, NAGLU, SGSH, AADC, GAD, GDNF, NRTN, LCAT, GBA, FGF-1, FGF-2, ADA, CLN2, CLN6, CLN3, IDS, huntingtin, TRAIL, dystrophin, GALGT2, accA, IDUA, GLB1, FS344, SGCA, DYSF, ABCD1, Gigaxonin and functional fragments thereof.

[0142] Incidentally, each of the above-mentioned configurations (1) to (44) can be combined by arbitrarily selecting two or more.

[0143] Effects of the Invention

[0144] The RNA aptamer of the present invention has excellent binding ability to ASP7967 or its analogs. Therefore, for example, the RNA aptamer of the present invention is very useful for designing a riboswitch that can sensitively respond to the presence of ASP7967 or its analogs. BRIEF DESCRIPTION OF THE DRAWINGS

[0145] [Figure 1] Figure 1a :Compound 3 1 H NMR spectrum. Figure 1b :Compound 3 13 C NMR spectrum. Figure 1c :Compound 3 19 FNMR spectrum.

[0146] [Figure 2] Small molecule ASP2905 / ASP7967 and aptamers. a, Structures of ASP2905, ASP7967 and compound 3. b, Aptamer sequence and predicted structure. R10-6 is the initial aptamer discovered by SELEX. AC17-4 was extracted from the predicted structure of R10-6, which was found to be sufficient to bind ASP2905 and ASP7967. The predicted structure is based on mFold 38c, SPR sensorgrams of the AC17-4 immobilized chip injected with ASP2905 and ASP7967 solutions.

[0147] [ Figure 3 ] ITC measurements of AC17-4 and ASP2905. Measurements were performed at 37°C. Data are the mean ± standard deviation (SD) of two independent experiments.

[0148] [Figure 4] Mutation analysis of AC17-4. a, Mutation and its effect on K of ASP2905 D The average values ​​in brackets represent the K values ​​measured by SPR. D NB: no binding. b, K of the mutants described in a D A summary of the SPR sensorgrams is provided in FIG5 .

[0149] [Figure 5] SPR sensorgrams of the interaction between the AC17-4 mutant and ASP2905. These measurements were used to generate the data shown in Figure 4. D Values ​​are the means of two independent experiments.

[0150] [Figure 6] Mammalian riboswitches based on AC17-4. a, Sequence and secondary structure of the pistol ribozyme. Arrows indicate cleavage sites. b, AC17-4-CPP aptamer ribozyme (aptazyme) embedded in the 3'UTR of EGFP mRNA. In the absence of ligand (ASP2905 or ASP7967), the active CPP ribozyme self-cleaves at the position indicated by the arrow (structure on the left). This leads to separation of the poly(A) tail and suppressed EGFP expression (OFF). In the presence of ligand, the aptamer-ligand interaction stabilizes the aptamer ribozyme structure described on the right, in which the anti-Rz sequence (circle with black edge) invades the P1 stem and the PK pseudoknot. This interferes with the CPP structure, inactivating the ribozyme and translating the mRNA (ON). c, Induction of gene expression by the riboswitch described in b. Variants with anti-Rz sequences of different sizes were examined. Empty: no aptamer ribozyme control. Data are the average of three replicate wells, and error bars represent SD. Numbers above the bars indicate ON / OFF ratios. d, a Dose-dependent response of 8-AC17-4-CPP in response to ASP7967. Empty: no aptamer ribozyme control. Data are the mean of three replicate wells, with error bars representing SD. Numbers near data points indicate ON / OFF ratios.

[0151] [ Figure 7] MTT (cell proliferation) assay of HEK293 cells cultured in the presence of ASP2095 or ASP7967. No cytotoxicity was observed up to 10 μM. Data are the means of four replicate wells, with error bars representing SD. Statistical comparisons were performed by unpaired two-tailed t-test. ns: not significant.

[0152] [Figure 8] Riboswitch function of a8c-AC17-4-CPP in HEK293 cells. a, Sequence and secondary structure of a8c-AC17-4-CPP. b, Experimental conditions and Figure 6c Same as shown in . Empty: No aptamer ribozyme control. Data are the mean of three replicate wells, where the error bars represent SD. The numbers above each bar represent the ON / OFF ratio.

[0153] [Figure 9] Evaluation of the function of a8c-AC17-4 CPP riboswitch in AAV vectors. a, AAV vector expressing hEPO regulated by a8c-AC17-4-CPP riboswitch. b, hEPO secretion from HEK293 cells transfected with AAV vector plasmid in the absence or presence of ASP7967. Control: no riboswitch. Data are the means of three biological replicates, with error bars representing SD. c, Experimental design for animal studies. Blood was collected 24 hours before ligand administration and at multiple time points after ligand administration (2 hours, 4 hours, 6 hours, 8 hours, 24 hours). d, Injection after oral administration of ASP7967 with 3×10 per mouse 10 Time-dependent secretion of hEPO in mice with 1 vector genome (vg). Serum hEPO protein concentration was measured at the indicated time points. Mice were administered saline and vehicle or ASP7967 (WT_vehicle or WT_ASP7967, n=5), AAV8-hEPO-control and vehicle or ASP7967 (AAV8-hEPO-control_vehicle or AAV8-hEPO-control_ASP7967, n=6), AAV8-hEPO-a8c-AC17-4-CPP and vehicle (AAV8-hEPO-a8c-AC17-4-CPP_vehicle, n=7), AAV8-hEPO-a8c-AC17-4-CPP and ASP7967 (AAV8-hEPO-a8c-AC17-4-CPP_ASP7967, n=8). Data are means of biological replicates (n), with error bars representing SE.

[0154] [ Fig.10 ] Pharmacokinetics of ASP7967 in mice after oral administration. -1After oral administration to mice (BALB / cAJcl), plasma and liver concentrations of ASP7967 were measured using liquid chromatography-tandem mass spectrometry (LC-MS / MS). ASP7967 concentrations in both plasma and liver reached a maximum within the first sampling time point (1 hour) and then decreased over time. The concentration ratio of liver to plasma ranged from 2.7 to 30.6, indicating that ASP7967 was distributed to the liver.

[0155] [Figure 11] Exon skipping riboswitch based on AC17-4. a, Description of the mechanism of exon skipping riboswitch. A suicide exon containing a stop codon flanked by two intron sequences derived from intron 2 of the human β-globin gene was inserted into the EGFP gene. The AC17-4 aptamer was inserted downstream of the 5'-ss of the second intron. In the absence of a ligand, the suicide exon is incorporated into the mature mRNA. In the presence of a ligand, the 5'-ss is masked by the aptamer structure and causes exon skipping. This allows the desired protein to be expressed. b, EGFP expression regulated by exon skipping riboswitches with different P1 stabilities. c, EGFP expression regulated by an exon skipping / aptamer ribozyme dual riboswitch. bc, Empty: no aptamer ribozyme control. The data are the averages of three replicate wells, with error bars representing SD. The numbers above each bar represent the ON / OFF ratio.

[0156] [ Fig.12 ]Sequences and secondary structures of CPP-4a9-P3-9d and CPP-4a9-P3-9e aptamer ribozymes.

[0157] [Figure 13] Map and sequence of plasmid pEGFP-BsaI-Amp. The riboswitch sequences shown in Table 5 replace the sequences shown in bold underline in the corresponding riboswitch plasmid. The CMV promoter is shown as a box. The egfp gene is shaded. The bla gene (Amp R ) are shown in gray. Benchling-based plasmid maps can be obtained from the following link:

[0158] https: / / benchling.com / s / seq-rsh62LI9bm2tWJWB2Ecm?m=slm-aMKjz51vOZsXH6ySC4ih.

[0159] [Figure 14] Map and sequence of plasmid pEGFP-ex169-AC17-4-a8. The riboswitch sequences shown in Table 6 replace the corresponding riboswitch plasmids with Underlined BoldPartially displayed sequences. In the dual exon skipping / aptamer ribozyme switches (a9+g2g7 / CPP-4a9-P3-9d and a9+g2g7 / CPP-4a9-P3-9e), in addition to the ex169-AC17-4-a9+g2g7 exon skipping module, the corresponding aptamer ribozyme sequences shown in Table 5 replace the sequences shown in bold / box. CMV promoter is shown in box. EGFP exons are shown in shaded / black. Introns are shown in shaded / grey. Alternative exons are shown in uppercase / shaded. AC17-4 aptamer is shown in uppercase / bold. Anti-5'ss is shown in lowercase / bold. Bla gene (Amp R ) are shown in gray. Benchling-based plasmid maps can be obtained from the following link:

[0160] https: / / benchling.com / s / seq-kxeLdS2ELr9C4pnrZ8lr?m=slm-M8eUKmXbeUXSKPJpKyQe.

[0161] [ Fig.15 ] Aptamer sequence and predicted structure of circularly permuted AC17-4 (cpAC17-4).

[0162] [ Fig.16 ] SPR sensorgram of cpAC17-4 immobilized chip injected with ASP2905 solution. cpAC17-4 binds to ASP2905, K D is 30nM.

[0163] [ Fig.17 ] Regulation of EGFP expression by exon skipping riboswitch. The AC17-4 aptamer in the exon skipping riboswitch (ex169-AC17-4-a7, a8, a9) was replaced with cpAC17-4. cpAC17-4 functions as part of the riboswitch in HEK293 cells. DETAILED DESCRIPTION

[0164] To address the above issues, we have performed in vitro selection of RNA aptamers against the small molecule ASP7967, whose structure is closely related to ASP2905, a known inhibitor of potassium voltage-gated channel subfamily H member 3 (KCNH3). One of the selected aptamers (AC17-4) was found to be functional in HEK293 cells and was used to design aptamer ribozyme-based riboswitches that can activate gene expression (>10-fold) in the presence of as little as 5 μM ASP2905 or ASP7967 in culture medium. Aptamer ribozyme-based riboswitches were successfully used to regulate human erythropoietin (hEPO) expression in mice injected with an adeno-associated virus (AAV8) vector using orally administered ASP7967. Furthermore, by combining aptamer ribozyme-based and exon skipping riboswitch mechanisms, an ON / OFF ratio of nearly 300 was achieved at low basal expression levels in cultured cells.

[0165] In this specification, the term "aptamer" refers to an oligonucleotide or peptide molecule with high specificity and affinity for a particular substance. The term "aptamer" includes DNA aptamers, RNA aptamers, XNA aptamers and peptide aptamers. Aptamers can be of any length, such as about 1 nucleotide to about 100 nucleotides, about 5 nucleotides to about 50 nucleotides, or about 10 nucleotides to about 25 nucleotides. Aptamers composed of RNA are referred to as "RNA aptamers".

[0166] In some embodiments of the present invention, the aptamer can be used in the form of a split aptamer. In other words, the scope of the aptamer of the present invention covers split aptamers designed based on parent aptamers. Split aptamers are aptamers composed of two fragments derived from a parent aptamer (obtained by, for example, cutting the parent aptamer sequence at a loop sequence), which can bind to a target substance by forming a structure substantially identical to that of the parent aptamer when used. As will be readily appreciated by those skilled in the art, split aptamers can be used for riboswitches and other applications, just like parent aptamers.

[0167] In other embodiments of the present invention, the RNA aptamer of the present invention is a circularly permuted aptamer. The term "circular permutation of aptamers" or "circularly permuted aptamers" refers to an aptamer having a changed nucleic acid sequence in its nucleic acid sequence compared to the parent RNA sequence, and the changed nucleic acid sequence results in an RNA structure with different connectivity but a generally similar three-dimensional (3D) shape. The circular permutation of aptamers is similar to the mathematical concept of circular permutation, which means that the sequence of the first part of the parent aptamer (adjacent to the 5'-end) is related to the sequence of the second part of the resulting circularly permuted aptamer (near its 3'-end). The circular permutation of aptamers compared to their parent aptamers is obtained by genetic or artificial engineering of RNA sequences, whereby the 5'- and 3'-ends of the parent RNA are "connected" and the RNA sequence is interrupted at another site, thereby generating new 5'- and 3'-ends of the aptamer. Optionally, additional sequences can be inserted between the original 5'- and 3'-ends. The additional sequence can form a stem-loop structure. Alternatively, in the case where the stem structure is formed in the region near the original 5'- and 3'-ends, the length of the stem structure can be varied. The cyclically arranged aptamers of the present invention are the result of the 5'- and 3'-ends of the parent aptamer sequences connected and the sequence cut or interrupted at the accessible or exposed site (preferentially at the loop) of the aptamer, whereby the folding of the cyclically arranged aptamer is retained or similar to the folding of the parent aptamer. The connection of the 5'- and 3'-ends in the cyclically arranged aptamer can be the result of phosphodiester bond connection, or the result of introducing an RNA linker, or the result of deleting the RNA sequence segment (stretch) near the original 5'- and 3'-ends of the parent aptamer, followed by the formation of phosphodiester bonds between the remaining nucleic acids.

[0168] In this specification, the term "stem-loop" refers to a secondary structure of nucleotides, wherein the "loop" consists of unpaired nucleic acids and the "stem" is formed by base pairs. A "stem" can be formed when the sequences of two regions of the same nucleotide chain are at least partially complementary, when they are substantially complementary, when they form a wobble base pair, etc. A "loop" represents a region of unpaired (i.e., non-complementary) nucleotides that connect the nucleotide chains of the stem and can cap the stem.

[0169] In this specification, the term "ribozyme" refers to a catalytic nucleic acid molecule that is RNA and specifically recognizes and cleaves a target nucleic acid sequence. The target can be the ribozyme itself or another nucleic acid molecule.

[0170] In the present specification, the phrase "operably linked to" means that a plurality of nucleic acids are linked to a single nucleic acid so that the function of one nucleic acid is exerted by another nucleic acid.

[0171] In this specification, descriptions of the embodiments can be cross-referenced unless otherwise specified.

[0172] <Appropriate>

[0173] As described above, the RNA aptamer of the present invention is an RNA aptamer that binds to ASP7967 or an analog thereof, and comprises:

[0174] sequence:

[0175] -X 1 -L 1 -X 2 -L 2 -X 3 -

[0176] in

[0177] X 1 With sequence Y 1 GY 2 GY 3 Y 4 Y 5 ,

[0178] L 1 is a first stem-loop nucleotide sequence comprising (in this order) a first stem region, a first loop region, and a second stem region, wherein the first stem region and the second stem region are 2 or more base pairs long and are substantially complementary to each other;

[0179] X 2 is A, G, C or U,

[0180] L 2 is a second stem-loop nucleotide sequence comprising (in this order) a third stem region, a second loop region, and a fourth stem region, wherein the third stem region and the fourth stem region are 2 or more base pairs long and are substantially complementary to each other; and wherein the first base (the 5'-most base) in the third stem region is G and the last base (the 3'-most base) in the fourth stem region is C;

[0181] X 3 With sequence UY 6 ;and

[0182] Y 1 , Y 2 , Y 3 , Y 4 , Y 5 and Y 6 are each independently A, G, C or U; or

[0183] sequence:

[0184] -S 1 -X 2-L 2 -X 3 -L 3 -X 1 -S 2 -

[0185] in

[0186] S 1 and S 2 are each independently A, G, C or U, and S 1 and S 2 Able to form base pairs or wobble base pairs with each other;

[0187] L 3 is a third stem-loop nucleotide sequence comprising a fifth stem region, a third loop region, and a sixth stem region, wherein the fifth stem region and the sixth stem region are 1 or more base pairs long and are substantially complementary to each other; and

[0188] X 1 , X 2 , X 3 and L 2 as defined above; or

[0189] sequence:

[0190] -S 3 -X 3 -L 3 -X 1 -L 1 -X 2 -S 4 -

[0191] in

[0192] S 3 C and S 4 is G; and

[0193] X 1 , X 2 , X 3 , L 1 and L 3 As defined above.

[0194] The above sequence is described from left to right, from the 5' end to the 3' end.

[0195] In some embodiments, the RNA aptamers of the present invention can be arranged in a circular manner. In other embodiments, the present invention also provides RNA aptamers derived from the circular arrangement of RNA aptamers of the present invention. In the circularly arranged RNA aptamers, the length of the first, second and / or third stem-loop regions can be 1, 2, 3, 4 or 5 base pairs longer than in the unarranged (parent) aptamers, or 1, 2, 3 or 4 base pairs shorter than in the unarranged (parent) aptamers. The cleavage site can be in the first loop region, the second loop region or the third loop region.

[0196] In other embodiments, the RNA aptamers of the present invention may be split-type aptamers.

[0197] In the present invention, Y 2 Preferably AU, more preferably A. Y 3 Preferably it is A or U, more preferably it is A. Y 4 Preferably it is G or C, and more preferably G.

[0198] In the present invention, preferably Y 1 and Y 6 can form base pairs or wobble base pairs with each other, more preferably Y 1 G and Y 6 U; or Y 1 U and Y 6 For G.

[0199] In the present invention, it is preferred that the first stem region and the second stem region are 3 to 7 base pairs long and are substantially complementary to each other, more preferably the first stem region and the second stem region are 5 base pairs long and are substantially complementary to each other, and particularly preferably the first stem region has the sequence GACGG and the second stem region has the sequence CCGUC.

[0200] In the present invention, it is preferred that the first loop region has 3 to 7 bases, and it is more preferred that the first loop region has the sequence AUU or UUCG.

[0201] In the present invention, it is preferred that the third stem region and the fourth stem region have 1 to 5 base pairs and are substantially complementary to each other, more preferably the third stem region and the fourth stem region have 3 or 4 base pairs and are substantially complementary to each other, and particularly preferably the third stem region has the sequence GCG and the fourth stem region has the sequence CGC; or the third stem region has the sequence GCGU and the fourth stem region has the sequence ACGC.

[0202] In the present invention, it is preferred that the second loop region has 3 to 7 bases, and it is more preferred that the second loop region has the sequence AAUUCA or UUCG.

[0203] In the present invention, it is preferred that the fifth stem region and the sixth stem region are 3 to 7 base pairs long and are substantially complementary to each other, more preferably the fifth stem region and the sixth stem region are 4 base pairs long and are substantially complementary to each other, and particularly preferably the fifth stem region has the sequence CUUG and the sixth stem region has the sequence CAAG.

[0204] In the present invention, the third loop region preferably has 3 to 7 bases, and more preferably the third loop region has the sequence UUCG.

[0205] In the present invention, preferably S 1 C and S 2 G; or S 1 G and S 2 For C.

[0206] The RNA aptamer of the present invention has the above sequence (-X 1 -L 1 -X 2 -L 2 -X 3 -;-S 1 -X 2 -L 2 -X 3 -L 3 -X 1 -S 2 -;-S 3 -X 3 -L 3 -X 1 -L 1 -X 2 -S 4 -) and can bind to ASP7967 or an analog thereof, preferably to ASP7967 or ASP2905. Here, ASP2905 is a compound represented by the following formula. ASP2905 is a potent and selective inhibitor of the potassium channel Kv12.2 encoded by the Kcnh3 / BEC1 gene. ASP2905 can cross the blood-brain barrier and has antipsychotic activity.

[0207] [Chemistry 1]

[0208]

[0209] ASP7967 (ASP2905 analog) is a compound represented by the following formula.

[0210] [Chemistry 2]

[0211]

[0212] In the above sequence (-X 1 -L 1 -X 2 -L2 -X 3 -;-S 1 -X 2 -L 2 -X 3 -L 3 -X 1 -S 2 -;-S 3 -X 3 -L 3 -X 1 -L 1 -X 2 -S 4 -), the first stem region and the second stem region are 2 or more base pairs long and substantially complementary to each other; and the third stem region and the fourth stem region are 2 or more base pairs long and substantially complementary to each other; and the fifth stem region and the sixth stem region are 2 or more base pairs long and substantially complementary to each other. These complementary base pairs can form a stem structure, producing an ASP7967 aptamer-like structure having binding activity to ASP7967 or its analogs. Although the stem structure can be formed by substantially complementary base pairs (including wobble base pairs (e.g., G=U base pairs) in addition to Watson-Crick base pairs), there is no particular limitation on the number of base pairs of the above-mentioned stem structure. The number of base pairs is 2 or more base pairs long, preferably 3 or more base pairs long, and more preferably 4 or more base pairs long. There is no particular limitation on the upper limit of the number of base pairs, for example, it is 7 or less base pairs long, preferably 6 or less base pairs long, and more preferably 5 or less base pairs long.

[0213] In the present invention, the phrase "substantially complementary" includes not only the case where one sequence is completely complementary to another sequence, but also the case where there are one to several mismatches (including bulges) that do not interfere with the formation of the stem structure. In the stem structure, even when a base pair is not formed in a part thereof, as long as the aptamer structure is constituted as a whole, the above-mentioned binding activity to ASP7967 or its analogues is maintained. In the present invention, a wobble base pair (e.g., a G=U base pair) is also included in the "complementary base pair".

[0214] In other aspects, an aptamer of the present disclosure may include the AC17-4 core sequence (SEQ ID NO: 1) as shown below.

[0215] 5'-UGAGAGAGACGGAUUCCGUCCGCGAAUUCACGCUG-3'(SEQ ID NO:1)

[0216] In other aspects, the aptamers of the present disclosure may include variants of SEQ ID NO: 1 as shown below.

[0217] In other aspects, the aptamers of the present disclosure may include various aptamers designed based on the AC17-4 aptamer (SEQ ID NO: 50) by any technique known in the art. For example, such aptamers include the circularly arranged AC17-4 (cpAC17-4) shown below.

[0218] 5'-GGUGUCCGCGAAUUCACGCUGCUUGUUCGCAAGUGAGAGAGACA CC-3'(SEQ ID NO:77)

[0219] In other aspects, an aptamer of the present disclosure may include the cpAC17-4 core sequence (SEQ ID NO: 78) as shown below.

[0220] 5'-CCGCGAAUUCACGCUGCUUGUUCGCAAGUGAGAGAG-3'(SEQ ID NO:78)

[0221] In other aspects, the aptamer of the present disclosure may include a base sequence represented by any one of SEQ ID NOs: 1 to 12, 77 and 78; or a homologous base sequence having at least 60%, 70%, 80%, 90% or 95% identity with the base sequence represented by any one of SEQ ID NOs: 1 to 12, 77 and 78. The homologous base sequence may be a base sequence comprising a substitution, deletion and / or insertion of 1 to 5 bases in the sequence represented by any one of SEQ ID NOs: 1 to 12, 77 and 78. The number of substitutions, deletions and insertions of the base sequence is preferably 1 to 4 nucleotides, more preferably 1 to 3 nucleotides, more preferably 1 or 2 nucleotides.

[0222] In the present invention, the sequence (-X 1 -L 1 -X 2 -L 2 -X 3 -) The RNA aptamer may further comprise 1 The fifth stem region adjacent to the 5' end and X 3 The fifth stem region and the sixth stem region have 1 to 15 base pairs and are substantially complementary to each other, and the fifth stem region and the sixth stem region form a double-stranded stem. The double-stranded stem is added to stabilize the sequence (-X 1 -L 1 -X 2 -L 2 -X 3-) formed by the aptamer structure. It is believed that the double-stranded stem has little effect on the binding force and binding specificity of the aptamer. Here, although the double-stranded stem structure can be formed by substantially complementary base pairs (including wobble base pairs (such as G=U base pairs) in addition to Watson-Crick base pairs), there is no particular restriction on the number of base pairs. The number of base pairs in the fifth stem region and the sixth stem region is preferably 2 to 10 base pairs, more preferably 6 to 9 base pairs, and particularly preferably 4 to 6 base pairs.

[0223] For example, the fifth stem region has a sequence as shown below.

[0224] 5'-GCAAG-3'

[0225] For example, the sixth stem region has a sequence as shown below.

[0226] 5'-CUUGC-3'

[0227] In the present invention, the sequence (-S 1 -X 2 -L 2 -X 3 -L 3 -X 1 -S 2 -) The RNA aptamer may further comprise 1 The 5' end of the seventh stem region is adjacent to the S 2 The seventh stem region and the eighth stem region have 1 to 15 base pairs and are substantially complementary to each other, and the seventh stem region and the eighth stem region form a double-stranded stem. The double-stranded stem is added to stabilize the sequence (-S 1 -X 2 -L 2 -X 3 -L 3 -X 1 -S 2 The number of base pairs in the seventh stem region and the eighth stem region is preferably 2 to 10 base pairs, more preferably 6 to 9 base pairs, and particularly preferably 4 to 6 base pairs.

[0228] For example, the seventh stem region has a sequence as shown below.

[0229] 5'-GGUGU-3'

[0230] For example, the eighth stem region has a sequence as shown below.

[0231] 5'-ACACC-3'

[0232] In the present invention, the sequence (-S 3 -X 3 -L3 -X 1 -L 1 -X 2 -S 4 -) The RNA aptamer may further comprise 3 The 5' end of the ninth stem region is adjacent to the S 4 The tenth stem region is adjacent to the 3' end of the ninth stem region, wherein the ninth stem region and the tenth stem region have 1 to 15 base pairs and are substantially complementary to each other, and wherein the ninth stem region and the tenth stem region form a double-stranded stem. The double-stranded stem is added to stabilize the double-stranded stem consisting essentially of the above sequence (-S 3 -X 3 -L 3 -X 1 -L 1 -X 2 -S 4 The number of base pairs in the ninth stem region and the tenth stem region is preferably 2 to 10 base pairs, more preferably 6 to 9 base pairs, and particularly preferably 4 to 6 base pairs.

[0233] The RNA aptamer of the present invention is, for example, a single-stranded RNA having a function of binding to ASP7967 or an analog thereof. In the present specification, the base sequence is described from left to right and from the 5' end to the 3' end.

[0234] In the present invention, the binding force between the RNA aptamer and the substance is represented by the dissociation constant (Kd) between the RNA aptamer and the substance. The dissociation constant of the RNA of the present invention to ASP7967 through SRP is, for example, no more than 1.0 μM, preferably no more than 0.2 μM, and more preferably no more than 50 nM. The dissociation constant of the RNA of the present invention to ASP2905 through SPR is, for example, no more than 1.0 μM, preferably no more than 0.2 μM, and more preferably no more than 50 nM.

[0235] In the present invention, the RNA aptamer can specifically bind to ASP7967 or its analogs. Here, the term "specificity" or "specifically" in this specification refers to the selective binding of the RNA aptamer of the present invention to ASP7967 or its analogs. The binding specificity of the RNA aptamer can be examined by comparing the binding of the RNA aptamer to ASP7967 or its analogs (binding force to ASP7967 or its analogs) with the binding of the RNA aptamer to an irrelevant substance (binding force to an irrelevant substance) under predetermined conditions.

[0236] The RNA aptamers of the present invention can be linked to other polynucleotides.

[0237] <Riboswitch>

[0238] A riboswitch generally refers to a functional unit (region or segment) of an RNA polynucleotide that is used to regulate the activity of a target sequence such as a protein-coding sequence and a non-protein-coding RNA (such as siRNA, pre-miRNA) on the same RNA polynucleotide. A riboswitch generally comprises an aptamer as a sensor region for detecting the presence of a ligand (such as a small molecule) and an effector region involved in the basic function. Non-limiting basic functions of riboswitches include the formation of a hairpin structure that terminates transcription, blocking translation by suppressing ribosome binding sites, self-cleavage, and regulating alternative splicing. Riboswitches undergo structural changes caused by the binding of aptamers to ligands, resulting in the enhancement or prevention of the activity of a target sequence on the same RNA polynucleotide. Here, ASP7967 or its analog (ASP2095) is not cytotoxic (see Figure 7 ), and thus these molecules are excellent ligands for modulating riboswitch function, particularly in vivo.

[0239] The riboswitch of the present invention comprises the RNA aptamer of the present invention in a part thereof. The riboswitch of the present invention can detect ASP7967 or an analog thereof through the aptamer and regulate the activity of a target sequence on the same RNA polynucleotide.

[0240] In many embodiments, the riboswitch of the present invention can be operably linked to a target sequence so that the structural change of the aptamer in response to the binding of ASP7967 or an analog thereof leads to the enhancement or prevention of the activity of the target sequence. In addition, as long as the riboswitch can regulate the activity of the target sequence, the riboswitch of the present invention can be indirectly linked to the target sequence, wherein there is any base sequence between the riboswitch and the target sequence. In addition, as long as the riboswitch can regulate the activity of the target sequence, the riboswitch of the present invention can be located between a part of the target sequence and another part of the target sequence. In the present invention, the phrase "operably linked to" includes these situations. In addition, in the present invention, the riboswitch sequence and the target sequence can share a part of the sequence.

[0241] In the present invention, the target sequence may be a protein encoding sequence or a non-protein encoding RNA such as siRNA, pre-miRNA, pri-miRNA, sgRNA, lncRNA, RNA aptamer, ribozyme, tRNA or rRNA. Here, the protein encoded by the target sequence may be any protein.

[0242] The target sequence may include and / or be operably connected to a functional element for allowing the target sequence to be transcribed and translated and / or expressed under appropriate conditions. It will be appreciated by those skilled in the art that transcription, translation or expression control sequences may be appropriately selected based on their abilities.

[0243] In the present invention, any riboswitch found in nature can be used as a platform for preparing the riboswitch of the present invention. Any riboswitch found in nature can be engineered to include the aptamer of the present invention, rather than the original aptamer. As long as the riboswitch activity is maintained as a whole, such riboswitches can be further reengineered. Examples of riboswitches found in nature as described above include, but are not limited to, thiamine pyrophosphate (TPP) riboswitch, adenosine cobalamin (AdoCbl) riboswitch, S-adenosylmethionine (SAM) riboswitch, SAH riboswitch, flavin mononucleotide (FMN) riboswitch, tetrahydrofolate riboswitch, lysine riboswitch, glycine riboswitch, purine riboswitch, GlmS riboswitch and nucleoside Q precursor (pre-queosine 1 , PreQ1) riboswitch.

[0244] <Polynucleotide>

[0245] The polynucleotide of the present invention comprises: a riboswitch comprising an RNA aptamer capable of binding to ASP7967 or an analog thereof, or a DNA sequence capable of being transcribed into a riboswitch; and a target sequence encoding a protein, wherein the riboswitch is operably linked to the target sequence so that the expression of the protein is upregulated or downregulated in response to ASP7967 or an analog thereof.

[0246] In some embodiments, the target sequence of protein encoding comprises multiple exons. The target sequence comprises, for example, alternative splicing exons flanked by 5' introns and 3' introns, wherein the alternative splicing exons comprise stop codons, wherein when the alternative splicing exons are spliced ​​to the mRNA of the protein, the stop codons are in frame with the protein. In this embodiment, for example, the riboswitch is located in the 3' intron of the alternative splicing exon. The riboswitch comprises a 5' splicing site ("5'ss") sequence of the 3' intron (i.e., the intron splicing site sequence of the 3' next to the selective exon) and a sequence complementary to the 5'ss sequence of the 3' intron as an effector region. When the aptamer binds to the ligand, the effector region forms a stem and therefore prevents the splicing of the splicing donor site at the 3' end of the selective exon, resulting in the expression of the protein of interest. Under certain conditions (e.g., when the aptamer is not bound to its ligand), the effector region is in a state that provides access to the splice donor site at the 3' end of the alternative exon, resulting in the inclusion of the alternative exon in the mRNA of the protein, thereby inhibiting the expression of the protein of interest (see, e.g., Fig.11a ). In this case, the total length of the stem formed by the effector region is preferably between 6 and 12 base pairs, more preferably between 6 and 10 base pairs, particularly preferably between 7 and 9 base pairs.

[0247] In an embodiment, examples of the base sequences of the riboswitches of the present invention are shown below.

[0248] 5’-GUAAUGUUGAGAGAGACGGAUUCCGUCCGCGAAUUCACGCU GACAUUAC-3’(SEQ ID NO:13)

[0249] 5’-GUAAUGUGUGAGAGAGACGGAUUCCGUCCGCGAAUUCACGC UGCACAUUAC-3’(SEQ ID NO:14)

[0250] 5’-GUAAUGUGGUGAGAGAGACGGAUUCCGUCCGCGAAUUCACG CUGCCACAUUAC-3’(SEQ IDNO:15)

[0251] 5’-GUAAUGUGGCUGAGAGAGACGGAUUCCGUCCGCGAAUUCAC GCUGGCCACAUUAC-3’(SEQ IDNO:16)

[0252] 5’-GUAAUGUGGCAUGAGAGAGACGGAUUCCGUCCGCGAAUUCA CGCUGUGCCACAUUAC-3’(SEQID NO:17)

[0253] 5’-GUAAUGUGGUGAGAGAGACGGAUUCCGUCCGCGAAUUCACG CUGCCGCAUUGCC-3’(SEQ IDNO:18)

[0254] 5’-GUAAUGUCCGCGAAUUCACGCUGCUUGUUCGCAAGUGAGAG AGACAUUAC-3’(SEQ ID NO:79)

[0255] 5’-GUAAUGUGCCGCGAAUUCACGCUGCUUGUUCGCAAGUGAGA GAGCACAUUAC-3’(SEQ IDNO:80)

[0256] 5’-GUAAUGUGGCCGCGAAUUCACGCUGCUUGUUCGCAAGUGAG AGAGCCACAUUAC-3’(SEQ IDNO:81)

[0257] In some embodiments, the polynucleotide of the invention comprises a 3'UTR comprising a polyadenylation signal sequence, and the riboswitch of the invention is inserted in the 3'UTR and on the 5' side of the polyadenylation signal sequence. Here, the function of the polyadenylation signal sequence (including the function of the poly-(A) tail) is regulated by the riboswitch. In this embodiment, for example, the riboswitch comprises a self-cleaving ribozyme, and here, the riboswitch sequence and the self-cleaving ribozyme can share a portion of the sequence.

[0258] In one embodiment, in a riboswitch, when an aptamer binds to ASP7967 or an analog thereof, the self-cleaving ribozyme structure is stabilized by a stem structure formed by the terminal side sequence of the aptamer (in this case, for example, the aptamer and the self-cleaving ribozyme share the stem structure), and then the self-cleaving ribozyme is activated. The activated self-cleaving ribozyme cleaves itself inserted between the target sequence and the 3'UTR, thereby inhibiting the function of the polyadenylation signal sequence.

[0259] In one embodiment, in the riboswitch, when the aptamer binds to ASP7967 or an analog thereof, the self-cleaving ribozyme structure is destroyed by the stem structure formed by the terminal side sequences of the aptamer (in this case, for example, for the formation of the stem structure, the aptamer utilizes only one side sequence of the stem that forms the self-cleaving ribozyme), and then the self-cleaving ribozyme is inactivated (see, e.g. Figure 6b ). The inactivated self-cleaving ribozyme does not cleave itself inserted between the target sequence and the 3'UTR, maintaining the function of the polyadenylation signal sequence. Here, the total length of the stem formed by the terminal side sequence of the aptamer as described above is preferably between 6 and 11 base pairs, more preferably between 6 and 10 base pairs, and particularly preferably between 8 and 10 base pairs.

[0260] In an embodiment, examples of the base sequence of the riboswitch of the present invention are shown below.

[0261] 5'-UCUAGACCCUGCGUCACAACGACGUGAGAGACGGAUUCCGUCCGCGAAUUCACGCUGCGUCGUCUGGGCGACGGUAAAUAGGUGUUAGGCCCAGAGCGGCAGGGUACAACUCCGGA-3'(SEQ ID NO:19)

[0262] 5'-UCUAGACCCUGCGUCACAGACGACGUGAGAGACGGAUUCCGUCCGCGAAUUCACGCUGCGUCGUCUGGGCGACGGUAAAUAGGUGUUAGGCCCAGAGCGGCAGGGUACAACUCCGGA-3' (SEQ ID NO: 20)

[0263] 5’-UCUAGACCCUGCGUCACAAGACGACGUGAGAGAGACGGAUUCCGUCCGCGAAUUCACGCUGCGUCGUCUGGGCGACGGUAAAUAGGUGUUAGGCCCAGAGCGGCAGGGUACAACUCCGGA-3’(SEQ ID NO:21)

[0264] 5’-UCUAGACCCUGCGUCACACAGACGACGUGAGAGAGACGGAUUCCGUCCGCGAAUUCACGCUGCGUCGUCUGGGCGACGGUAAAUAGGUGUUAGGCCCAGAGCGGCAGGGUACAACUCCGGA-3’(SEQ ID NO:22)

[0265] 5’-UCUAGACCCUGCGUCACACCAGACGACGUGAGAGAGACGGAUUCCGUCCGCGAAUUCACGCUGCGUCGUCUGGGCGACGGUAAAUAGGUGUUAGGCCCAGAGCGGCAGGGUACAACU-3’(SEQ ID NO:23)

[0266] 5’-UCUAGACCCUGCGUCACACCCAGACGACGUGAGAGAGACGGAUUCCGUCCGCGAAUUCACGCUGCGUCGUCUGGGCGACGGUAAAUAGGUGUUAGGCCCAGAGCGGCAGGGUACAACUCCGGA-3’(SEQ ID NO:24)

[0267] 5’-UCUAGACCCUGCGUCACAAAGAAAAGACGACGUGAGAGAGACGGAUUCCGUCCGCGAAUUCACGCUGCGUCGUCUGGGCGACGGUAAAUAGGUGUUAGGCCCAGAGCGGCAGGGUACAACUCCGGA-3’(SEQ ID NO:25)

[0268] 5’-UCUAGACCCUGCGUCACAUGAGAGAGACGGAUUCCGUCCGCGAAUUCACGCUGUGUGACGCACGUCGUCUGGGCGACGGUAAAUAGGUGUUAGGCCCAGAGCGGCAAGGUCUAACUCCGGA-3’(SEQ ID NO:26)

[0269] 5’-UCUAGACCCUGCGUCACAUGAGAGAGACGGAUUCCGUCCGCGAAUUCACGCUGUGUGACGCACGUCGUCUGGGCGACGGUAAAUAGG UGUUAGGCCCAGAGCGGCAGAGUCUAACUCCGGA-3’(SEQ ID NO:27)

[0270] In the present invention, the protein encoded by the target sequence may be any protein, for example, it may be a protein to be used for therapy. Examples of proteins encoded by the target sequence include 4-1BB ligand, 5-helix, human CC chemokine, human L105 chemokine, human L105 chemokine named huL105_3, monokine induced by gamma-interferon (MIG), part of CXCR4B protein, platelet basic protein (PBP), α1-antitrypsin, ACRP-30 homolog; complement component C1q C, adenoids-expressed chemokine (ADEC), aFGF; FGF-1, AGF, AGF protein, albumin, etoposide, angiostatin, anthrax vaccine, antibodies specific for cerebral atrophin, antistasin, anti-TGFβ family antibodies, antithrombin III, APM-1; ACRP-30; Famoxin, apolipoproteins, arylsulfatase B, b57 protein, BCMA, β-thromboglobulin (β-TG), bFGF; FGF2, coagulation factors, BMP Processing enzymes Furin, BMP-10, BMP-12, BMP-15, BMP-17, BMP-18, BMP-2B, BMP-4, BMP-5, BMP-6, BMP-9, Bone morphogenetic protein-2, Calcitonin, Calpain-10a, Calpain-10b, Calpain-10c, Cancer vaccines, Carboxypeptidases, CC chemokines, MCP2, CCR5 variants, CCR7, CCR7, CD11aMab, CD137; 4-1BB receptor protein, CD20 Mab, CD27, CD27L, CD30, CD30 ligand, CD33 immunotoxin, CD40, CD40L, CD52 Mab, Cerebus protein, Chemokine Eotaxin, Chemokine hIL-8, Chemokine hMCP1, Chemokine hMCP1a, Chemokine hMCP1b, Chemokine hMCP2, Chemokine hMCP3, Chemokine hSDF1b, Chemokine MCP-4, Chemokine TECK and TECK variants, Chemokine-like protein IL-8M1 full length and mature, Chemokine-like protein IL-8M10 full length and mature, Chemokine-like protein IL-8M3, Chemokine Chemokine-like protein IL-8M8 full length and mature, chemokine-like protein IL-8M9 full length and mature, chemokine-like protein PF4-414 full length and mature, chemokine-like protein PF4-426 full length and mature, chemokine-like protein PF4-M2 full length and mature, cholera vaccine, chondroitin-like protein, c-kit ligand; SCF; mast cell growth factor; MGF; fibrosarcoma-derived stem cell factor, CNTF and its fragments, pro- and active forms of coagulation factors, collagen, complement C5 Mab, connective tissue activation protein-III, CTAA16.88 Mab, CTAP-III,CTLA4-Ig, CTLA-8, CXC3, CXC3, CXCR3; CXC chemokine receptor 3, cyanobacterial antiviral protein-N, darbepoetin, named exodus, named huL105_7, DIL-40, DNase, EDAR, EGF receptor Mab, ENA-78, endostatin, Eotaxin, epithelial neutrophil activation protein-78, EPO receptor; EPOR, erythropoietin (EPO) and EPO mimetics, Eutropin, Exodus protein, factor IX, factor VII, factor VIII, factor X, and factor XI II, FAS ligand inhibitory protein (DcR3), FasL, FasL, FasL, FGF, FGF-12; fibroblast growth factor homologous factor-1, FGF-15, FGF-16, FGF-18, FGF-3; INT-2, FGF-4; gelonin, HST-1; HBGF-4, FGF-5, FGF-6; heparin-binding secretory transforming factor-2, FGF-8, FGF-9; glial activating factor, flt-1, flt-3 ligand, follicle-stimulating hormone alpha subunit, follicle-stimulating hormone beta subunit, follitropin, Fractalkine, fragment. Myofibrillar protein troponin I, FSH, galactosidase, galectin-4, G-CSF, GDF-1, gene therapy, glioma-derived growth factor, glucagon, glucagon-like peptide, glucocerebrosidase, glucose oxidase, glucosidase, Glycodelin-A; progesterone-related endometrial protein, GM-CSF, gonadotropin, granulocyte chemoattractant protein-2 (GCP-2), granulocyte-macrophage colony-stimulating factor, growth hormone, growth-regulated oncogene-α (GRO-α), growth-regulated oncogene-β (GRO-β), growth-regulated oncogene-γ (GRO-γ), hAPO-4; TROY, hCG, hepatitis B surface antigen, hepatitis B vaccine, HER2 receptor Mab, hirudin, HIVgp120, HIV gp41, HIV inhibitory peptide, HIV inhibitory peptide, HIV inhibitory peptide, HIV protease inhibitory peptide, HIV-1 protease inhibitor, HPV vaccine, human 6CKine protein, human Act-2 protein, human adipogenesis inhibitory factor, human B cell stimulating factor-2 receptor, human β-chemokine H1305 (MCP-2), human CC chemokine DGWCC, human CC chemokine ELC protein, human CC-type chemokine interleukin C, human CCC3 protein, human CCF18 chemokine, human CC-type chemokine protein named SLC (secondary lymphoid chemokine), human chemokine β-8 short form, human chemokine C10, human chemokine CC-2, human chemokine CC-3, human chemokine CCR-2, human chemokine Ckβ-7, human chemokine ENA-78,Human chemokine eotaxin, human chemokine GROα, human chemokine GROα, human chemokine GROβ, human chemokine HCC-1, human chemokine HCC-1, human chemokine 1-309, human chemokine IP-10, human chemokine L105_3, human chemokine L105_7, human chemokine MIG, human chemokine MIG-β protein, human chemokine MIP-1α, human chemokine MIP1β, human chemokine MIP-3α, human chemokine MIP-3β, human chemokine PF4, human chemokine protein 331D5, human chemokine protein 61164, human chemokine receptor CXCR3, human chemokine SDF1α, human chemokine SDF1β, human chemokine ZSIG-35, human Chr19Kine protein, human CKβ-9, human CKβ-9, human CX3C 111 amino acid chemokine, human DNAX interleukin-40, human DVic-1 CC chemokine, human EDIRF I protein sequence, human EDIRF II protein sequence, human eosinophil CC type chemokine eotaxin, human eosinophil-expressed chemokine (EEC), human fast-twitch skeletal muscle troponin C, human fast-twitch skeletal muscle troponin I, human fast-twitch skeletal muscle troponin subunit C, human fast-twitch skeletal muscle troponin subunit I protein, human fast-twitch skeletal muscle troponin subunit T, human fast-twitch skeletal muscle troponin T, chemokine expressed by human fetal spleen, FSEC, human GM-CSF receptor, human gro-α chemokine, human gro-β chemokine, human gro-γ chemokine, human IL-16 protein, human IL-1RD10 protein sequence, human IL-1RD9, human IL-5 receptor α chain, human IL-6 receptor, Human IL-8 receptor protein hIL8RA, human IL-8 receptor protein hIL8RB, human IL-9 receptor protein, human IL-9 receptor protein variant #3, human IL-9 receptor protein variant fragment, human IL-9 receptor protein variant fragment #3, human interleukin 1δ, human interleukin 10, human interleukin 10, human interleukin 18, human interleukin 18 derivative, human interleukin-1β precursor, human interleukin-1β precursor, human interleukin-1 receptor accessory protein, human interleukin-1 receptor antagonist beta, human interleukin-1 type-3 receptor, human interleukin-10 (precursor), human interleukin-10 (precursor), human interleukin-11 receptor, human interleukin-12 40kD subunit, human interleukin-12 beta-1 receptor, human interleukin-12 beta-2 receptor, human interleukin-12p35 protein, human interleukin-12p40 protein, human interleukin-12 receptor, human interleukin-13alpha receptor, human interleukin-13beta receptor, human interleukin-15, human interleukin-15 receptor from clone P1,Human interleukin-17 receptor, human interleukin-18 protein (IL-18), human interleukin-3, human interleukin-3 receptor, human interleukin-3 variant, human interleukin-4 receptor, human interleukin-5, human interleukin-6, human interleukin-7, human interleukin-7, human interleukin-8 (IL-8), human intracellular IL-1 receptor antagonist, human IP-10 and HIV-1 gp120 hypervariable region fusion protein, human IP-10 and human Muc-1 core epitope (VNT) fusion protein, human liver and activation-regulated chemokine (LA RC), human Lkn-1 full length and mature protein, human mammary gland-associated chemokine (MACK) protein full length and mature, human mature chemokine Ckβ-7, human mature gro-α, human mature gro-γ polypeptide for the treatment of sepsis, human MCP-3 and human Muc-1 core epitope (VNT) fusion protein, human MI10 protein, human MI1A protein, human monocyte chemoattractant factor hMCP-1, human monocyte chemoattractant factor hMCP-3, human monocyte chemoattractant proprotein (MCPP) sequence, human neuroattractant chemokine chemokine-like domain, human non-ELR CXC chemokine H174, human non-ELR CXC chemokine IP10, human non-ELR CXC chemokine Mig, human PAI-1 mutant, human protein with IL-16 activity, human protein with IL-16 activity, human secondary lymphoid tissue chemokine (SLC), human SISD protein, human STCP-1, human stromal cell-derived chemokine, SDF-1, human chemokine expressed by mixed lymphocyte reaction of T cells (TMEC), human thymus and activation-regulated cytokine (TARC), human thymus-expressed, human TNF-α, human TNF-α, human TNF-β (LT-α), human CC-type chemokine eotaxin3 protein sequence, human type II interleukin-1 receptor, human wild-type interleukin-4 (hIL-4) protein, human ZCHEMO-8 protein, humanized anti-VEGF antibodies and fragments thereof, humanized anti-VEGF antibodies and fragments thereof, hyaluronidase, ICE 10kD subunit, ICE 20kD subunit, ICE 22kD subunit, iduronate 2-sulfatase, iduronidase, IL-1α, IL-1β, IL-1 inhibitor (IL-1i), IL-1 maturation, IL-10 receptor, IL-11, IL-11, IL-12p40 subunit, IL-13, IL-14, IL-15, IL-15 receptor, IL-17, IL-17 receptor, II-17 receptor, II-17 receptor, IL-19, IL-li fragment, IL1-receptor antagonist, IL-21 (TIF), fusion protein containing IL-3, IL-3 mutant protein, IL-3 variant, IL-3 variant, IL-4, IL-4 mutant protein, IL-4 mutant protein Y124G,IL-4 mutant protein Y124X, IL-4 mutant protein, II-5 receptor, IL-6, II-6 receptor, IL-7 receptor clone, IL-8 receptor, IL-9 mature protein variant (Met117 type), immunoglobulin or immunoglobulin-based molecule or a fragment of any thereof (e.g. Small Modular ImmunoPharmaceutical, TM("SMIP") or dAb, Fab' fragment, F(ab')2, scAb, scFv or scFv fragment), including but not limited to plasminogen, influenza vaccine, inhibin alpha, inhibin beta, insulin, insulin-like growth factor, integrin Mab, inter-alpha trypsin inhibitor, inter-alpha trypsin inhibitor, interferon gamma-induced protein (IP-10), interferons (such as interferon alpha species and subspecies, interferon beta species and subspecies, interferon gamma species and subspecies), interferons (such as interferon alpha species and subspecies, interferon beta species and subspecies, interferon gamma species and subspecies), interleukin 6, interleukin 8 (I L-8) receptor, interleukin 8 receptor B, interleukin-1α, interleukin-2 receptor-associated protein p43, interleukin-3, interleukin-4 mutant protein, interleukin-8 (IL-8) protein, interleukin-9, interleukin-9 (IL-9) mature protein (Thr117 type), interleukins (such as IL0, IL11 and IL2), interleukins (such as IL0, IL11 and IL2), Japanese encephalitis vaccine, Kalikrein inhibitor, keratinocyte growth factor, Kunitz domain proteins (such as aprotinin, amyloid precursor protein and WO those described in 03 / 066824, with or without albumin fusion), Kunitz domain protein, aprotinin, amyloid precursor protein with or without albumin fusion, LACI, lactoferrin, potential TGF-β binding protein II, leptin, liver expressed chemokine-1 (LVEC-1), liver expressed chemokine-2 (LVEC-2), LT-α, LT-β, ​​luteinizing hormone, Lyme disease vaccine, lymphocyte chemoattractant, macrophage derived chemokine analog MDC(n+1), macrophage derived chemokine analog MDC-eyfy, macrophage derived chemokine analog MDC-yl, macrophage derived chemokine, MDC, macrophage derived chemokine (MDC), Maspin;Proteinase inhibitor 5, MCP-1 receptor, MCP-1a, MCP-1b, MCP-3, MCP-4 receptor, M-CSF, melanoma inhibitory protein, membrane-bound protein, Met117 human interleukin 9, MIP-3α, MIP-3β, MIP-γ, MIRAP, modified Rantes, monoclonal antibody, MP52, mutant interleukin 6S176R, myofibrillar contractile protein troponin I, natriuretic peptide, nerve growth factor-β, nerve growth factor-β2, neuropilin-1, neuropilin-2, neurochemokine, neurotrophin-3, neurotrophin-4, neurotrophin-4a, neurotrophin-4b, neurotrophin-4c, neurotrophin-4d, neutrophil-activating peptide-2 (NAP-2), NOGO-66 receptor, NOGO-A, NOGO-B, NO GO-C, a new β-chemokine named PTEC, N-terminally modified chemokine GroHEK / hSDF-1α, N-terminally modified chemokine GroHEK / hSDF-1β, N-terminally modified chemokine met-hSDF-1α, N-terminally modified chemokine met-hSDF-1β, OPGL, osteogenic protein-1; OP-1; BMP-7, osteogenic protein-2, OX40; ACT-4, OX40L, oxytocin (neurohypophysis transporter I), parathyroid hormone, Patched, Patched-2, PDGF-D, pertussis toxoid, pituitary expressed chemokine (PGEC), placental growth factor, placental growth factor-2, plasminogen activator inhibitor-1; PAI-1, plasminogen activator inhibitor-2; PAI-2, plasminogen activator inhibitor-2;PAI-2, platelet-derived growth factor, platelet-derived growth factor Bv-sis, platelet-derived growth factor precursor A, platelet-derived growth factor precursor B, platelet Mab, platelet-derived endothelial cell growth factor (PD-ECGF), platelet-derived growth factor A chain, platelet-derived growth factor B chain, peptides for the treatment of sepsis, prepro-apolipoprotein "Milan" variant, prepro-apolipoprotein "Paris" variant, prothrombin, primate CC chemokine "ILINCK", primate CXC chemokine "IBICK", proinsulin, prolactin, prolactin 2, prosaptide, protease inhibitory peptides, protein C, protein S, prothrombin, prourokinase, RANTES, RANTES8-68, RANTES 9-68, RANTES peptide, RANTES receptor, recombinant interleukin-16, resistin, restrictocin, retroviral protease inhibitor, ricin, rotavirus vaccine, RSV Mab, saporin, Sarcina, secreted and transmembrane polypeptide, secreted and transmembrane polypeptide, serum cholinesterase, serum protein, coagulation factor, soluble BMP receptor kinase protein-3, soluble VEGF receptor, stem cell inhibitory factor, Staphylococcus vaccine, stromal derived factor-1α, stromal derived factor-1β, substance P (tachykinin), T1249 peptide, T20 peptide, T4 endonuclease, TACI, Tarc, TGF-β1, TGF-β2, Thr11 7 Human interleukin 9, thrombin, thrombopoietin, thrombopoietin derivative 1, thrombopoietin derivative 2, thrombopoietin derivative 3, thrombopoietin derivative 4, thrombopoietin derivative 5, thrombopoietin derivative 6, thrombopoietin derivative 7, thymus-expressed chemokine (TECK), thyroid-stimulating hormone, tick anticoagulant peptide, Tim-1 protein, TNF-α precursor, TNF-R, TNF-RII; TNF p75 receptor; death receptor, tPA, transferrin, transforming growth factor β, troponin peptide, truncated monocyte chemoattractant protein 2 (6-76), truncated monocyte chemoattractant protein 2 (6-76), truncated RANTES protein (3-68), tumor necrosis factor, urate oxidase, urokinase, vasopressin (neurohypophysis transporter protein II), VEGF R-3; flt-4, VEGF receptor; KDR; flk-1, VEGF-110, VEGF-121, VEGF-138, VEGF-145, VEGF-162, VEGF-165, VEGF-182, VEGF-189, VEGF-206, VEGF-D, VEGF-E; VEGF-X, von Willebrand factor, wild-type monocyte chemoattractant protein 2, wild-type monocyte chemoattractant protein 2, ZTGF-β9, β;(T87Q) -globin, SMN1, chimeric antigen receptor, RPE65, F8, HGF, LPL, p53, apoe2, arylsulfatase A, NAGLU, SGSH, AADC, GAD, GDNF, NRTN, LCAT, GBA, FGF-1, FGF-2, ADA, CLN2, CLN6, CLN3, IDS, huntingtin, TRAIL, dystrophin, GALGT2, accA, IDUA, GLB1, FS344, SGCA, DYSF, ABCD1, Gigaxonin and their functional fragments.

[0271] The polynucleotide of the present invention may be a polynucleotide in which the sugar residue (e.g., ribose) of each nucleotide has been modified (herein, modification of RNA will be described, but the description is appropriately understood as a description of modification of DNA). As examples of modifications in the sugar residue, substitution of the hydroxyl group at the 2'-position, 3'-position, and / or 4'-position of the sugar residue with another atom and the like can be mentioned. As the types of modifications, fluorination, alkoxylation (e.g., methoxylation, ethoxylation), O-arylation, S-alkylation (e.g., S-methylation, S-ethylation), S-arylation, and amination (e.g., -NH 2 Such changes in sugar residues can be carried out by methods known per se (see, for example, Sproat et al., (1991) Nucl. Acid. Res. 19, 733-738; Cotton et al., (1991) Nucl. Acid. Res. 19, 2629-2635; Hobbs et al., (1973) Biochemistry 12, 5138-5145).

[0272] The sugar residue may also be a BNA: bridging nucleic acid (LNA: linking nucleic acid) in which a cross-linked structure is formed at the 2'-position and the 4'-position. Such changes in the sugar residue may also be performed by methods known per se (e.g., Tetrahedron Lett., 38, 8735-8738 (1997); Tetrahedron, 59, 5123-5128 (2003), Rahman SMA, Seki S., Obika S., Yoshikawa H., Miyashita K., Imanishi T., J. Am. Chem. Soc., 130, 4886-4896 (2008) etc.).

[0273] The polynucleotides of the present invention may also have altered (e.g., chemically substituted) nucleic acid bases (e.g., purine or pyrimidine). As examples of such alterations, pyrimidine alterations at the 5-position, purine alterations at the 6- and / or 8-positions, alterations with extracyclic amines, substitutions with 4-thiouridine, and substitutions with 5-bromouracil or 5-iodouracil may be mentioned.

[0274] In addition, the phosphate groups contained in the polynucleotides of the present invention can be altered to confer resistance to nucleases and hydrolysis. For example, the P(O)O group as a phosphate group can be replaced by P(O)S (thioate), P(S)S (dithioate), P(O)NR 2 (amid), P(O)R, R(O)OR', CO or CH 2 (formacetal) or 3'-amine (-NH-CH 2 -CH 2 -) [wherein each R or R' unit is independently H or a substituted or unsubstituted alkyl (eg, methyl, ethyl)].

[0275] <Carrier>

[0276] The present invention also relates to an RNA or DNA vector comprising an RNA aptamer of the present invention or a DNA sequence capable of being transcribed into an RNA aptamer of the present invention. The RNA vector comprises, for example, an RNA aptamer of the present invention. The DNA comprises, for example, a DNA sequence capable of being transcribed into an RNA aptamer of the present invention.

[0277] The present invention also relates to an RNA or DNA vector comprising a riboswitch of the present invention or a DNA sequence capable of being transcribed into a riboswitch of the present invention. The RNA vector comprises, for example, a riboswitch of the present invention. The DNA vector comprises, for example, a DNA sequence capable of being transcribed into a riboswitch of the present invention.

[0278] The present invention also relates to an RNA or DNA vector comprising a riboswitch of the present invention or a DNA sequence capable of being transcribed into a riboswitch of the present invention, and a target sequence operably linked to the riboswitch or DNA sequence. The RNA vector comprises, for example, a riboswitch of the present invention and a target sequence operably linked to the riboswitch. The DNA vector comprises, for example, a DNA sequence capable of being transcribed into a riboswitch of the present invention and a target sequence operably linked to the DNA sequence.

[0279] The present invention also relates to an RNA or DNA vector comprising a polynucleotide of the present invention. The RNA vector comprises, for example, a polynucleotide comprising: a riboswitch comprising an RNA aptamer capable of binding to ASP7967 or an analog thereof and a target sequence encoding a protein, wherein the riboswitch is operably linked to the target sequence, such that the expression of the protein is up-regulated or down-regulated in response to ASP7967 or an analog thereof. The DNA vector comprises, for example, a DNA sequence capable of being transcribed into a polynucleotide comprising: a riboswitch comprising an RNA aptamer capable of binding to ASP7967 or an analog thereof and a target sequence encoding a protein, wherein the riboswitch is operably linked to the target sequence, such that the expression of the protein is up-regulated or down-regulated in response to ASP7967 or an analog thereof.

[0280] In the present invention, examples of vectors include, but are not limited to, plasmids, viral vectors, cosmids, artificial chromosomes, and phagemids. A vector may be a vector that can replicate in a host cell, and it may be further characterized by one or more endonuclease restriction sites at which the vector may be cut and a desired nucleic acid sequence inserted therein. A vector may contain one or more marker sequences that are suitable for identifying and / or selecting cells that have or have not been transformed or genomic modified with the vector.

[0281] In the present invention, the vector may further comprise additional nucleic acid elements, including nucleic acid regions or segments that provide for replication of the vector in the cell and expression of the aptamer, riboswitch or polynucleotide of the present invention in the cell at an appropriate level. It is understood by those skilled in the art that expression control sequences (promoters and enhancers, etc.) are selected based on their ability to promote their expression in the cell.

[0282] In the present invention, a viral vector can be preferably used. Examples of viral vectors include, but are not limited to, adenovirus (AV) vectors, adeno-associated virus (AAV) vectors, retrovirus and lentivirus vectors, herpes simplex virus type 1 (HSV1) vectors, and vesicular stomatitis virus (VSV) vectors.

[0283] In the present invention, polynucleotides and vectors can be introduced into cells by viral vector systems or non-viral vector systems. In non-viral vector systems, for example, cationic lipids, polymers or both can be used as carriers. Conjugated poly-L-lysine (PLL) polymers and polyethyleneimine (PEI) polymer systems can also be used to deliver polynucleotides or vectors to cells. Other methods for delivering polynucleotides or vectors to cells include hydrodynamic injection and electroporation and the use of ultrasound. For a review of viral and non-viral delivery systems for gene delivery, see Nayerossadat, N. et al. (Adv Biomed Res. 2012; 1: 27; incorporated herein by reference).

[0284] <Kit>

[0285] The kit for regulating the expression of a protein of the present invention comprises ASP7967 or an analog thereof, and a polynucleotide of the present invention or a vector comprising the polynucleotide of the present invention. The polynucleotide of the present invention can be used to regulate (upregulate or downregulate) the expression of a specific protein in response to ASP7967 or an analog thereof, and therefore, the kit of the present invention can be used to regulate the expression of a specific protein encoded by a target sequence on the polynucleotide of the present invention.

[0286] As described above, ASP2905 (ASP7967 analog) is a potent and selective inhibitor of the potassium channel Kv12.2 encoded by the Kcnh3 / BEC1 gene, and can cross the blood-brain barrier and has antipsychotic activity. Therefore, the kit of the present invention can be used to treat, for example, a disease, preferably a central nervous system disease, a cognitive disorder or a KCNH3-related disease, more preferably ADHD, Parkinson's disease, Alzheimer's disease or schizophrenia.

[0287] In the present invention, the protein encoded by the target sequence can be a protein used for therapy. In this case, the kit of the present invention can be used to treat any disease for which the protein encoded by the target sequence has a therapeutic effect. Examples of such proteins encoded by the target sequence are mentioned above in the section on polynucleotides of the present invention.

[0288] If necessary, the kit of the present invention may further comprise any components other than ASP7967 or an analog thereof, the polynucleotide of the present invention, and a vector comprising the polynucleotide of the present invention.

[0289] <Method for regulating protein expression in vivo>

[0290] The method for regulating protein expression in vivo of the present invention comprises: (1) introducing the polynucleotide of the present invention or a vector comprising the polynucleotide of the present invention into a cell, and (2) contacting ASP7967 or its analog with the polynucleotide or the vector. The present method can regulate the expression of a protein encoded by a target sequence on the polynucleotide of the present invention in a cell, so that the expression of the protein is upregulated or downregulated only when the polynucleotide or the vector is contacted with ASP7967 or its analog.

[0291] <Method for treating or preventing disease>

[0292] The method for treating or preventing a disease of the present invention comprises: (1) introducing the polynucleotide of the present invention or a vector comprising the polynucleotide of the present invention into a subject, and (2) administering ASP7967 or an analog thereof to the subject. The present method can treat or prevent diseases caused by the properties of ASP7967 or an analog thereof and / or a protein encoded by a target sequence on the polynucleotide of the present invention. For example, the diseases treated or prevented by the present method include central nervous system diseases, cognitive disorders or KCNH3-related diseases, and are preferably ADHD, Parkinson's disease, Alzheimer's disease or schizophrenia. Here, "KCNH3-related diseases" refers to diseases caused by increased or decreased expression of KCNH3 (BEC1) or changes in its function. KCNH3 is K + A member of the channel superfamily, it has a preferential forebrain distribution and a restricted expression distribution in the brain. Its expression is significant in the hippocampus and cerebral cortex. In addition, it has been strongly shown that the hippocampus and cerebral cortex are associated with memory and learning. Therefore, "KCNH3-related diseases" include diseases associated with cognitive decline, including a decline in memory and learning.

[0293] In the method for treating or preventing a disease of the present invention, the polynucleotide of the present invention or a vector comprising the polynucleotide of the present invention is introduced into a subject, for example, into cells of a specific tissue or organ of the subject, by using methods known in the art, for example, by using a known viral vector system or a non-viral vector system. Known methods for introducing polynucleotides or vectors can be used in this method. Cell specificity can be controlled, for example, by a promoter or other elements within the vector.

[0294] Due to the nature of the polynucleotides of the present invention, the expression of proteins encoded by the target sequences on the polynucleotides of the present invention can be regulated by administering ASP7967 or its analogs to a subject.Here, examples of proteins encoded by the target sequences are mentioned above in the section on the polynucleotides of the present invention.

[0295] The delivery of the polynucleotide or vector containing the target sequence and the delivery of the ligand (i.e., ASP7967 or its analogs) are usually separated in time. The delivery of the ligand will control when the target gene is expressed and the level of protein expression. The ligand can be delivered by a variety of routes, including but not limited to oral, intramuscular (IM), intravenous (IV), intraocular or topical.

[0296] The timing of the delivery of the ligand will depend on the requirement for activation or inactivation of the protein encoded by the target sequence. For example, if the protein encoded by the target sequence is continuously needed for therapy, the ligand can be delivered daily or multiple times a day to ensure continuous activation or inactivation of the protein. If the protein has a long-lasting effect, the ligand can be delivered less frequently.

[0297] <Method for treating a disease in a subject receiving gene therapy>

[0298] The above-mentioned method for treating or preventing a disease can be applied to a subject receiving gene therapy. Therefore, the present invention relates to a method for treating a disease, which comprises (2') administering ASP7967 or an analog thereof to a subject receiving gene therapy using a vector comprising the polynucleotide of the present invention. Since the present method is applied to a subject receiving gene therapy using a vector comprising the polynucleotide of the present invention, the step of (1) introducing the polynucleotide of the present invention or a vector comprising the polynucleotide of the present invention into the subject is optional.

[0299] In this method, the subject has been subjected to gene therapy using a vector comprising a polynucleotide of the present invention, for example, using known gene therapy techniques. Here, "gene therapy" generally refers to the transfer of heterologous nucleic acids to a subject suffering from a disease or condition for which such therapy is sought, for example, to cells of a specific tissue or organ of the subject. In the present invention, a vector comprising a polynucleotide of the present invention is introduced into a cell in a manner such that the polypeptide of the present invention is continuously or transiently expressed. Here, examples of proteins encoded by the target sequence in the polynucleotide of the present invention are mentioned above in the section on polynucleotides of the present invention.

[0300] Example

[0301] <Materials and Methods>

[0302] 1. Aptamer Selection (SELEX)

[0303] 1.1. Ligand-coupled agarose matrix

[0304] 1.1.1. Overview

[0305] All chemicals and solvents (including dry DMF and dry dioxane) were purchased from commercial sources and used without further purification. Intermediate compounds (2) shown in Scheme 1 were obtained from BioFine. Thin layer chromatography (TLC) was performed on silica gel plates pre-coated with a fluorescent indicator and visualized by UV light (254 nm). Silica gel (45-75 μm) was used for column chromatography. Recordings were made on a 400 MHz Bruker or 600 MHz JEOL NMR instrument. 1 H NMR spectra. Chemical shifts (δ) in parts per million refer to 1 H NMR and 13 C NMR spectrum of DMSO-d 6 The residual proton signal (2.50ppm) and carbon signal (39.5ppm) of 1H NMR spin coupling multiplicities are reported as s (singlet), br s (broad singlet), d (doublet). Values ​​of apparent coupling constants (J) are reported in Hz. High resolution mass spectrometry (HRMS) data were obtained using positive electrospray ionization (ESI) mode.

[0306] [Chemistry 3]

[0307]

[0308] 1.1.2. Synthesis of compound 3

[0309] In N 2 Under atmosphere, compound 1 1 To a stirred solution of 2-(80 mg, 0.24 mmol) and compound 2 (61 mg, 0.30 mmol) in dry DMF (0.8 ml) was added DIPEA (209 μl, 1.2 mmol). The resulting reaction mixture was heated to 75 °C for 19 hours. Then, the reaction mixture was cooled to room temperature and subjected to column chromatography purification (35-80% ethyl acetate in hexane) to isolate the newly formed product (78 mg, 70%). The resulting compound (50 mg, 0.107 mmol) was dissolved in methanol (3 ml), to which LiOH·H was added. 2 O (55 mg, 1.31 mmol, in 0.6 ml water) was added and stirred for 2 days. The volatiles were removed and water (2 ml) was added to the resulting compound. The pH was adjusted to ~7-8 with 2N HCl, the formed precipitate was filtered and the residue was washed with water, then with acetone and diethyl ether, which gave the desired compound 3 (32 mg, 66%).

[0310] 1 H NMR (400 MHz, DMSO-d 6 ): 1 H NMR (400 MHz, DMSO-d 6 )δ9.17(s,2H),9.11(br s,2H),7.79-7.55(m,5H),6.99-7.12(m,4H),4.76(d,J=5.2Hz,2H); 13 C NMR (150 MHz, DMSO-d 6 ): δ170.7,165.8,165.0,163.9,158.0,157.3(J=238.5Hz),136.4,121.5,114.8(J=21.0Hz),114.5,46.3; 19 F NMR (376 MHz, DMSO-d 6 )δ-121.7; HRMS (m / z): C 21H 17 F 2 N 8 O 2 + [M+H] + Calculated value 451.1437, measured value 451.1435.

[0311] 1.1.3. Immobilization of compound 3 on agarose beads

[0312] EAH Sepharose 4B (Cytiva) containing free amino groups was coupled to compound 3 using PyBOP (benzotriazole-1-yl-oxy-tripyrrolidino-phosphonium hexafluorophosphate). Sepharose 4B (6 ml) was transferred to a 10 ml column (PD-10 Cytiva) and the ethanol solution was discharged. The matrix was washed twice with DMF (6 ml each). Subsequently, compound 3 (6.2 mg, 13.76 μmol in 500 μl dry DMF), PyBOP (9.36 mg, 17.98 μmol in 500 μl DMF) and DIPEA (5 μl, 28.7 μmol) were added. The column containing the reaction mixture was placed in an oscillator at 25°C for 3 hours. Then, unreacted compounds were discharged from the matrix. The matrix was washed with DMF (2×1 ml) and acetonitrile (2×6 ml). The unreacted free amino groups of the matrix were blocked by acetyl groups by treating it with Cap A solution (THF: Lutidine: acetic anhydride [8:1:1]; 6 ml) at 25°C for 30 minutes. Then, the solution was drained from the matrix and washed with acetonitrile (3×6 ml). Finally, the matrix was stored in 50% methanol water (6 ml) at 4°C. Similarly, the acetylated matrix was prepared for negative selection by directly treating Sepharose 4B (6 ml) with Cap A solution.

[0313] 1.2. Oligonucleotides, Molecular Biology, and Buffers

[0314] OneTaq 2×Master Mix (NEB) and Q5 High Fidelity 2×Master Mix (NEB) containing standard buffer were used for PCR in SELEX rounds and NGS sequencing library preparation, respectively. Reverse transcription reactions were performed using Superscript III reverse transcriptase (Thermo Scientific) and Rev-primers (Table 1). HiScribe T7 Fast and Efficient RNA Synthesis Kit (NEB) was used for in vitro transcription of the initial RNA pool (700 μl) and for subsequent SELEX rounds (20 μl scale).

[0315] [Table 1]

[0316] Table 1. List of oligonucleotides used in SELEX experiments

[0317]

[0318] a,c Used for PCR during SELEX rounds.

[0319] b N represents a mixture of A, T, G and C (25% each).

[0320] c For reverse transcription.

[0321] Composed of 10mM HEPES-KOH (pH7.4), 140mM KCl, 10mM NaCl, 1mM MgCl 2 SELEX buffer consisting of 5% (v / v) DMSO and 0.01% (v / v) Tween 20 was used for refolding, washing and elution. Only in the case of elution, the buffer was supplemented with 1 mM ASP7967.

[0322] 1.3. Aptamer selection (SELEX)

[0323] The reaction buffer was composed of 1× standard (Mg-free) reaction buffer, 2 mM MgCl 2 , 0.2 mM dNTP and Taq DNA polymerase (25 U, NEB) in a volume of 1.0 ml for the reaction of N40-T7Fwd (1 nmol) and N40-Rev-Lib (1 nmol; ~6×10 15 Unique sequences) (Table 1) were overlapped and extended at 94°C for 2.5 minutes, 49°C for 30 seconds, and 68°C for 5.5 minutes. Subsequently, dsDNA was recovered by ethanol precipitation. Using the HiScribe T7 Fast and Efficient RNA Synthesis Kit (NEB), dsDNA containing T7 promoter (38 μg, ~0.57 nmol) was transcribed in vitro at 37°C in a volume of 700 μl for 6 hours. The solution was treated with 80 μl of 10× DNase I buffer and 20 μl of DNase I (40U, NEB) at 37°C for 45 minutes. The RNA pool was recovered by phenol-chloroform extraction followed by ethanol precipitation to be used as the initial RNA pool for SELEX.

[0324] The initial RNA pool (115.8 μg, ∼4.2 nmol) was mixed into 1.2 ml of SELEX buffer (10 mM HEPES-KOH, pH 7.4, 140 mM KCl, 10 mM NaCl, 1 mM MgCl) by incubation at 80°C for 3 min followed by cooling on ice. 2, 5% (v / v) DMSO, 0.01 (v / v) Tween 20). The annealed RNA pool was incubated with 200 μl of ligand-coupled agarose matrix in a column (PD-10, Cytiva) at 25°C for 45 minutes while shaking (Table 2). Subsequently, unbound RNA was removed from the column by gravity. The matrix was washed twice with SELEX buffer (1+0.4 ml), and the bound RNA sequences were recovered by adding 0.2 ml SELEX buffer supplemented with ASP7967 (1 mM) after shaking at 25°C for 30 minutes. The elution was repeated once more. The eluted RNA was ethanol precipitated using Quick-Precip Plus solution (EdgeBio). The progress of the SELEX experiment was monitored by measuring the absorbance (260 nm) of the recovered RNA (Table 3). The RNA pool was then reverse transcribed using SuperScript III reverse transcriptase (ThermoFisher Scientific) with Rev-primer (Table 1), and amplified by PCR using OneTaq 2×Master Mix (NEB) containing standard buffer with N40-T7Fwd and Rev-primer (Table 1). The PCR product was used as a template for in vitro transcription, treated with DNase I, and ethanol precipitated to produce an RNA pool for the next round of SELEX. In subsequent SELEX rounds, various parameters such as the amount of the input RNA pool, temperature, volume of the washing buffer, elution time, etc. were changed to adjust the stringency of the selection (Table 2). From the fourth round, negative selection was performed by incubating the input RNA pool with an acetyl-blocked matrix (150 to 1000 μl) and then incubating with a ligand-immobilized matrix to select sequences with affinity to the gel matrix (Table 2). The RNA pool generated after 7, 8, 9, and 10 rounds was used to prepare a library for deep sequencing analysis. RNA from each round was independently reverse transcribed (with a unique barcode sequence to identify the round) and PCR (with an adapter sequence) amplified. The resulting sequencing libraries were pooled together and sequenced using MiSeq Reagent Kit v3 (Illumina). 11 sequences were selected for ITC measurement based on the enrichment efficiency in the last three rounds of SELEX (data not shown). Due to the R10-6 (5'-GGGAAGAGAAGGACAUAUGAUCAAGUGAGAGAGACGGAUUCCG UCCGCGAAUUCACGCUGCUUGACUAGUACAUGACCACUUGA-3' (SEQ ID NO: 31)) observed by ITC Figure 2b ) (data not shown), R10-6 was selected for further analysis.

[0325] [Table 2]

[0326]

[0327] [Table 3]

[0328] Table 3. Amounts of RNA pool eluted after each SELEX round

[0329]

[0330] 2. Affinity Measurement by SPR

[0331] As Chang et al. 53 The affinity measurement of aptamers to ligands by SPR was performed as described with some modifications. The experiments were performed on a Biacore T200 (Cytiva) at 25°C. To immobilize the capture DNA (5'- / 5AmMC6 / TTTTTTTTTTTTTTTTTTTTTTTT-3' (SEQ ID NO: 32), / 5AmMC6 / : 5' amino modifier C6, IDT), 1xHBS-N (10 mM HEPES, pH 7.4, 150 mM NaCl) was used as running buffer. The CM5 chip surface was eluted with 20 μl min -1 Wash with two injections of NaOH / NaCl solution (25 mM NaOH, 1 M NaCl) for 30 seconds. -1 A solution containing 200 mM 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) and 50 mM N-hydroxysuccinimide (NHS) was injected into all flow cells for 7 min to activate the surface carboxylic acid groups. -1 The captured DNA (20 μM) was injected in 10 mM HEPES-KOH buffer (pH 7.5) supplemented with 0.6 mM hexadecyltrimethylammonium bromide for 10 minutes. -1 1 M ethanolamine-HCl (pH 8.5) was injected for 7 minutes to quench the unreacted activated carboxylic acid groups. To remove non-covalently adsorbed DNA on the chip surface, 20 μl / min -1 NaOH / NaCl solution was injected twice for 30 seconds. The level of immobilized DNA was 2846 ± 284 RU.

[0332] The dsDNA template for in vitro transcription of the aptamer was prepared by primer extension of two oligonucleotide (oligo) DNAs using Q5 high-fidelity DNA polymerase (NEB). AC17-4 RNA aptamer and its mutants containing a 3' poly (A) tail were synthesized by in vitro transcription using the ScriptMAX Thermo T7 Transcription Kit (TOYOBO) according to the manufacturer's instructions (Table 4). The reaction product was treated with 2U TURBO DNase (Thermo Fisher Scientific) at 37°C for 30 minutes and purified with RNAClean & Concentrator-25 Kit (Zymo Research). The 50 μg / ml RNA was purified by PCR according to the OligoCalc 54 , RNA concentration was determined by absorbance at 260 nm. RNA solution (~3.6 μM) was prepared in water and denatured by heating at 80°C for 3 minutes. After cooling for a few minutes at room temperature, the RNA solution was diluted with an equal volume of high salt buffer (10 mM Tris-HCl, pH 7.5, 1 M NaCl, 1 mM EDTA). Stock solutions of ASP2905 and ASP7967 in DMSO (20 mM, fumaric acid adduct, Astelas Pharma, Inc.) were prepared based on weight. The RNA was added in SPR running buffer (10 mM HEPES, pH 7.4, 150 mM NaCl, 0.05% (v / v) surfactant P-20, 1 mM MgCl 2 Ligand solutions of various concentrations were prepared in 2% (v / v) DMSO. -1 Inject RNA solution for 30 seconds, then inject SPR running buffer for 20 seconds. -1 The aptamer ligand was injected for 120 s to monitor association, and then the dissociation kinetics were monitored for 180 s in SPR running buffer. -1 The sensor surface was regenerated with a 10 μl injection of 25 mM NaOH, followed by SPR buffer for 30 seconds. Raw data were analyzed by Biacore T200 Evaluation Software 1.0 using a 1:1 Langmuir interaction model. The background signal from the reference flow cell was subtracted from the background signal of the sample flow cell, and non-ligand samples (SPR running buffer only) were injected in each experiment (double reference). The dissociation constant (K D ) is derived from the association and dissociation rate constants (K D =k off / k on ) or determined by equilibrium analysis. Graphs were generated using GraphPad Prism 9. Measurements were repeated at least twice to ensure reproducibility.

[0333] [Table 4]

[0334] Table 4. Sequences of AC17-4 aptamers and their mutants analyzed by SPR

[0335]

[0336] The mutated sequences are underlined.

[0337] 3. Affinity Measurement by ITC

[0338] As previously mentioned 26 ITC experiments were performed with some modifications. Template DNA for in vitro transcription was prepared by primer extension using Q5 high-fidelity DNA polymerase. AC17-4 RNA aptamer (5'-GCAAGUGAGAGAGACGGAUUCCGUCCGCGAAUUCACGCUGCUUGC-3' (SEQ ID NO: 50)) was prepared using HiScribe T7 Fast and Efficient RNA Synthesis Kit (NEB) according to the manufacturer's instructions. The transcript (100 μl) was treated with 2U TURBO DNase at 37°C for 30 minutes. RNA was precipitated with ammonium acetate and ethanol and dissolved in water. The solution was further extracted with phenol-chloroform and ethanol precipitation was performed. RNA was purified by denaturing polyacrylamide gel electrophoresis (PAGE) and the main band was extracted from the gel with TE buffer (10 mM Tris-HCl, pH 7.0, 0.1 mM EDTA). The purified RNA was concentrated and the buffer was exchanged for nuclease-free water using an ultrafiltration device (Amicon Ultra 0.5 ml, 3 kDa, Merck-Millicore). RNA concentration was determined by absorbance at 260 nm according to OligoCalc. RNA was mixed with 15 μl of DMSO and diluted to 270 μl with nuclease-free water, denatured at 80 °C for 3 minutes, and incubated at room temperature for 5 minutes. After adding 30 μl of 10× ITC buffer (0.2 M HEPES-KOH, pH 7.5, 1.4 M KCl, 0.1 M NaCl, 10 mM MgCl 2 ), a 7.5 μM RNA solution (300 μl) was incubated at room temperature for 30 minutes before measurement. Just before measurement, an ASP2905 solution (75 μM) was prepared in 5% (v / v) DMSO-1×ITC buffer.

[0339] Titrations were performed using a MicroCal PEAQ-ITC (Malvern) at 37°C. Injection parameters were as follows: initial 300 s delay, single 0.4 μl injection and 24 consecutive injections of 1.5 μl at 120 s intervals. Stirring speed and reference power were set to 750 rpm and 5 μcal sec, respectively.-1 Raw data were analyzed using a single-site binding model by MicroCal PEAQ-ITC analysis software version 1.0.0.1259. Measurements from control titrations (ASP2905 to buffer, buffer to AC17-4 RNA aptamer, buffer to buffer) were subtracted from sample measurements. Measurements were repeated twice to ensure reproducibility.

[0340] 4. Riboswitch Plasmid Design and Construction

[0341] Will Figure 6b , Figure 8a and Fig.12 The aptamer ribozyme sequence shown in was cloned into the 3'UTR of the EGFP mRNA encoded in pEGFP-BsaI-Amp (Figure 13). The sequence is shown in Table 5. The exon skipping riboswitch cassette was inserted between the 169th and 170th codons in the EGFP coding sequence in pEGFP-BsaI-Amp. The complete plasmid sequence of ex169-AC17-4-a8 (pEGFP-ex-169-AC17-4-a8) is provided in Figure 14. Other variant sequences are listed in Table 6. pEGFP-BsaI-Amp was used as an "empty vector" control in transfection experiments.

[0342] [Table 5]

[0343] Table 5. Riboswitch sequences (aptamer ribozymes)

[0344]

[0345] 1 Sequences are shown as DNA. The CPP ribozyme sequence is shown in bold, anti-Rz is shown in a box, and the AC17-4 aptamer is shown in shading.

[0346] 2 The 6 nt spacer upstream of the anti-Rz sequence in a8c-AC17-4-CPP is depicted in lower case letters.

[0347] 3 The extended P3 stem sequence is underlined. These constructs contain an anti-Rz sequence downstream of the aptamer that interferes with the P2 and P3 stems.

[0348] [Table 6]

[0349] Table 6. Riboswitch sequences (exon skipping)

[0350]

[0351] 1 The sequence is shown as DNA. The AC17-4 aptamer is shown in shaded areas.

[0352] 5. Riboswitch Assay in HEK293 Cells

[0353] HEK293 cells were cultured in a medium containing 2 mM L-glutamine and 100 units ml -1 The cells were cultured in Dulbecco's modified Eagle's medium (DMEM) (DMEM-FBS) supplemented with 10% heat-inactivated FBS (Gibco) containing penicillin-streptomycin. The cells were maintained in a humidified atmosphere with 5% CO. 2 The cells were cultured in a 37°C incubator and passaged regularly when they reached 90% confluency. Approximately 20 hours before transfection, the cells were trypsinized and diluted to ~2.7×10 5 Cells ml -1 100 μl was inoculated into each well of a 96-well plate. According to the manufacturer's instructions, 0.3 μl of TransIT-293 transfection reagent (Mirus) was used to transfect the cells in each well with 100 ng of EGFP aptamer ribozyme plasmid and 20 ng of pCMV-mCherry 27 (Transfection control) co-transfection. 5 hours after transfection, the medium in each well was replaced with fresh medium containing (up to 5 μM) or without ASP2905 or ASP7967. The aptamer ligand was dissolved in DMSO at a 1000× concentration. 48 hours after transfection, the medium in each well was replaced with 100 μl of phosphate-buffered saline (PBS), and the fluorescence intensity was measured by an Infinite M1000PRO microplate reader (Tecan). For EGFP, the fluorescence intensity was measured at 484 nm excitation / 510 nm emission / 5 nm bandwidth, and for mCherry, the fluorescence intensity was measured at 587 nm excitation / 610 nm emission / 10 nm bandwidth. The background fluorescence measured using untransfected cells was subtracted from the EGFP and mCherry fluorescence values. EGFP fluorescence was then normalized by mCherry fluorescence to account for the variability in transfection efficiency and cell counts. All reported values ​​are the average of three replicate wells.

[0354] 6. MTT assay

[0355] MTT assay was performed using an MTT cell counting kit (Nacalai Tesque). HEK293 cells were trypsinized and diluted to 2.4 × 10 5 Cells ml -1 100 μl was plated into each well of a 96-well plate. The cells were incubated at 5% CO 2The cells were cultured at 37°C for 24 hours. The medium was replaced with fresh medium (DMEM-FBS containing 0.1% (v / v) DMSO) containing 0, 2, 5, or 10 μM ASP2905 or ASP7967. The cells were incubated at 5% CO 2 The cells were incubated at 37°C for an additional 18 hours. Subsequently, 10 μl of MTT solution was added to each well and the cells were incubated at 5% CO. 2 The plates were incubated at 37°C for 3 hours. Then, 100 μl of the solubilization solution was added to each well. To dissolve the precipitated formazan, the plates were incubated at 37°C for 2 hours. The absorbance at 570 nm (reference wavelength: 700 nm) was measured by an Infinite M1000 PRO microplate reader (Tecan). The reported value is the average of four replicate wells. The assay was repeated three times to ensure reproducibility.

[0356] 7. In vitro hEPO assay

[0357] for Figure 9b For hEPO ELISA assay, HEK293 cells were trypsinized and diluted to 2.0 × 10 5 Cells ml -1 , and 100 μl per well was inoculated into a 96-well collagen plate. According to the manufacturer's instructions, 0.3 μl of TransIT-293 transfection reagent was used to transfect the cells in each well with 100 ng of pAAV-CMV-hEPO-p3-dpAAV-CMV-hEPO-control, pAAV-MCS-based plasmid encoding human EPO with or without CPP-a8c-AC17-4 riboswitch. 5 hours after transfection, the medium in each well was replaced with fresh medium containing (up to 10 μM) or without ASP7967. 24 hours after transfection, the medium in each well was collected and stored at -20 ° C. To measure the hEPO concentration, the culture medium was diluted 50 times by PBS and further diluted 50 times by the sample dilution buffer included in the ELISA kit. The diluted samples were measured using the Human Erythropoietin / EPO Quantikine ELISA Kit (R&D systems, Inc.) and an Infinite M200 PRO microplate reader (Tecan).

[0358] 8. In vivo hEPO Measurement

[0359] For AAV production, 293T cells inoculated in cellstack5 (Corning) were co-transfected with 227.9 μg of plasmids encoding AAV8 replication and capsid proteins, 455.8 μg of plasmids encoding auxiliary proteins, and 227.9 μg of pAAV-CMV-hEPO-a8c or -control using PEI MAX (Polysciences Inc). 6 days after transfection, cells and supernatants were harvested, then filtered and concentrated by KrosFlo Research IIi (Spectrum Labs, Inc) for use with AKTA avant 25 (GE healthcare), AAV purification by affinity chromatography. Then, the virus solution was ultracentrifuged and dialyzed. The titer of the AAV solution was determined by quantitative PCR using AAVpro titration kit (for real-time PCR) version 2 (Takara).

[0360] For in vivo animal experiments, 200 μl of PBS (as a control group) or purified AAV8 particles carrying the hEPO gene with or without the CPP-a8c-AC17-4 riboswitch (3.0 × 10 per mouse) were used. 10 7-week-old male BALB / c cAJcl mice (CLEA Japan Inc.) were intravenously injected with 100 mg / kg AAV genome (vg). 13 days after AAV injection, 24 μl of blood was collected from the tail vein of the mice, and the blood sample was immediately diluted with 96 μl. 24 hours after blood collection, 100 mg / kg AAV was orally administered to the mice. -1 ASP7967 or 0.5% methylcellulose in 0.5% methylcellulose (FUJIFILM Wako Pure Chemical Corp) was used as a vehicle solution. Blood samples were collected as described above 2, 4, 6, 8 and 24 hours after ASP7967 administration. The blood samples were incubated on ice and then centrifuged at 1,200 × g for 15 minutes at 4°C to collect serum samples. Serum samples were stored at -80°C and used for measurement of serum hEPO concentration by ELISA.

[0361] All animal experimental procedures were approved by the Institutional Animal Care and Use Committee of Astellas Pharma Inc. In addition, Astellas Pharma Inc. Tsukuba Research Center was granted Accreditation Status by the Association for Assessment and Accreditation of Laboratory Animal Care International (AAALAC International).

[0362] <Results>

[0363] 1. Aptamer Selection (SELEX) and Characterization

[0364] Conventional SELEX requires the immobilization of the target molecule on a solid phase to which a pool of RNA containing randomized sequences is applied. We synthesized a carboxylate derivative of ASP7967 (3) coupled to amino-containing agarose beads (EAH agarose 4B). 15 Unique sequence 37 Starting with a random RNA pool containing 40-nucleotide degenerate bases, we performed 10 rounds of affinity selection with increasing stringency (Table 2). Sequences enriched during the SELEX experiment were analyzed by high-throughput (Illumina) sequencing. After extensive screening of individual sequences enriched after SELEX (data not shown), we identified the sixth most abundant sequence in the final pool (R10-6) as a promising lead aptamer with a putative binding motif that included the randomized region ( Figure 2b ). The minimal binding motif AC17-4 ( Figure 2b ) binds both ASP2905 and ASP7967 with comparable affinity ( Figure 2c AC17-4 binds to ASP2905 and ASP7967 with K values ​​of 7.7 nM and 12 nM for ASP2905 and ASP7967, respectively, at 25 °C. D The binding of AC17-4 and ASP2905 at 37 °C was also measured by isothermal titration calorimetry (ITC), yielding a K of 48 nM. D ( Figure 3 ).

[0365] Mutational analysis of the AC17-4 aptamer was performed using SPR (Figures 4 and 5). The affinities of the mutants generally confirmed Figure 4a The secondary structure shown in . Single mutations in G2C, A3U, G4C, A5U, G6C, C20A, A30G, U34C and U34G eliminate or significantly impair binding, indicating that these nucleotides play a key role in aptamer structure or binding. Loops L2 and L4 can be replaced with the classic UUCG tetraloops (M12, M13) without loss of affinity, and therefore, are unlikely to participate in aptamer-ligand or tertiary interactions. It is inferred that base pair substitutions M9 and M11 negatively affect binding, which has raised some questions about these interactions. Further biochemical and structural studies of aptamer-ligand interactions are being conducted to improve affinity and riboswitch design strategies.

[0366] 2. Mammalian Riboswitches

[0367] Next, we sought to modulate gene expression in mammalian cells using AC17-4 and small molecule ligands. One of the most widely adopted strategies for regulating gene expression in mammalian cells based on aptamer-ligand interactions is to insert one or more allosteric self-cleaving ribozymes (apta-ribozymes) into the untranslated region (UTR) of the mRNA encoding the gene of interest. 5,6 Ribozyme self-cleavage (activated or inhibited by aptamer-ligand interactions) leads to mRNA degradation and repression of protein expression 39 .

[0368] We recently developed circularly permuted pistol (CPP) ribozymes as scaffolds to engineer aptamer ribozymes and riboswitches that function in mammalian cells 27 By ligating the original 5' and 3' ends of the native pistol ribozyme structure 40 And by destroying the original L3 ring ( Figure 6a , b) to generate new ends to design CPP. The base sequence of the pistol ribozyme ( Figure 6a ) is as follows: 5'-CGUCGUCUGGGCGACGGUAAAUAGGUGUUAGGCCCAGAGCGGCA GGGUUCUUCCCUGCGUCACA-3' (SEQ ID NO:66). We show that this scaffold can accommodate RNA aptamers at multiple positions to engineer riboswitches that function in mammalian cells. Here, we inserted the AC17-4 aptamer into the linker between the P2 and P1 stems along with an anti-ribozyme (anti-Rz) sequence complementary to the ribozyme sequence downstream of the aptamer ( Figure 6bThe basic principle of aptamer ribozyme design is that the ribozyme is active in the absence of ligand (gene expression OFF), but aptamer-ligand binding stabilizes an alternative structure in which anti-Rz forms the base-stem of the aptamer (P apt ). The ligand-bound structure disrupts the ribozyme folding, thereby inhibiting self-cleavage (gene expression ON) ( Figure 6b ). We have demonstrated that the performance of the switch can be tuned by adjusting the magnitude of the anti-Rz.

[0369] like Figure 6b As shown in , AC17-4 was inserted into the CPP scaffold. The anti-Rz sequence varied from 6 to 10 nucleotides, and the aptamer ribozyme was inserted into the 3'UTR of the EGFP transcript. Figure 6b The base sequence shown in is as follows:

[0370] 5'-CUCUAGACCCUGCGUCACAGCAGCAUGAGAGAGACGGAUUCC GUCCGCGAAUUCACGCUGCGUCGUCUGGGCGACGGUAAAUAGGUGU UAGGCCCAGAGCGGCAGGGUACAACU-3' (SEQ ID NO: 67)

[0371] 5'-CUCUAGACCCUGCGUCACAGCAGCAGUGAGAGACGGAUU CCGUCCGCGAAUUCACGCUGCGUCGUCUGGGCGACGGUAAAUAGGU GUUAGGCCCAGAGCGGCAGGGUACAACU-3'(SEQ ID NO:68)

[0372] 5'-CUCUAGACCCUGCGUCACAGCAGCAGAUGAGAGAGACGGAU UCCGUCCGCGAAUUCACGCUGCGUCGUCUGGGCGACGGUAAAUAGG UGUUAGGCCCAGAGCGGCAGGGUACAACU-3'(SEQ ID NO:69)

[0373] 5'-CUCUAGACCCUGCGUCACAGCAGCAGACUGAGAGAGACGGA UUCCGUCCGCGAAUUCACGCUGCGUCGUCUGGGCGACGGUAAAUAG GUGUUAGGCCCAGAGCGGCAGGGUACAACU-3'(SEQ ID NO:70)

[0374] 5'-CUCUAGACCCUGCGUCACAGCAGCAGACCUGAGAGAGACGGA UUCCGUCCGCGAAUUCACGCUGCGUCGUCUGGGCGACGGUAAAUAG GUGUUAGGCCCAGAGCGGCAGGGUACAACU-3' (SEQ ID NO: 71)

[0375] Here, in each base sequence, the EGFP sequence is linked to the 5' end, and the poly-A tail is linked to the 3' end.

[0376] EGFP-riboswitch plasmid and mCherry-expressing plasmid (transfection control) were co-transfected into HEK293 cells in the absence or presence (5 μM) of ASP2905 or ASP7967. EGFP and mCherry fluorescence were measured two days after transfection, and EGFP fluorescence was normalized by mCherry fluorescence to account for variability in transfection efficiency. As expected, weak anti-Rz resulted in low EGFP levels, and strong anti-Rz resulted in elevated EGFP levels, regardless of the presence or absence of ligand. In the presence of ASP2905 or ASP7967, the best switch response was observed with 8-nucleotide anti-Rz (a8-AC17-4-CPP), which activated EGFP expression by about 10-fold ( Figure 6c ). A significant deviation from the trend was the 7-nucleotide anti-Rz (a7-AC17-4-CPP) which showed higher ON and OFF expression levels. We attribute this to the coincidental complementarity of the nucleotides preceding the anti-Rz (CA) to the ribozyme sequence, making the effective anti-Rz sequence length longer than expected. Nevertheless, semi-rational tuning of the anti-Rz length once again proved to be an effective strategy for CPP aptamer ribozyme optimization.

[0377] Further analysis of the dose-dependent response of the riboswitch a8-AC17-4-CPP to ASP7967 ( Figure 6d ). The riboswitch response was mostly saturated at 5 μM ASP7967, EC 50 The fully induced ON level of a8-AC17-4-CPP was about 50% of that of the empty vector. Figure 6c As shown in our previous work 27 , through engineering aptamer ribozyme sequence design, the ON and OFF levels as well as the ON / OFF ratio can be fine-tuned to a certain extent.

[0378] ASP2905 or ASP7967 did not significantly affect the proliferation of HEK293 cells until 10 μM was added to the culture medium ( Figure 7). We therefore continued to explore the possibility of using riboswitches to chemically regulate gene expression in mice.

[0379] 3. Regulation of hEPO expression in mice

[0380] To demonstrate in vivo glycosylation function, we sought to modulate hEPO expression in mice using an adeno-associated viral (AAV) vector. hEPO is commonly used to treat anemia associated with chronic kidney disease. 41 , and it represents a class of genes that could benefit from chemically regulated expression from gene therapy vectors. After an initial screen of additional riboswitch variants (data not shown), we decided to perform in vivo studies using 8c-AC17-4-CPP due to the low basal expression (OFF) levels of riboswitch variants in HEK293 cells (Figure 8). Figure 8a The base sequence shown in is as follows: 5'-CUCUAGACCCUGCGUCACAAAGAAAAGACGACGUGAGAGAGACGGAUUCCGUCCGCGAAUUCACGCUGCGUC GUCUGGGCGACGGUAAAUAGGUGUUAGGCCCAGAGCGGCAGGGUAC AACU-3' (SEQ ID NO: 72). Here, the EGFP sequence is connected to the 5' end, and the poly-A tail is connected to the 3' end.

[0381] Then, 8c-AC17-4-CPP was inserted into the 3'UTR region of the hEPO gene expressed by the CMV promoter in a plasmid containing the AAV2 inverted terminal repeats (ITR) (pAAV-CMV-hEPO-a8c-AC17-4-CPP) ( Figure 9a ). Plasmid pAAV-CMV-hEPO-a8c-AC17-4-CPP was transfected into HEK293 cells in the absence or presence (0.1-10 μM) of ASP7967. Two days after transfection, hEPO concentrations in the culture medium were measured by ELISA. In the absence of ligand, hEPO secretion was attenuated to 2.8% compared to a control plasmid lacking a riboswitch (pAAV-CMV-hEPO-control). As expected, in the presence of 10 μM of ligand, hEPO levels in the culture medium reached 29% relative to hEPO levels in the control, equivalent to a 10-fold induction of ASP7967 ( Figure 9b ). These results demonstrate that the riboswitch functions in the context of an AAV vector to regulate hEPO expression.

[0382] Next, we investigated the efficacy and functionality of the riboswitch in vivo. Fig.10), we chose liver as the target tissue and AAV8 due to its strong liver tropism. Mice were intravenously injected with viral vectors AAV8-CMV-hEPO-control, AAV8-CMV-hEPO-a8c-AC17-4-CPP, or saline (WT). Two weeks after AAV injection, 100 mg kg -1 ASP7967 was dosed to induce expression from the riboswitch regulatory vector. Blood was drawn before and at multiple time points after oral administration ( Fig.9c The level of hEPO secreted in the serum of mice injected with control AAV (AAV8-CMV-hEPO-control) was approximately 550 mIU ml -1 , and 100 mg kg was administered during the observation period -1 The dose of ligand had no effect ( Figure 9d , upper right). On the other hand, after administration of 100 mg kg -1 In the case of a dose of ligand, the level of hEPO secretion induced by the riboswitch-regulated vector (AAV8-CMV-hEPO-a8c-AC17-4-CPP) reached approximately 115 mIU mL 6-8 hours after administration. -1 , equivalent to a 7.2-fold increase compared with the mice given vehicle ( Figure 9d , lower left). Serum hEPO levels subsequently decrease in accordance with a corresponding decrease in ligand concentrations in the liver ( Fig.10 ).

[0383] The moderate ON / OFF ratio of ∼10 exhibited by our riboswitches is typical of mammalian riboswitches. 5,6 For many applications, tighter regulation of gene expression is desirable. 42 A riboswitch mechanism based on exon skipping induced by aptamer-ligand interactions is described. In this strategy, a suicide exon containing an internal stop codon flanked by two introns is inserted into the gene whose expression is to be regulated ( Fig.11a ). The aptamer is placed immediately downstream of the 5'-splicing site (5'-ss) of the second intron. In the absence of ligand, the suicide exon is included in the spliced ​​transcript, resulting in an OFF state. The aptamer-ligand interaction induces a stable stem that masks the 5'-ss, which causes exon skipping, resulting in the expression of the desired protein ( Fig.11a ). The key variable is the stability of the base aptamer stem (P1); if it is too unstable, the suicide exon is constitutively incorporated, whereas if the P1 stem is too stable, the exon is always skipped.

[0384] We inserted the exon skipping switch module between codons 169 and 170 of EGFP. Varying the size of the P1 stem revealed that an 8-bp stem (ex169-AC17-4-a8) resulted in robust activation of EGFP expression with an ON / OFF ratio of 114 ( Fig.11b ). To search for riboswitches with higher ON levels, we screened variants with different P1 sequences / stabilities (data not shown). One of the variants ex169-AC17-4-a9+g2g7 showed ∼75% EGFP expression in the presence of ASP7967 relative to the control with a lower ON / OFF ratio of 58. To further improve its ON / OFF ratio, the CPP-based aptamer ribozyme variants CPP-AC17-4-a9-P3-9d and CPP-AC17-4-a9-P3-9e ( Fig.12 ) is inserted in the 3'UTR. Fig.12 The base sequence shown in is as follows:

[0385] 5'-CUCUAGACCCUGCGUCACAUGAGAGAGACGGAUUCCGUCCGCGA AUUCACGCUGUGUGACACGUCGUCUGGGCGACGGUAAAUAGGUGUU AGGCCCAGAGCGGCAAGGUCUAACU-3'(SEQ ID NO:73)

[0386] 5'-CUCUAGACCCUGCGUCACAUGAGAGAGACGGAUUCCGUCCGCGA AUUCACGCUGUGUGACACGUCGUCUGGGCGACGGUAAAUAGGUGUU AGGCCCAGAGCGGCAGAGUCUAACU-3'(SEQ ID NO:74)

[0387] Here, in each base sequence, the EGFP sequence is linked to the 5' end, and the poly-A tail is linked to the 3' end.

[0388] The dual exon skipping / aptamer ribozyme constructs a9+g2g7 / CPP-4a9-P3-9d and a9+g2g7 / CP P-4a9-P3-9e showed excellent ON / OFF ratios of 177 and 296, respectively, and ON levels of 64% and 52%, respectively, relative to the control.

[0389] <Discussion>

[0390] Although synthetic riboswitches exhibit many advantages for mammalian applications, such as low risk of immunogenic complications and small genetic size of the constructs 6, but there are still some remaining challenges for wider adoption by researchers. Here, we seek to expand the limited repertoire of aptamer-ligand pairs available for constructing mammalian riboswitches. ASP2905 was originally developed as an inhibitor of potassium voltage-gated channel subfamily H member 3 (KCNH3) to study its effects on cognitive performance in animals. 35 Small molecules have been used in vitro to stably express KCNH3 in CHO cells and cultured rat hippocampal neurons. Oral administration of ASP2905 up to 10 mg kg has been reported in rats. -1 34 Although no results have been published, ASP2905 has undergone Phase I clinical trials targeting Alzheimer's disease and schizophrenia (Annual Report 2010, Astellas, Inc., https: / / www.astellas.com / system / files / annual2010_en_0.pdf). ASP2905 is commercially available from several sources.

[0391] We performed SELEX on ASP7967, which contains an additional fluorine in the pendant phenyl group of ASP2905, which has better synthetic accessibility to 3 due to immobilization on agarose beads. Extensive screening of the enriched aptamer candidates after 10 rounds of SELEX led us to AC17-4 ( Figure 2b AC17-4 binds ASP2905 and ASP7967 with similar affinity ( Figure 2c Although the binding mode of these compounds to the aptamer is unclear at this time, mutational analysis ( Figure 4b ) and structural studies may allow further refinement of aptamer-ligand interactions. However, a significant advantage of RNA-based genetic devices such as riboswitches is that detailed structural information is not always required to engineer such devices. Here, we hypothesized that the putative P1 stem ( Figure 4a ) will be stabilized upon ligand binding as has been observed with other aptamers and inserted into the CPP ribozyme scaffold previously used to construct guanine- and tetracycline-responsive riboswitches 27 .

[0392] We found that a8-AC17-4-CPP acts as an ON-switch in response to ASP2905 and ASP7967. In the presence of 5 μM ligand, gene expression in cultured mammalian cells was upregulated ∼10-fold ( Figure 6c). It is noteworthy that most other aptamer ligands for mammalian riboswitches require concentrations of 100 μM or higher in culture medium to fully activate or repress gene expression. 16,20,33 The observed ON / OFF ratio is also the best among mammalian aptamer-ribozyme-based ON-switches reported to date. 12,16,18,20,21,23,26,27,30,43 However, the moderate baseline expression (OFF level) of these riboswitches often precludes applications that require tighter gene regulation. 42 Claims for excellent ON / OFF ratio of riboswitch based on exon skipping mechanism ( Fig.11a We adapted this riboswitch architecture to our AC17-4 aptamer and observed excellent switching properties, especially at low baseline expression levels ( Fig.11b , c). The combination of the exon skipping switch and the CPP aptamer ribozyme further increased the ON / OFF ratio to 296. This level of switching performance will significantly expand potential applications.

[0393] We have demonstrated that our riboswitch can regulate transgene expression in mice in response to oral administration of ASP7967. Oral administration of 100 mg kg -1 ASP7967 increased serum hEPO concentration by 7.2-fold ( Figure 9d ). Since the level of transgene expression in vivo depends on the pharmacokinetics of the ligand in the target tissue, the pharmacokinetics of ASP7967 were evaluated to verify the relationship between target tissue concentration and efficacy. It was found that as the concentration of ligand in the target tissue decreased, transgene expression decreased ( Figure 9d , Fig.10 ). Furthermore, re-administration of the ligand resulted in reactivation of hEPO (data not shown). Our riboswitch can stimulate transgene expression when the ligand is administered as needed, and transgene expression ceases as the ligand is cleared from plasma and target tissues. Thus, riboswitch-regulated gene therapy vectors may be able to reduce the effects of mitochondria such as MeCP2 by appropriate administration of the ligand. 44,45 ,insulin 46,47 and erythropoietin 48 side effects caused by overexpression.

[0394] In addition to riboswitches based on small molecule-aptamer binding, several chemically regulated riboswitches have been recently reported in mammalian cells and in animal models. Monteys et al. used LMI070, a small molecule drug in clinical trials for the treatment of spinal muscular atrophy (SMA), as a trigger to induce the inclusion of synthetic exons. 49. The molecule works by stabilizing the interaction with the U1 small nuclear RNA near the splice site. Although the engineered switch was optimized to function at low LMI070 concentrations where most endogenous splicing events are unaffected, prolonged exposure to the compound may lead to adverse effects. The riboswitch module is also slightly large, requiring 1.16 kbp or 560 bp for the full-size and miniaturized modules, respectively. It may also be more challenging to develop orthogonal switches that respond to additional molecules based on this strategy. Furthermore, in contrast to aptamers, which have been exploited to regulate gene expression through multiple different mechanisms 6 , the use of LMI070 will likely be limited to systems based on regulation of pre-mRNA splicing. Alternatively, morpholino oligonucleotides have been used to interfere with ribozyme cleavage to achieve high ON / OFF ratios. 50 However, a major challenge is the delivery of oligonucleotide effectors for in vivo applications. 51 .

[0395] The lack of small molecules and their aptamers that function effectively in vivo or in clinical settings remains a major challenge in the biomedical applications of synthetic riboswitches. 52 However, the development of new small molecule-aptamer pairs for applications in mammalian cells and animals is rare. This work represents one such effort to generate new mammalian riboswitches with improved properties. Riboswitch performance (sensitivity to inducer molecules, ON / OFF ratio, etc.) can be further improved by optimizing the aptamer sequence and / or chemical modification of ASP2905 / ASP7967.

[0396] <Circular permutation AC17-4 (cpAC17-4)>

[0397] Circularly permuted AC17-4 (cpAC17-4) was designed based on the AC17-4 aptamer (SEQ ID NO: 50). The base sequence of cpAC17-4 is shown below.

[0398] 5'-GGUGUCCGCGAAUUCACGCUGCUUGUUCGCAAGUGAGAGAGACA CC-3'(SEQ ID NO:77)

[0399] Affinity measurements of the cpAC17-4 aptamer to the ligand by SPR were performed as described above. For this measurement, a cpAC17-4 RNA aptamer containing a 3' poly(A) tail was synthesized and used.

[0400] 5'-GGUGUCCGCGAAUUCACGCUGCUUGUUCGCAAGUGAGAGAGACACCAAAAAAAAAAAAAAAAAAAAAAAA-3'(SEQ ID NO:82)

[0401] Affinity measurements determined that cpAC17-4 bound ASP2905, K D is 30nM.

[0402] Exon skipping riboswitch cassettes containing the cpAC17-4 aptamer (ex169-cpAC17-4-a7, ex169-cpAC17-4-a8, ex169-cpAC17-4-a9) were prepared by replacing the AC17-4 aptamer with the cpAC17-4 aptamer (core sequence; SEQ ID NO: 83) in the exon skipping riboswitch cassettes (ex169-AC17-4-a7, ex169-AC17-4-a8, ex169-cpAC17-4-a9; Table 6). The exon skipping riboswitch cassette was inserted between the 169th and 170th codons in the EGFP coding sequence in pEGFP-BsaI-Amp.

[0403] 5'-CCGCGAATTCACGCTGCTTGTTCGCAAGTGAGAGAG-3'(SEQ ID NO:83)

[0404] [Table 7]

[0405] Table 7. Riboswitch sequences (exon skipping)

[0406]

[0407] 1 Sequences are shown as DNA. The cpAC17-4 aptamer is highlighted with shading.

[0408] A riboswitch assay for exon skipping riboswitches using a cassette containing the cpAC17-4 aptamer was performed in the same manner as described above for ex169-AC17-4-a7, etc. This assay demonstrated that cpAC17-4 functions as part of a riboswitch in HEK293 cells like AC17-4.

[0409] References

[0410] 1.Buskirk, AR&Liu, DRCreating small-molecule-dependent switches to modulate biological functions. Chem. Biol. 12, 151-61 (2005).

[0411] 2.Xie,M.&Fussenegger,M.Designing cell function:assembly of syntheticgene circuits for cell biology applications.Nat.Rev.Mol.Cell Biol.19,507-525(2018).

[0412] 3.Gossen,M.&Bujard,H.Tight control of gene expression in mammaliancells by tetracycline-responsive promoters.Proc.Natl.Acad.Sci.U.S.A.89,5547-51(1992).

[0413] 4.Gossen,M.et al.Transcriptional activation by tetracyclines inmammalian cells.Science 268,1766-9(1995).

[0414] 5.Auslander,S.&Fussenegger,M.Synthetic RNA-based switches formammalian gene expression control.Curr.Opin.Biotechnol.48,54-60(2017).

[0415] 6.Yokobayashi,Y.Aptamer-based and aptazyme-based riboswitches inmammalian cells.Curr.Opin.Chem.Biol.52,72-78(2019).

[0416] 7.Panchapakesan,S.S.S.&Breaker,R.R.The case of the missing allostericribozymes.Nat.Chem.Biol.17,375-382(2021).

[0417] 8.Garst,A.D.,Edwards,A.L.&Batey,R.T.Riboswitches:structures andmechanisms.Cold Spring Harb.Perspect.Biol.3(2011).

[0418] 9.Dunn,M.R.,Jimenez,R.M.&Chaput,J.C.Analysis of aptamer discoveryandtechnology.Nat.Rev.Chem.1,0076(2017).

[0419] 10.Berens,C.,Groher,F.&Suess,B.RNAaptamers as genetic controldevices:the potential of riboswitches as synthetic elements for regulatinggeneexpression.Biotechnol.J.10,246-57(2015).

[0420] 11.Auslander,S.,Ketzer,P.&Hartig,J.S.A ligand-dependenthammerheadribozyme switch for controlling mammalian geneexpression.Mol.Biosyst.6,807-14(2010).

[0421] 12.Chen,Y.Y.,Jensen,M.C.&Smolke,C.D.Genetic control of mammalianT-cell proliferation with synthetic RNA regulatory systems.Proc.Natl.Acad.Sci.U.S.A.107,8531-6(2010).

[0422] 13.Ketzer,P.,Haas,S.F.,Engelhardt,S.,Hartig,J.S.&Nettelbeck,D.M.Synthetic riboswitches for external regulation of genes transferredbyreplication-deficient and oncolytic adenoviruses.Nucleic Acids Res.40,e167(2012).

[0423] 14.Nomura,Y.,Zhou,L.,Miu,A.&Yokobayashi,Y.Controllingmammalian geneexpression by allosteric hepatitis delta virus ribozymes.ACSSynth.Biol.2,684-9(2013).

[0424] 15.Bell,C.L.et al.Control of alphavirus-based gene expressionusingengineered riboswitches.Virology 483,302-11(2015).

[0425] 16.Xiang,J.S.et al.Massively parallel RNA device engineeringinmammalian cells with RNA-Seq.Nat.Commun.10,4327(2019).

[0426] 17.Pu,Q.et al.Intracellular Selection of Theophylline-SensitiveHammerhead Aptazyme.Mol.Ther.Nucleic Acids 20,400-408(2020).

[0427] 18.Beilstein,K.,Wittmann,A.,Grez,M.&Suess,B.Conditional controlofmammalian gene expression by tetracycline-dependent hammerheadribozymes.ACS Synth.Biol.4,526-34(2015).

[0428] 19.Zhong,G.,Wang,H.,Bailey,C.C.,Gao,G.&Farzan,M.Rationaldesign ofaptazyme riboswitches for efficient control of gene expression inmammaliancells.Elife 5(2016).

[0429] 20.Strobel,B.et al.High-throughput identification ofsyntheticriboswitches by barcode-free amplicon-sequencing in humancells.Nat.Commun.11,714(2020).

[0430] 21.Strobel,B.et al.A Small-Molecule-Responsive RiboswitchEnablesConditional Induction of Viral Vector-Mediated Gene Expression inMice.ACSSynth.Biol.9,1292-1305(2020).

[0431] 22.Lin,Y.H.&Chang,K.Y.Rational design of a syntheticmammalianriboswitch as a ligand-responsive-1 ribosomal frame-shiftingstimulator.NucleicAcids Res.44,9005-9015(2016).

[0432] 23.Dhamodharan,V.,Nomura,Y.,Dwidar,M.&Yokobayashi,Y.Optochemicalcontrol of gene expression by photocaged guanine andriboswitches.Chem.Commun.(Camb.)54,6181-6183(2018).

[0433] 24.Kim,N.&Yokobayashi,Y.Novel RNA Viral Vectors forChemicallyRegulated Gene Expression in Embryonic Stem Cells.ACSSynth.Biol.10,2959-2967(2021).

[0434] 25.Kobori,S.,Nomura,Y.,Miu,A.&Yokobayashi,Y.High-throughputassay andengineering of self-cleaving ribozymes by sequencing.Nucleic AcidsRes.43,e85(2015).

[0435] 26.Mustafina,K.,Fukunaga,K.&Yokobayashi,Y.Design of MammalianON-Riboswitches Based on Tandemly Fused Aptamer and Ribozyme.ACS Synth.Biol.9,19-25(2020).

[0436] 27.Mustafina,K.,Nomura,Y.,Rotrattanadumrong,R.&Yokobayashi,Y.Circularly-Permuted Pistol Ribozyme:A Synthetic Ribozyme ScaffoldforMammalian Riboswitches.ACS Synth.Biol.10,2040-2048(2021).

[0437] 28.Nomura,Y.,Kumar,D.&Yokobayashi,Y.Synthetic mammalianriboswitchesbased on guanine aptazyme.Chem.Commun.(Camb.)48,7215-7(2012).

[0438] 29.Sporing,M.,Boneberg,R.&Hartig,J.S.Aptamer-Mediated ControlofPolyadenylation for Gene Expression Regulation in Mammalian Cells.ACSSynth.Biol.9,3008-3018(2020).

[0439] 30.Stifel,J.,Sporing,M.&Hartig,J.S.Expanding the toolbox ofsyntheticriboswitches with guanine-dependent aptazymes.Synth.Biol.(Oxf.)4,ysy022(2019).

[0440] 31.Strobel,B.et al.Riboswitch-mediated Attenuation ofTransgeneCytotoxicity Increases Adeno-associated Virus Vector Yields in HEK-293 Cells.Mol.Ther.23,1582-91(2015).

[0441] 32.Takahashi,K.&Yokobayashi,Y.Reversible Gene Regulation inMammalianCells Using Riboswitch-Engineered Vesicular Stomatitis VirusVector.ACSSynth.Biol.8,1976-1982(2019).

[0442] 33.Groher,F.et al.Riboswitching with ciprofloxacin-developmentandcharacterization of a novel RNA regulator.Nucleic Acids Res.46,2121-2132(2018).

[0443] 34.Takahashi,S.,Ohmiya,M.,Honda,S.&Ni,K.The KCNH3 inhibitorASP2905shows potential in the treatment of attention deficit / hyperactivitydisorder.PLoS One 13,e0207750(2018).

[0444] 35.Takahashi,S.et al.Neurochemical and neuropharmacologicalcharacterization of ASP2905,a novel potent selective inhibitor of the potassiumchannelKCNH3.Eur.J.Pharmacol.810,26-35(2017).

[0445] 36.Takahashi,S.,Okamura,A.,Yamazaki,M.&Ni,K.ASP2905,aspecificinhibitor of the potassium channel Kv12.2 encoded by the Kcnh3 gene,ispsychoactive in mice.Behav.Brain Res.378,112315(2020).

[0446] 37.Dwidar,M.et al.Programmable Artificial Cells UsingHistamine-Responsive Synthetic Riboswitch.J.Am.Chem.Soc.141,11103-11114(2019).

[0447] 38.Zuker,M.Mfold web server for nucleic acid folding andhybridizationprediction.Nucleic Acids Res.31,3406-15(2003).

[0448] 39.Yen,L.et al.Exogenous control of mammalian gene expressionthroughmodulation of RNA self-cleavage.Nature 431,471-6(2004).

[0449] 40.Weinberg,Z.et al.New classes of self-cleaving ribozymes revealedbycomparative genomics analysis.Nat.Chem.Biol.11,606-10(2015).

[0450] 41.Hayat,A.,Haria,D.&Salifu,M.O.Erythropoietin stimulating agentsinthe management of anemia of chronic kidney disease.Patient Prefer Adherence2,195-200(2008).

[0451] 42.Boyne,A.R.,Danos,F.O.,Volles,J.M.&Guo,X.Regulation ofgeneexpression by aptamer-mediated modulation of alternative splicing.WO / 2016 / 126747(2016).

[0452] 43.Reid,C.A.,Nettesheim,E.R.,Connor,T.B.&Lipinski,D.M.Development ofan inducible anti-VEGF rAAV gene therapy strategy for thetreatment of wetAMD.Sci.Rep.8,11763(2018).

[0453] 44.Collins,A.L.et al.Mild overexpression of MeCP2 causes aprogressiveneurological disorder in mice.Hum.Mol.Genet.13,2679-89(2004).

[0454] 45.Gadalla,K.K.E.et al.Development of a Novel AAV GeneTherapyCassette with Improved Safety Features and Efficacy in a Mouse Modelof RettSyndrome.Mol.Ther.Methods Clin.Dev.5,180-190(2017).

[0455] 46.Gan,S.U.et al.Correction of Murine Diabetic Hyperglycaemia WithASingle Systemic Administration of An AAV2 / 8 Vector Containing A NovelCodonOptimized Human Insulin Gene.Curr.Gene Ther.16,65-72(2016).

[0456] 47.Thule,P.M.et al.Long-term glycemic control with hepatic insulingenetherapy in streptozotocin-diabetic mice.J.Gene Med.17,141-52(2015).

[0457] 48.Zhang,M.et al.Erythropoietin promotes abdominal aortic aneurysmsinmice through angiogenesis and inflammatory infiltration.Sci.Transl.Med.13,eaaz4959(2021).

[0458] 49.Monteys,A.M.et al.Regulated control of gene therapies bydrug-induced splicing.Nature 596,291-295(2021).

[0459] 50.Zhong,G.et al.A reversible RNA on-switch that controlsgeneexpression of AAV-delivered therapeutics in vivo.Nat.Biotechnol.38,169-175(2020).

[0460] 51.Roberts,T.C.,Langer,R.&Wood,M.J.A.Advances in oligonucleotidedrugdelivery.Nat.Rev.Drug Discov.19,673-694(2020).

[0461] 52.Tickner,Z.J.&Farzan,M.Riboswitches for Controlled ExpressionofTherapeutic Transgenes Delivered by Adeno-Associated ViralVectors.Pharmaceuticals(Basel)14,554(2021).

[0462] 53.Chang,A.L.,McKeague,M.,Liang,J.C.&Smolke,C.D.Kineticandequilibrium binding characterization of aptamers to small molecules usingalabel-free,sensitive,and scalable platform.Anal.Chem.86,3273-8(2014).

[0463] 54.Kibbe,W.A.OligoCalc:an online oligonucleotide propertiescalculator.Nucleic Acids Res.35,W43-6(2007).

[0464] 55.Salado,I.G.et al.Optimization of the pharmacokinetic propertiesofpotent anti-trypanosomal triazine derivatives.Eur.J.Med.Chem.151,18-26(2018).

[0465] 56.Dwidar,M.et al.Programmable Artificial Cells UsingHistamine-Responsive Synthetic Riboswitch.J.Am.Chem.Soc.141,11103-11114(2019).

Claims

1. An RNA aptamer that binds to ASP7967 or an analog thereof, the aptamer comprising: sequence: -X1-L1-X2-L2-X3- in X1 has the sequence Y1GY2GY3Y4Y5, L1 is a first stem-loop nucleotide sequence comprising a first stem region, a first loop region, and a second stem region, wherein the first stem region and the second stem region are 2 or more base pairs long and are substantially complementary to each other; X2 is A, G, C or U, L2 is a second stem-loop nucleotide sequence comprising a third stem region, a second loop region, and a fourth stem region, wherein the third stem region and the fourth stem region are 2 or more base pairs long and are substantially complementary to each other; and wherein the first base in the third stem region is G and the last base in the fourth stem region is C; X3 has the sequence UY6; and Y1, Y2, Y3, Y4, Y5 and Y6 are each independently A, G, C or U; or sequence: -S1-X2-L2-X3-L3-X1-S2- in S1 and S2 are each independently A, G, C or U, and S1 and S2 can form a base pair or a wobble base pair with each other; L3 is a third stem-loop nucleotide sequence comprising a fifth stem region, a third loop region, and a sixth stem region, wherein the fifth stem region and the sixth stem region are 1 or more base pairs long and are substantially complementary to each other; and X1, X2, X3 and L2 are as defined above; or sequence: -S3-X3-L3-X1-L1-X2-S4- in S3 is C and S4 is G; and X1, X2, X3, L1 and L3 are as defined above.

2. The RNA aptamer according to claim 1, in Y2 is selected from A or U; Y3 is selected from A or U; and / or Y4 is selected from G or C.

3. The RNA aptamer according to claim 2, in Y2 is A; Y3 is A; and / or Y4 is G.

4. The RNA aptamer according to claim 1, in Y1 and Y6 can form a base pair or a wobble base pair with each other.

5. The RNA aptamer according to claim 1, in Y1 is G and Y6 is U; or Y1 is U and Y6 is G.

6. The RNA aptamer according to claim 1, in The first stem region and the second stem region are 3 to 7 base pairs long and are substantially complementary to each other.

7. The RNA aptamer according to claim 1, in The first stem region and the second stem region are 5 base pairs long and are substantially complementary to each other.

8. The RNA aptamer according to claim 1, in The first stem region has the sequence GACGG and the second stem region has the sequence CCGUC.

9. The RNA aptamer according to claim 1, in The first loop region has 3 to 7 bases.

10. The RNA aptamer according to claim 1, in The first loop region has the sequence AUU or UUCG.

11. The RNA aptamer according to claim 1, in The third stem region and the fourth stem region have 1 to 5 base pairs and are substantially complementary to each other.

12. The RNA aptamer according to claim 1, in The third stem region and the fourth stem region have 3 or 4 base pairs and are substantially complementary to each other.

13. The RNA aptamer according to claim 1, in The third stem region has the sequence GCG and the fourth stem region has the sequence CGC; or The third stem region has the sequence GCGU and the fourth stem region has the sequence ACGC.

14. The RNA aptamer according to claim 1, in The second loop region has 3 to 7 bases.

15. The RNA aptamer according to claim 1, in The second loop region has the sequence AAUUCA or UUCG.

16. The RNA aptamer of claim 1, wherein the RNA aptamer comprises the sequence: -X1-L1-X2-L2-X3-, and further comprises a fifth stem region adjacent to the 5' end of X1 and a sixth stem region adjacent to the 3' end of X3, wherein the fifth stem region and the sixth stem region have 1 to 15 base pairs and are substantially complementary to each other, and wherein the fifth stem region and the sixth stem region form a double-stranded stem.

17. The RNA aptamer according to claim 1, in The fifth stem region and the sixth stem region are 3 to 7 base pairs in length and are substantially complementary to each other.

18. The RNA aptamer according to claim 1, in The fifth stem region and the sixth stem region are 4 base pairs long and are substantially complementary to each other.

19. The RNA aptamer according to claim 1, in The fifth stem region has the sequence CUUG and the sixth stem region has the sequence CAAG.

20. The RNA aptamer according to claim 1, in The third loop region has 3 to 7 bases.

21. The RNA aptamer according to claim 1, in The third loop region has the sequence UUCG.

22. The RNA aptamer according to claim 1, in S1 is C and S2 is G; or S1 is G and S2 is C.

23. The RNA aptamer of claim 1, wherein the RNA aptamer comprises the sequence: -S1-X2-L2-X3-L3-X1-S2-, and further comprises a seventh stem region adjacent to the 5' end of S1 and an eighth stem region adjacent to the 3' end of S2, wherein the seventh stem region and the eighth stem region have 1 to 15 base pairs and are substantially complementary to each other, and wherein the seventh stem region and the eighth stem region form a double-stranded stem.

24. The RNA aptamer of claim 1, wherein the RNA aptamer comprises the sequence: -S3-X3-L3-X1-L1-X2-S4-, and further comprises a ninth stem region adjacent to the 5' end of S3 and a tenth stem region adjacent to the 3' end of S4, wherein the ninth stem region and the tenth stem region have 1 to 15 base pairs and are substantially complementary to each other, and wherein the ninth stem region and the tenth stem region form a double-stranded stem.

25. The RNA aptamer according to claim 1, The RNA aptamers are arranged circularly.

26. The RNA aptamer according to claim 1, Among them, the analog of ASP7967 is ASP2905.

27. An RNA or DNA vector comprising the RNA aptamer according to claim 1 or a DNA sequence that can be transcribed into the RNA aptamer according to claim 1.

28. A riboswitch comprising the RNA aptamer of claim 1.

29. An RNA or DNA vector comprising the riboswitch of claim 28 or a DNA sequence capable of being transcribed into the riboswitch of claim 28.

30. The RNA or DNA vector of claim 29, further comprising a target sequence operably linked to the riboswitch or the DNA sequence, wherein the target sequence encodes a protein; or wherein the target sequence is a siRNA, a pre-miRNA, a pri-miRNA, a sgRNA, a lncRNA, an RNA aptamer, a ribozyme, a tRNA, or an rRNA; or a DNA sequence that can be transcribed into a siRNA, a pre-miRNA, a pri-miRNA, a sgRNA, a lncRNA, an RNA aptamer, a ribozyme, a tRNA, or an rRNA.

31. An isolated polynucleotide comprising: A riboswitch comprising an RNA aptamer capable of binding to ASP7967 or an analog thereof, or a DNA sequence capable of being transcribed into the riboswitch, and The target sequence encoding the protein, The riboswitch is operably linked to the target sequence such that expression of the protein is upregulated or downregulated in response to ASP7967 or an analog thereof.

32. The polynucleotide of claim 31, wherein the target sequence comprises a plurality of exons.

33. The polynucleotide of claim 32, wherein the target sequence comprises an alternatively spliced ​​exon flanked by a 5' intron and a 3' intron, wherein the alternatively spliced ​​exon comprises a stop codon, wherein when the alternatively spliced ​​exon is spliced ​​to the mRNA of the protein, the stop codon is in frame with the protein.

34. The polynucleotide of claim 31, wherein the polynucleotide further comprises a 3'UTR comprising a polyadenylation signal sequence, and wherein the riboswitch is inserted within the 3'UTR and on the 5' side of the polyadenylation signal sequence, and wherein the function of the polyadenylation signal sequence is regulated by the riboswitch.

35. The polynucleotide of claim 34, wherein the riboswitch further comprises a self-cleaving ribozyme.

36. The polynucleotide according to claim 35, wherein the self-cleaving ribozyme is activated when the aptamer binds to ASP7967 or an analog thereof, or the self-cleaving ribozyme is inactivated when the aptamer binds to ASP7967 or an analog thereof.

37. A kit for regulating the expression of a protein, comprising: ASP7967 or its analogs, and A polynucleotide according to claim 31 or a vector comprising the polynucleotide according to claim 31.

38. The kit according to claim 37, The kit is used for treating a disease.

39. The kit according to claim 38, The disease is a central nervous system disease, cognitive disorder or KCNH3-related disease.

40. The kit according to claim 39, The disease is ADHD, Parkinson's disease, Alzheimer's disease or schizophrenia.

41. A method for regulating the expression of a protein in vivo, the method comprising: introducing the polynucleotide according to claim 31 or a vector comprising the polynucleotide according to claim 31 into a cell, and ASP7967 or an analog thereof is contacted with the polynucleotide or the vector.

42. A method for treating or preventing a disease, the method comprising: introducing the polynucleotide according to claim 31 or a vector comprising the polynucleotide according to claim 31 into a subject, and ASP7967 or an analog thereof is contacted with the subject.

43. The method according to claim 42, The disease is a central nervous system disease, cognitive disorder or KCNH3-related disease.

44. The method according to claim 43, The disease is ADHD, Parkinson's disease, Alzheimer's disease or schizophrenia.

45. A method for treating a disease, the method comprising: ASP7967 or an analog thereof is administered to a subject receiving gene therapy using a vector comprising the polynucleotide of claim 31 .

46. ​​The method according to claim 45, Wherein the target sequence encodes a protein selected from the group consisting of: 4-1BB ligand, 5-helix, human CC chemokine, human L105 chemokine, human L105 chemokine designated as huL105_3, monokine induced by gamma interferon (MIG), part of CXCR4B protein, platelet basic protein (PBP), α1-antitrypsin, ACRP-30 homolog; complement component C1q C, adenoids-expressed chemokine (ADEC), aFGF; FGF-1, AGF, AGF protein, albumin, etoposide, angiostatin, anthrax vaccine, antibodies specific for brain degeneration protein, antistasin, anti-TGFβ family antibodies, antithrombin III, APM-1; ACRP-30; Famoxin, apolipoproteins, arylsulfatase B, b57 protein, BCMA, beta thromboglobulin (β-TG), bFGF; FG F2, coagulation factors, BMP processing enzyme furin, BMP-10, BMP-12, BMP-15, BMP-17, BMP-18, BMP-2B, BMP-4, BMP-5, BMP-6, BMP-9, bone morphogenetic protein-2, calcitonin, calpain-10a, calpain-10b, calpain-10c, cancer vaccines, carboxypeptidases, CC chemokines, MCP2, CCR5 variants, CCR7, CCR7, CD11a Mab, CD137; 4-1BB receptor protein, CD20 Mab, CD27, CD27L, CD30, CD30 ligand, CD33 immunotoxin, CD40, CD40L, CD52 Mab, Cerebus protein, Chemokine Eotaxin, Chemokine hIL-8, Chemokine hMCP1, Chemokine hMCP1a, Chemokine hMCP1b, Chemokine hMCP2, Chemokine hMCP3, Chemokine hSDF1b, Chemokine MCP-4, Chemokine TECK and TECK variants, Chemokine-like protein IL-8M1 full length and mature, Chemokine-like protein IL-8M10 full length and mature, Chemokine-like protein IL-8M3, Chemokine Chemokine-like protein IL-8M8 full length and mature, chemokine-like protein IL-8M9 full length and mature, chemokine-like protein PF4-414 full length and mature, chemokine-like protein PF4-426 full length and mature, chemokine-like protein PF4-M2 full length and mature, cholera vaccine, chondroitin-like protein, c-kit ligand; SCF; mast cell growth factor; MGF; fibrosarcoma-derived stem cell factor, CNTF and its fragments, pro- and active forms of coagulation factors, collagen, complement C5 Mab, connective tissue activation protein-III, CTAA16.88 Mab, CTAP-III, CTLA4-Ig, CTLA-8, CXC3, CXC3, CXCR3; CXC chemokine receptor 3, cyanobacterial antiviral protein-N, darbepoetin,named exodus, named huL105_7., DIL-40, Dnase, EDAR, EGF receptor Mab, ENA-78, endostatin, Eotaxin, epithelial neutrophil activation protein-78, EPO receptor; EPOR, erythropoietin (EPO) and EPO mimetics, Eutropin, Exodus protein, factor IX, factor VII, factor VIII, factor X and factor XIII, FAS ligand inhibitory protein (DcR3), FasL, FasL, FasL, FGF, FGF-12; fibroblast growth factor homologous factor-1, FGF-15, FGF-16, FGF-18, FGF-3; INT-2, FGF-4; gelonin, HST-1; HBGF-4, FGF-5, FGF-6; heparin-binding secretory transforming factor-2, FGF-8, FGF-9; neuroglial activating factor , flt-1, flt-3 ligand, follicle-stimulating hormone alpha subunit, follicle-stimulating hormone beta subunit, follicle-stimulating hormone, fractalkine, fragment, myofibroblast troponin I, FSH, galactosidase, galectin-4, G-CSF, GDF-1, gene therapy, glioma-derived growth factor, glucagon, glucagon-like peptide, glucocerebrosidase, glucose oxidase, glucosidase, glycodelin-A; progesterone Related endometrial proteins, GM-CSF, gonadotropin, granulocyte chemoattractant protein-2 (GCP-2), granulocyte-macrophage colony-stimulating factor, growth hormone, growth-regulated oncogene-α (GRO-α), growth-regulated oncogene-β (GRO-β), growth-regulated oncogene-γ (GRO-γ), hAPO-4; TROY, hCG, hepatitis B surface antigen, hepatitis B vaccine, HER2 receptor Mab, hirudin, HIV gp120, HIV gp41, HIV inhibitory peptide, HIV inhibitory peptide, HIV inhibitory peptide, HIV protease inhibitory peptide, HIV-1 protease inhibitor, HPV vaccine, human 6CKine protein, human Act-2 protein, human adipogenesis inhibitory factor, human B cell stimulating factor-2 receptor, human β-chemokine H1305 (MCP-2), human CC chemokine DGWCC, human CC chemokine ELC protein, human CC type chemokine interleukin C, human CCC3 protein, human C CF18 chemokine, human CC-type chemokine protein named SLC (secondary lymphoid chemokine), human chemokine beta-8 short form, human chemokine C10, human chemokine CC-2, human chemokine CC-3, human chemokine CCR-2, human chemokine Ck beta-7, human chemokine ENA-78, human chemokine eotaxin, human chemokine GRO alpha, human chemokine GRO alpha, human chemokine GRO beta, human chemokine HCC-1,Human chemokine HCC-1, human chemokine 1-309, human chemokine IP-10, human chemokine L105_3, human chemokine L105_7, human chemokine MIG, human chemokine MIG-β protein, human chemokine MIP-1α, human chemokine MIP1β, human chemokine MIP-3α, human chemokine MIP-3β, human chemokine PF4, human chemokine protein 331D5, human chemokine protein 61164, human chemokine receptor CXCR3, human chemokine SDF1α, human chemokine SDF1β, human chemokine ZSIG-35, human Chr19Kine protein, human CKβ-9, human CKβ-9, human CX3C 111 amino acid chemokine, human DNAX interleukin-40, human DVic-1 CC chemokine, human EDIRF I protein sequence, human EDIRF II protein sequence, human eosinophil CC-type chemokine eotaxin, human eosinophil-expressed chemokine (EEC), human fast-twitch skeletal muscle troponin C, human fast-twitch skeletal muscle troponin I, human fast-twitch skeletal muscle troponin subunit C, human fast-twitch skeletal muscle troponin subunit I, human fast-twitch skeletal muscle troponin subunit T, human fast-twitch skeletal muscle troponin T, chemokine expressed by human fetal spleen, FSEC, human GM-CSF receptor, human gro-α chemokine, human gro-β chemokine, human gro-γ chemokine, human IL-16 protein, human IL-1RD10 protein sequence, human IL-1RD9, human IL-5 receptor alpha chain, human IL-6 receptor, human IL-8 receptor protein hIL8RA, human IL-8 receptor protein hIL8RB, human IL-9 receptor protein, human IL-9 receptor protein variant #3, human IL-9 receptor protein variant fragment, human IL-9 receptor protein variant fragment #3, human interleukin 1δ, human leukocyte Interleukin 10, human interleukin 10, human interleukin 18, human interleukin 18 derivative, human interleukin-1β precursor, human interleukin-1β precursor, human interleukin-1 receptor accessory protein, human interleukin-1 receptor antagonist beta, human interleukin-1 type-3 receptor, human interleukin-10 (precursor), human interleukin-10 (precursor), human interleukin-11 receptor, human interleukin-12 40kD subunit, human interleukin-12β-1 receptor , human interleukin-12β-2 receptor, human interleukin-12p35 protein, human interleukin-12p40 protein, human interleukin-12 receptor, human interleukin-13α receptor, human interleukin-13β receptor, human interleukin-15, human interleukin-15 receptor from clone P1, human interleukin-17 receptor, human interleukin-18 protein (IL-18), human interleukin-3, human interleukin-3 receptor, human interleukin-3 variant,Human interleukin-4 receptor, human interleukin-5, human interleukin-6, human interleukin-7, human interleukin-7, human interleukin-8 (IL-8), human intracellular IL-1 receptor antagonist, human IP-10 and HIV-1gp120 hypervariable region fusion protein, human IP-10 and human Muc-1 core epitope (VNT) fusion protein, human liver and activation-regulated chemokine (LARC), human Lkn-1 full length and mature protein, human mammary gland-associated chemokine (MAC K) protein full length and mature, human mature chemokine Ckβ-7, human mature gro-α, human mature gro-γ polypeptide for the treatment of sepsis, human MCP-3 and human Muc-1 core epitope (VNT) fusion protein, human MI10 protein, human MI1A protein, human monocyte chemoattractant factor hMCP-1, human monocyte chemoattractant factor hMCP-3, human monocyte chemoattractant proprotein (MCPP) sequence, human neuroattractant chemokine chemokine-like domain, human non-ELR CXC chemokine H174, human non-ELR CXC chemokine IP10, human non-ELR CXC chemokine Mig, human PAI-1 mutant, human protein with IL-16 activity, human protein with IL-16 activity, human secondary lymphoid tissue chemokine (SLC), human SISD protein, human STCP-1, human stromal cell-derived chemokine, SDF-1, human chemokine expressed by mixed lymphocyte reaction of T cells (TMEC), human thymus and activation-regulated cytokine (TARC), human thymus-expressed, human TNF-α, human TNF-α, human TNF-β (LT-α), human CC-type chemokine eotaxin 3 protein sequence, human type II interleukin-1 receptor, human wild-type interleukin-4 (hIL-4) protein, human ZCHEMO-8 protein, humanized anti-VEGF antibodies and fragments thereof, humanized anti-VEGF antibodies and fragments thereof, hyaluronidase, ICE10kD subunit, ICE 20kD subunit, ICE 22kD subunit, iduronate 2-sulfatase, iduronidase, IL-1α, IL-1β, IL-1 inhibitor (IL-1i), IL-1 maturation, IL-10 receptor, IL-11, IL-11, IL-12p40 subunit, IL-13, IL-14, IL-15, IL-15 receptor, IL-17, IL-17 receptor, II-17 receptor, II-17 receptor, IL-19, IL-li fragment, IL1-receptor antagonist, IL-21 (TIF), fusion protein containing IL-3, IL-3 mutant protein, IL-3 variant, IL-3 variant, IL-4, IL-4 mutant protein, IL-4 mutant protein Y124G, IL-4 mutant protein Y124X, IL-4 mutant protein, II-5 receptor, IL-6, II-6 receptor, IL-7 receptor clone, IL-8 receptor,IL-9 mature protein variant (Met117 type), immunoglobulin or immunoglobulin-based molecule or fragment of either (e.g. Small Modular ImmunoPharmaceutical, TM ("SMIP") or dAb, Fab' fragment, F(ab')2, scAb, scFv or scFv fragment), including but not limited to plasminogen, influenza vaccine, inhibin alpha, inhibin beta, insulin, insulin-like growth factor, integrin Mab, inter-alpha trypsin inhibitor, inter-alpha trypsin inhibitor, interferon gamma-induced protein (IP-10), interferons (such as interferon alpha species and subspecies, interferon beta species and subspecies, interferon gamma species and subspecies), interferons (such as interferon alpha species and subspecies, interferon beta species and subspecies, interferon gamma species and subspecies), interleukin 6, interleukin 8 (I L-8) receptor, interleukin 8 receptor B, interleukin-1α, interleukin-2 receptor-associated protein p43, interleukin-3, interleukin-4 mutant protein, interleukin-8 (IL-8) protein, interleukin-9, interleukin-9 (IL-9) mature protein (Thr117 type), interleukins (such as IL0, IL11 and IL2), interleukins (such as IL0, IL11 and IL2), Japanese encephalitis vaccine, Kalikrein inhibitor, keratinocyte growth factor, Kunitz domain proteins (such as aprotinin, amyloid precursor protein and WO those described in 03 / 066824, with or without albumin fusion), Kunitz domain protein, aprotinin, amyloid precursor protein with or without albumin fusion, LACI, lactoferrin, potential TGF-β binding protein II, leptin, liver expressed chemokine-1 (LVEC-1), liver expressed chemokine-2 (LVEC-2), LT-α, LT-β, ​​luteinizing hormone, Lyme disease vaccine, lymphocyte chemoattractant, macrophage derived chemokine analog MDC(n+1), macrophage derived chemokine analog MDC-eyfy, macrophage derived chemokine analog MDC-yl, macrophage derived chemokine, MDC, macrophage derived chemokine (MDC), Maspin;Proteinase inhibitor 5, MCP-1 receptor, MCP-1a, MCP-1b, MCP-3, MCP-4 receptor, M-CSF, melanoma inhibitory protein, membrane-bound protein, Met117 human interleukin 9, MIP-3α, MIP-3β, MIP-γ, MIRAP, modified Rantes, monoclonal antibody, MP52, mutant interleukin 6S176R, myofibrillar contractile protein troponin I, natriuretic peptide, nerve growth factor-β, nerve growth factor-β2, neuropilin-1, neuropilin-2, neurochemokine, neurotrophin-3, neurotrophin-4, neurotrophin-4a, neurotrophin-4b, neurotrophin-4c, neurotrophin-4d, neutrophil-activating peptide-2 (NAP-2), NOGO-66 receptor, NOGO-A, NOGO-B, NO GO-C, a new β-chemokine named PTEC, N-terminally modified chemokine GroHEK / hSDF-1α, N-terminally modified chemokine GroHEK / hSDF-1β, N-terminally modified chemokine met-hSDF-1α, N-terminally modified chemokine met-hSDF-1β, OPGL, osteogenic protein-1; OP-1; BMP-7, osteogenic protein-2, OX40; ACT-4, OX40L, oxytocin (neurohypophysis transporter I), parathyroid hormone, Patched, Patched-2, PDGF-D, pertussis toxoid, pituitary expressed chemokine (PGEC), placental growth factor, placental growth factor-2, plasminogen activator inhibitor-1; PAI-1, plasminogen activator inhibitor-2; PAI-2, plasminogen activator inhibitor-2;PAI-2, platelet-derived growth factor, platelet-derived growth factor Bv-sis, platelet-derived growth factor precursor A, platelet-derived growth factor precursor B, platelet Mab, platelet-derived endothelial cell growth factor (PD-ECGF), platelet-derived growth factor A chain, platelet-derived growth factor B chain, peptides for the treatment of sepsis, prepro-apolipoprotein "Milan" variant, prepro-apolipoprotein "Paris" variant, prothrombin, primate CC chemokine "ILINCK", primate CXC chemokine "IBICK", proinsulin, prolactin, prolactin 2, prosaptide, protease inhibitory peptide, protein C, protein S, prothrombin, prourokinase, RANTES, RANTES 8-68, RANTES 9-68, RANTES peptide, RANTES receptor, recombinant interleukin-16, resistin, restrictocin, retroviral protease inhibitor, ricin, rotavirus vaccine, RSVMab, saporin, Sarcina, secreted and transmembrane polypeptide, secreted and transmembrane polypeptide, serum cholinesterase, serum protein, coagulation factor, soluble BMP receptor kinase protein-3, soluble VEGF receptor, stem cell inhibitory factor, Staphylococcus vaccine, stromal-derived factor-1α, stromal-derived factor-1β, substance P (tachykinin), T1249 peptide, T20 peptide, T4 Endonuclease, TACI, Tarc, TGF-β1, TGF-β2, Thr117 human interleukin 9, thrombin, thrombopoietin, thrombopoietin derivative 1, thrombopoietin derivative 2, thrombopoietin derivative 3, thrombopoietin derivative 4, thrombopoietin derivative 5, thrombopoietin derivative 6, thrombopoietin derivative 7, thymus-expressed chemokine (TECK), thyroid-stimulating hormone, tick anticoagulant peptide, Tim-1 protein, TNF-α precursor, TNF-R, TNF-RII; TNF p75 receptor; death receptor, tPA, transferrin, transforming growth factor β, troponin peptide, truncated monocyte chemoattractant protein 2 (6-76), truncated monocyte chemoattractant protein 2 (6-76), truncated RANTES protein (3-68), tumor necrosis factor, urate oxidase, urokinase, vasopressin (neurohypophysis transporter protein II), VEGF R-3; flt-4, VEGF receptor; KDR; flk-1, VEGF-110, VEGF-121, VEGF-138, VEGF-145, VEGF-162, VEGF-165, VEGF-182, VEGF-189, VEGF-206, VEGF-D, VEGF-E; VEGF-X, von Willebrand factor, wild-type monocyte chemoattractant protein 2, wild-type monocyte chemoattractant protein 2, ZTGF-β9, β; (T87Q) -globin, SMN1, chimeric antigen receptor, RPE65, F8, HGF, LPL, p53, apoe2, arylsulfatase A, NAGLU, SGSH, AADC, GAD, GDNF, NRTN, LCAT, GBA, FGF-1, FGF-2, ADA, CLN2, CLN6, CLN3, IDS, huntingtin, TRAIL, dystrophin, GALGT2, accA, IDUA, GLB1, FS344, SGCA, DYSF, ABCD1, Gigaxonin and their functional fragments.

Images