Application of aminooxyacetic acid to reduction of compost malodorous gas emission

Abstract

The invention provides application of aminooxyacetic acid (AOAA) in reduction of compost malodorous gas emission, and belongs to the technical field of biological agriculture. The invention provides a method for reducing compost malodorous gas emission. Agricultural waste and aminooxyacetic acid are mixed and then subjected to aerobic composting. According to the method disclosed by the invention, key enzymes cystathionine-gamma-lyase (CSE) and cystathionine-beta-synthase (CBS) of hydrogen sulfide in the composting process are inhibited by adding a low dosage of aminooxyacetic acid, so that the generation and emission of metabolite hydrogen sulfide malodorous gas are highly inhibited; the emission of foul odor (hydrogen sulfide) in the composting process of livestock and poultry manure agricultural wastes is reduced, and the related action relationship of sulfur components is changed, so that the sulfur loss is reduced, the sulfur content and the utilization rate of compost products are improved, and further the aims of enhancing the treatment of livestock and poultry manure solid wastes, enhancing the foul odor control and promoting the development of the waste recycling industry are achieved. And the purpose of high-quality recycling is achieved.

Description

Technical Field

[0001] The invention belongs to the technical field of biological agriculture, and particularly relates to the application of aminooxyacetic acid (AOAA) in reducing the emission of malodorous gas from composting. Background Art

[0002] Aerobic composting is one of the main methods for resource utilization of agricultural organic solid waste (especially livestock and poultry manure waste). However, during the heating and high temperature stages of the composting process, more than 50% of the total sulfur is lost in the form of volatile sulfides mediated by microorganisms, and a large amount of foul odor is emitted. Among them, hydrogen sulfide is a foul-smelling, corrosive and highly toxic composting byproduct. Due to its low detection olfactory threshold and high odor activity, it can also produce serious odor pollution at low concentrations, which leads to a large amount of sulfur loss and affects the quality of compost products, which seriously hinders the development of the composting industry. Optimizing the material conveying process, adjusting the physical and chemical properties, optimizing the composting parameters or using gene-knockout modified microorganisms to reduce odor generation and emissions are the current mainstream solutions, but the impact on the key nodes of the metabolic process during the composting process is small, and there are also complex experimental operation processes, low inhibition efficiency and high costs, which do not solve the problem of hydrogen sulfide emissions from the root. Summary of the invention

[0003] In view of this, the object of the present invention is to provide an application of aminooxyacetic acid in reducing the emission of malodorous gas from composting. Aminooxyacetic acid inhibits the conversion of sulfur compounds into hydrogen sulfide by acting on cystathionine-γ-lyase (CSE) and cystathionine-β-synthase (CBS), key enzymes in microbial-mediated sulfur metabolism, thereby achieving the purpose of reducing the emission of hydrogen sulfide, a sulfur-containing malodorous gas.

[0004] The invention provides application of aminooxyacetic acid in reducing emission of malodorous gas from composting.

[0005] Preferably, the raw materials for composting include agricultural waste such as livestock excrement.

[0006] Preferably, the composting malodorous gas comprises hydrogen sulfide.

[0007] The present invention provides a method for reducing the emission of malodorous gas from composting, comprising the following steps:

[0008] Mix agricultural waste with aminooxyacetic acid and then perform aerobic composting.

[0009] Preferably, the added mass of the aminooxyacetic acid accounts for 0.5‰ to 0.7‰ of the dry weight of the agricultural waste.

[0010] Preferably, the carbon-nitrogen ratio of the agricultural waste is 25-30.

[0011] Preferably, the moisture content of the agricultural waste is 60% to 70%.

[0012] Preferably, the particle size of the agricultural waste is ≤2 cm.

[0013] Preferably, intermittent ventilation is performed during the entire aerobic composting process; the intermittent ventilation is performed once every 3 to 4 hours; each time for 1 to 1.5 hours;

[0014] The ventilation volume of the intermittent ventilation is 0.25 to 0.5 L / min.

[0015] Preferably, the aerobic composting time is 50 to 60 days.

[0016] The present invention provides the application of aminooxyacetic acid in reducing the emission of malodorous gas from composting. The present invention inhibits the activity of cystathionine-γ-lyase (CSE) and cystathionine-β-synthase (CBS), key enzymes in sulfur metabolism during composting, by adding non-biotoxic aminooxyacetic acid. Under the condition of adding low doses, the generation and emission of hydrogen sulfide malodorous gas, a metabolite on the pathway, can be highly inhibited, and the dissipation of malodorous odor during the composting of agricultural waste such as livestock and poultry manure can be reduced. Experiments show that aminooxyacetic acid, as a targeted enzyme inhibitor, inhibits the role of key enzymes in sulfur metabolism, reduces the relative abundance of key enzyme encoding genes, thereby affecting the sulfur metabolic pathway of microbial action, changing the relevant action relationship of sulfur components, and reducing the emission of hydrogen sulfide gas, thereby reducing sulfur loss, increasing the sulfur content and utilization rate of compost products, and thus achieving the purpose of strengthening the management of livestock and poultry manure solid waste, strengthening odor control, promoting the development of waste recycling industry, and high-quality resource utilization. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The dynamic change results of the inhibition efficiency of the enzyme inhibitor AOAA on hydrogen sulfide during the composting process, where a is a line chart showing the dynamic changes in the daily emission of hydrogen sulfide; b is a bar chart showing the dynamic changes in the inhibition efficiency of the enzyme inhibitor;

[0018] Figure 2 The results of the relative content changes of genes encoding key enzymes during the composting process, where a is the relative abundance bar graph of the enzyme encoding gene CTH of CSE during the composting process; b is the relative abundance bar graph of the enzyme encoding gene Cbs of CBS during the composting process;

[0019] Figure 3 The figure is a diagram showing the dynamic changes of sulfur content during the composting process, where a is a bar graph showing the changes in effective sulfur content during the composting process; and b is a bar graph showing the changes in total sulfur content during the composting process. DETAILED DESCRIPTION

[0020] The invention provides application of aminooxyacetic acid in reducing emission of malodorous gas from composting.

[0021] In the present invention, the aminooxyacetic acid is 2-(aminooxy)acetic acid, with a molecular formula of C2H5NO3, a molecular weight of 91.07, a CAS number of 645-88-5, and a structural formula as shown in Formula I. In the embodiments of the present invention, the aminooxyacetic acid is purchased from Cayman Chemical Company.

[0022]

[0023] In the present invention, the raw materials of the compost preferably include agricultural wastes such as poultry and livestock manure and wood-based agricultural wastes. The agricultural wastes such as poultry and livestock manure preferably include at least one of the following: poultry manure, livestock manure and human manure. The poultry preferably includes chickens, ducks, geese, ostriches, pigeons, quails, etc. The livestock manure includes cattle, sheep, horses, donkeys, camels, mules, etc. The compost odor gas preferably includes hydrogen sulfide.

[0024] In the present invention, the aminooxyacetic acid acts as an inhibitor of cystathionine-γ-lyase (CSE) and cystathionine-β-synthase (CBS), key enzymes in sulfur metabolism, and competitively binds to the active site of the enzyme with the substrate, thereby preventing the binding of substrates such as cysteine ​​with the enzyme during metabolism, thereby inhibiting the catalytic activity of the two key enzymes, destroying the conversion process of sulfur-containing compounds to hydrogen sulfide, and effectively reducing the emission of hydrogen sulfide, a sulfur-containing malodorous gas of the metabolite in this process, reducing the risk of environmental pollution, and promoting high-quality sulfur fixation of compost products. The technical solution of the present invention ensures the quality of the compost product without compromising the compost efficiency, while solving environmental problems.

[0025] The present invention provides a method for reducing the emission of malodorous gas from composting, comprising the following steps:

[0026] Mix agricultural waste with aminooxyacetic acid and then perform aerobic composting.

[0027] In the present invention, the added mass of aminooxyacetic acid preferably accounts for 0.5‰ to 0.7‰ of the dry weight of agricultural waste, and can be 0.6‰. The present invention has no special restrictions on the mixing, and a mixing method well known in the art can be adopted. The carbon-nitrogen ratio of the agricultural waste is preferably 25 to 30. The method for adjusting the carbon-nitrogen ratio of the agricultural waste is to adjust the carbon-nitrogen ratio by adding wood-based agricultural waste based on poultry and livestock manure. In an embodiment of the present invention, wood chips are added based on chicken manure to adjust the carbon-nitrogen ratio. The moisture content of the agricultural waste is preferably 60% to 70%, and can be 65%. The agricultural waste is adjusted by adding deionized water. The particle size of the agricultural waste is preferably ≤2cm, and can be 1 to 2cm.

[0028] In the present invention, the aerobic composting is divided into five stages: an initial stage of 25 to 30°C, a temperature rise period of 30 to 50°C, a high temperature period of 50 to 60°C, a temperature drop period of 40°C to 30°C, and a mature period of 40°C to 30°C. Intermittent ventilation is preferably performed throughout the entire process of aerobic composting. The intermittent ventilation is preferably performed once every 3 to 4 hours; each time for 1 to 1.5 hours. The ventilation volume of the intermittent ventilation is preferably 0.25 to 0.5 L / min, and can be 0.3 to 0.4 L / min. The time of aerobic composting is preferably 50 to 60 days, and can be 52 to 58 days, or 55 days.

[0029] The application of aminooxyacetic acid (AOAA) provided by the present invention in reducing the emission of malodorous gases from composting is described in detail below in conjunction with the examples, but they should not be construed as limiting the scope of protection of the present invention.

[0030] Example 1

[0031] A method for reducing the emission of malodorous gases from composting

[0032] The livestock and poultry manure used for composting comes from fresh chicken manure produced by a farm in Xiangfang District, Heilongjiang Province. Before composting begins, the chicken manure is air-dried to remove large impurities, crushed evenly, and the particle size is controlled at 1 to 2 cm. Then, sawdust is used to adjust the carbon-nitrogen ratio to 25, and deionized water is used to adjust the moisture content of the material to 60%. The targeted enzyme inhibitor aminooxyacetic acid is added to the material, and the amount added is 0.5‰ of the dry weight of the composted material, and it is fully mixed. During the composting period, intermittent ventilation is carried out, once every 3 hours, 1 hour each time, and the ventilation volume is 0.25L / min. A composting test lasting 55 days was carried out. Among them, the composting system with the enzyme inhibitor AOAA added in the above step is recorded as the experimental group AOAA, and the material without any treatment is the control group CK. During the composting period, hydrogen sulfide gas emissions were monitored and measured, and DNA from the compost samples was extracted using a soil DNA extraction kit (Omega Bio-Tek, Norcross, GA) before the decomposition step. Real-time quantitative fluorescence PCR was used to detect and compare the relative content of genes encoding key enzymes CSE and CBS and 16S rRNA. The detection reaction system is shown in Table 1, the detection primers are shown in Table 2, and the reaction procedure is shown in Table 3.

[0033] Table 1 Reaction system

[0034] Reactants Volume (μL) Upstream primer 0.3 Downstream primer 0.3 2×ChamQ Universal SYBR qPCR Master Mix 5 Template DNA 1 <![CDATA[ddH2O]]> 3.4 Total volume 10

[0035] Table 2 Primer sequences

[0036] Gene Primers Sequence (5'-3') 16S rRNA Upstream TGTGTAGCGGTGAAATGCG(SEQ ID NO:1) Downstream CATCGTTTACGGCGTGGAC(SEQ ID NO:2) CTH Upstream AATGGGGTTTTGGAATCTGGT(SEQ ID NO:3) Downstream GCACTGTTAACCAGGTATTGGA(SEQ ID NO:4) Cbs Upstream TTACGGCAGCTCCTTGAGAC(SEQ ID NO:5) Downstream TCAAGGGGTGTTTCCATCGT(SEQ ID NO:6)

[0037] Table 3 Reaction procedure

[0038]

[0039] Example 2

[0040] A method for reducing the emission of malodorous gases from composting

[0041] The livestock and poultry manure used for composting comes from fresh chicken manure produced by a farm in Xiangfang District, Heilongjiang Province. Before composting begins, the chicken manure is air-dried to remove large impurities, crushed evenly, and the particle size is controlled at 1 to 2 cm. Then, sawdust is used to adjust the carbon-nitrogen ratio to 28, and deionized water is used to adjust the moisture content of the material to 62%. The targeted enzyme inhibitor aminooxyacetic acid is added to the material, and the amount added is 0.6‰ of the dry weight of the composted material, and it is fully mixed. During the composting period, intermittent ventilation is carried out, once every 4 hours, 1 hour each time, and the ventilation volume is 0.4L / min. A composting test lasting 55 days was carried out. Among them, the composting system with the enzyme inhibitor AOAA added in the above step is recorded as the experimental group AOAA, and the material without any treatment is the control group CK. During the composting period, hydrogen sulfide gas emissions were monitored and measured, and DNA from the compost samples was extracted using a soil DNA extraction kit (Omega Bio-Tek, Norcross, GA) before the decomposition step. The relative abundance of genes encoding the key enzymes CSE and CBS was characterized using real-time quantitative fluorescent PCR according to the method of Example 1.

[0042] Example 3

[0043] A method for reducing the emission of malodorous gases from composting

[0044] The livestock and poultry manure used for composting comes from fresh chicken manure produced by a farm in Xiangfang District, Heilongjiang Province. Before composting, the chicken manure is air-dried to remove large impurities, crushed evenly, and the particle size is controlled at 1-2 cm. Then sawdust is used to adjust the carbon-nitrogen ratio to 30, deionized water is used to adjust the material moisture content to 65%, and the targeted enzyme inhibitor aminooxyacetic acid is added to the material, and the addition amount is 0.7‰ of the dry weight of the compost material to be composted, and it is fully mixed. Intermittent ventilation is carried out during composting, and ventilation is performed once every 3h, 1.5h each time, and the ventilation volume is 0.5L / min. A 58-day composting test is carried out. Among them, the composting system in which the enzyme inhibitor AOAA is added in the above steps is recorded as the experimental group AOAA, and the material without any treatment is the control group CK. During the composting period, hydrogen sulfide gas emissions are monitored and measured, and the DNA in the compost sample is extracted by the extraction method of the soil kit, and the relative abundance of the genes encoding the key enzymes CSE and CBS is characterized by real-time quantitative fluorescence PCR according to the method of Example 1.

[0045] The average value of the hydrogen sulfide gas emission data measured in Examples 1 to 3 was calculated. Figure 1 The dynamic changes of the inhibition efficiency of aminooxyacetic acid on hydrogen sulfide during the composting process are shown. The highest inhibition efficiency in a single day can reach 76.58%. Compared with the CK group, aminooxyacetic acid has a significant inhibitory effect on hydrogen sulfide from the third day of composting, and gradually increases with time. The inhibition rate reaches the highest on the 10th day, and the inhibition efficiency of hydrogen sulfide shows a decreasing trend on the 21st day of composting.

[0046] The relative contents of the genes encoding the key enzymes CSE and CBS detected in Examples 1 to 3 are compared and the results are shown in Figure 2 ,The results showed that the genes encoding the two enzymes, CSE and CBS, were at a lower expression level at the end of composting, and the activities of the two key enzymes were reduced and significantly inhibited.

[0047] It can be seen that the method of the present invention can use a low dose of the targeted enzyme inhibitor aminooxyacetic acid to inhibit the emission of hydrogen sulfide odor gas in the composting of agricultural waste such as livestock and poultry manure, and the method is simple and highly operable.

[0048] The barium sulfate turbidimetry was used to determine the effective sulfur and total sulfur contents in the compost samples prepared in Examples 1 to 3.

[0049] Figure 3 The results show the dynamic change of sulfur content during composting. Compared with CK, the effective sulfur and total sulfur content of the AOAA treatment group are increased, which has a certain effect on the sulfur sequestration of compost products. This shows that the method of the present invention has a certain effect on improving the sulfur content of compost on the basis of reducing the emission of hydrogen sulfide odor gas.

[0050] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Application of aminooxyacetic acid in reducing malodorous gas emissions from composting.

2. The use according to claim 1, characterized in that: The raw materials of the compost include agricultural wastes such as livestock excrement.

3. The application according to claim 1, characterized in that: The composting malodorous gas includes hydrogen sulfide.

4. A method for reducing the emission of malodorous gases from composting, characterized in that: The following steps are involved: Mix agricultural waste with aminooxyacetic acid and then perform aerobic composting.

5. The method according to claim 4, characterized in that: The added mass of the aminooxyacetic acid accounts for 0.5‰ to 0.7‰ of the dry weight of the agricultural waste.

6. The method according to claim 4, characterized in that: The carbon-nitrogen ratio of the agricultural waste is 25-30.

7. The method according to claim 4, characterized in that: The moisture content of the agricultural waste is 60% to 70%.

8. The method according to claim 4, characterized in that: The particle size of the agricultural waste is ≤2 cm.

9. The method according to claim 4, characterized in that: During the whole process of aerobic composting, intermittent ventilation is performed; the intermittent ventilation is performed once every 3 to 4 hours; each time lasts for 1 to 1.5 hours; The ventilation volume of the intermittent ventilation is 0.25 to 0.5 L / min.

10. The method according to any one of claims 4 to 9, characterized in that: The aerobic composting time is 50 to 60 days.

Images