Oriental small-bridge fungus and artificial cultivation method thereof

Abstract

The present application belongs to the technical field of edible fungi, and particularly relates to a Ponticulomyces orientalis and an artificial cultivation method thereof. A wild Ponticulomyces orientalis is obtained through wild fungus collection, separation, identification and pure culture, and is named as Kaiyao mushroom CS12, and is preserved in China Center for Type Culture Collection with a preservation number of CCTCC NO: M20242547. A domestication cultivation method of the Kaiyao mushroom CS12 is formed through strain propagation, bag material cultivation and control of light, temperature, water and gas conditions. The Kaiyao mushroom CS12 has a mycelium age of 40-85 days, and a biological conversion rate of 66.37%-120.23%. The Kaiyao mushroom CS12 is rich in polysaccharides, proteins, amino acids and other nutrients, has a delicious taste and rich nutrition, and has a crisp and tender stem and a smooth cap, and has a fresh taste and a strong and overflowing fragrance, and has a very good taste.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of edible fungi, and particularly relates to a Ponticulomyces orientalis and an artificial cultivation method thereof. BACKGROUND

[0002] Ponticulomyces is a new genus proposed in Oudemansiella / Xerula in recent years, which contains two species, Ponticulommyces kedrovayae from the Russian Far East and Ponticulumyces orientalis (Oudemansilla orientalis Zhu L. Yang) from China, according to morphological and molecular data. The main characteristics of the genus are that the pileus is sticky, the fruiting body grows on rotten wood, and there are two types of cysts. Ponticulomyces orientalis (Oudemansilla orientalis Zhu L. Yang) is one of 966 classification units of edible fungi in China, but there is no related report on artificial cultivation at home and abroad at present. SUMMARY

[0003] The present application research personnel collect wild fruiting bodies, then carry out strain isolation, identification, pure culture and preservation, obtain the CS12 strain of Kai Ao mushroom, and form the cultivation method of the CS12 strain of Kai Ao mushroom through solid and liquid propagation, bag material cultivation and control of light, temperature, water and gas conditions of fruiting, and the like. Specifically, the following technical scheme is implemented:

[0004] A Ponticulomyces orientalis is obtained through wild mushroom collection, identification, isolation and pure culture, and is named as the CS12 strain of Kai Ao mushroom, has been preserved in the China Center for Type Culture Collection, and the preservation number is CCTCC NO: M 20242547, and the preservation date is November 13, 2024.

[0005] The obtaining method of the above-mentioned Ponticulomyces orientalis comprises the following steps: a wild strain of mushroom is collected from a broad-leaved tree stump in Qiandongnan, Guizhou, after being disinfected by 1 ‰ HgCl2, 1-3 mm 3 tissue blocks are cultured on a PDA culture medium plate at 25 DEG C, when the mycelium grows to 2 / 3 of the area of the plate, the edge mycelium of the colony is picked and transferred for culture to obtain a pure culture and a strain, and the number is CS12. The PDA culture medium is composed of 200 g of potato, 20 g of glucose, 15 g of agar and 1000 ml of water.

[0006] Strain identification: The fruiting body of the strain is clustered or solitary, the cap is 20-70mm wide, hemispherical to conical convex, the color is "brown" to "dark brown" when the fruiting body is immature, and "smoky" to "mouse gray" when it is mature, the middle part is darker, the edge is lighter, the gills are radially arranged, short and soft (when young) to slightly hairy, and sticky when wet. The flesh is white. The gills are white, curved, sparse, and have no edges. The stem is 30-300x5-40mm, from top to bottom, grayish white to brown, with white small scales, no ring and false root. 18S rDNA-ITS sequence analysis and comparison in NCBI database (blast.ncbi.nlm.nih.gov) determine that the classification name is Ponticulomyces orientalis, named Kaeo mushroom CS12.

[0007] 18S rDNA-ITS sequence analysis is:

[0008] TTTGACGCTTGTGGCTTCACTTCTGTTGCTGACTTTCCTTAGGGGAAGTATGTGCACGTTGGGAAGTCGCTCGCCTCTTCTTTGTCCACCTGTGCACCTTTTGTAGATCTGGTTGGGAAGCTCACTTGAACGTTAACTCGTTCAAGTGGATTTTGAAGGGTTTGCTTCGGTGCTCCCTTTGTCCGCCAGGTCTATGCTTCATATCATCTCTTTGTATGTTTAGAATGTCTCGTTTATTGGACTTTGTCCATTAACAAACCTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGGCATGCCTGTTTGAGTGTCAGTAAATTTCTCAACCCTCCTTTACTTTGTTGTTAAAGGATTGGCGTTGGGATGGGTGGAGGCTTGCCGGACGTCAACGTTCGGCTCCTCTGAAATGCATTAGCAGTACAACCATTTACTTGGGCTTCGCTAAGCTGTGATAATATCTAAGCTAGCTTGGTTCAGAGTGTTGGCAGAGCTCGGGGTTTTTTGAAGGGTTTTTGCTTCGCGGCTCCCTTTGCGTTCTCTCTTCTCGAGAGATACCTATGCGACTCTGTGCACGGTTTTTGTTACCGCTTCGAACCGTCTTCTTCACTGAGACAACCTTAACTGACTA-TTGACCTCAAATCAGGTAGACTAC

[0009] The artificial cultivation method of the above-mentioned Microbacterium orientale, comprising the following steps:

[0010] 1. Preparation of mother culture:

[0011] Select the preserved strain, pick up a 5mm diameter mycelium block under sterile conditions, inoculate into a culture medium plate or test tube, and cultivate at 25°C until the mycelium covers the surface of the culture medium after inoculation. The culture medium is prepared from the following raw materials: potato 200g / L (boiled liquid), glucose 20g / L, agar 15g / L, peptone 2-15g / L, yeast powder 1-10g / L, pH natural.

[0012] 2. Preparation of original strain:

[0013] (1) Preparation of liquid original strain

[0014] Original liquid medium (g / L): soybean powder 10-100, corn powder 10-40, rapeseed cake powder 10-50, KH2PO4 1-5, MgSO4 1-5, peptone 5-20, yeast powder 1-10, pH 5.5-7.5. The above several or all materials are accurately weighed according to the formula to prepare the medium, sterilized at 121℃ for 30min; select the mycelium white, dense, robust and no contamination of the mother plate or test tube, under sterile conditions, pick 2-6 pieces of 5mm diameter mycelium, inoculate into 100-5000ml of triangular flask, the liquid volume is 35-1500ml, after inoculation, stand for 12-36h, then place in 25℃, 100-300r / min speed shaker for 5-12 days.

[0015] (2) Preparation of solid original strain

[0016] Original solid medium: sawdust 40-80%, corn powder 1-10%, chaff 10-30%, cottonseed hull 10-30%, wheat bran 10-35%, sucrose 1-5%, lime 1-2%, gypsum 1-2%, pH natural. The above several or all materials are accurately weighed according to the formula to prepare the medium, mix well, then add water to 55-65% moisture content, put into 8cm x 28cm x 0.005cm polypropylene plastic bag, seal with collar, the prepared original bag is sterilized in high pressure steam sterilization pot at 121℃ for 2-4h, when the temperature of the cultivation bag drops to 60-70℃, take out, cool to 28℃, select the mycelium white, dense, robust and no contamination of the plate. Under sterile conditions, pick 2-6 pieces of 1cm diameter mycelium which grows vigorously, inoculate into the bag, place in 25℃ incubator for dark culture until the bag is full.

[0017] 3. Preparation of cultivation strain:

[0018] (1) Preparation of liquid cultivation strain

[0019] Liquid culture medium (g / L): Wood flour (100 mesh) 20-200 g, wheat bran 50-200 g, soybean flour 10-100 g, glucose 5-100 g, corn flour 10-40 g, peptone 1-10 g, potassium dihydrogen phosphate 1-5 g, magnesium sulfate 0.2-2 g, foaming agent 0.1-2 g, vitamin B1 0.002-0.5 g, pH 5.5-7.5. Accurately weigh the above materials according to the formula to prepare the culture medium. Add the above culture medium to 1 / 2-2 / 3 of the fermenter's liquid volume. Sterilize at 121℃ for 30 min. After cooling to 25℃, inoculate the liquid culture at an inoculation rate of 5%-20% of the fermenter's culture medium volume. Incubate for 5-20 days. The incubation conditions are an aeration rate of 20-40 L / 1.0 m³. 3 / h, tank pressure is 0.03MPa, and culture temperature is 25℃.

[0020] (2) Preparation of solid culture media

[0021] Solid culture medium for cultivation: 40-80% sawdust, 1-10% corn flour, 10-30% rice hulls, 10-30% cottonseed hulls, 10-35% wheat bran, 1-5% sucrose, 1-2% lime, 1-2% gypsum, pH natural. Accurately weigh the above materials according to the formula to prepare the culture medium. Mix well and add water to a moisture content of 55-65%. Pack the medium into 8cm×28cm×0.005cm polypropylene plastic bags, seal with a ring, and sterilize the bags in a high-pressure steam sterilizer at 121℃ for 2-4 hours. When the temperature of the cultivation bags drops to 60-70℃, remove them and cool to 28℃. Inoculate with 15-20ml of liquid culture medium or 1-10g of solid culture medium, and incubate at 25℃ in the dark until the bag is full.

[0022] 4. Preparation of inoculum bags:

[0023] Culture medium: 20-80% sawdust, 10-40% camellia hulls (powder), 20-90% cottonseed hulls, 1-20% wheat bran, 1-5% sucrose, 1-3% lime, 1-3% gypsum, natural pH.

[0024] Accurately weigh the above-mentioned materials according to the formula ratio, mix them well, add water to a moisture content of 55-65%, pack them into 8cm×28cm×0.005cm polypropylene plastic bags, seal them with a ring, and sterilize the packed cultivation bags in a high-pressure steam sterilizer at 121℃ for 2-4 hours. When the temperature of the cultivation bags drops to 60-70℃, take them out, cool them to 28℃, inoculate them with 20-35ml of liquid inoculum or 5-10g of solid inoculum, and place them at 25℃ in the dark to incubate until the bags are full.

[0025] 4. Mushroom Management:

[0026] (1) No soil covering cultivation

[0027] The physiological mature bag is moved to the mushroom house, and is placed on the bed frame after opening the bag mouth, the relative humidity of the room air is kept above 90%, the illumination is 100-500lx, the temperature is controlled at 15-25℃, the ventilation is paid attention to, and the primordium appears in 10-20 days.

[0028] (2) Over-land cultivation

[0029] The physiological mature bag is moved to the mushroom house, and is placed on the bed frame after opening the bag mouth, the relative humidity of the room air is kept above 90%, the illumination is 100-500lx, the temperature is controlled at 15-25℃, the ventilation is paid attention to, and the primordium appears in 10-20 days.

[0030] The present application has the beneficial effects that:

[0031] The present application obtains a wild east small long bridge fungus strain named Kai Ao mushroom CS12 through wild fungus collection, separation, identification and pure culture. The artificial cultivation method of the Kai Ao mushroom CS12 strain is formed through strain solid and liquid propagation, bag material cultivation and light, temperature, water and gas condition control. The commercial cultivation of the Kai Ao mushroom CS12 can be realized through the present application, a new kind of edible fungus is added to the edible fungus market, and the artificial cultivation method of the wild edible fungus strain is provided. The age of the Kai Ao mushroom CS12 is 40-85 days, and the biological conversion rate is 66.37%-120.23%. The fruiting body of the Kai Ao mushroom CS12 is rich in polysaccharides, proteins, amino acids and other nutrients, tastes delicious and nutritious, the stem is crisp and tender, the cap is smooth, the taste is fresh, the aroma is rich, and the taste is excellent. BRIEF DESCRIPTION OF DRAWINGS

[0032] Figure 1 It is an artificial cultivation flow chart of the east small long bridge fungus;

[0033] Figure 2 It is a photo of the east small long bridge fungus harvested in Example 1;

[0034] Figure 3 It is a phylogenetic tree diagram. DETAILED DESCRIPTION

[0035] The technical solutions of the present application are further limited in combination with specific implementation manners, but the scope of protection is not limited to the description.

[0036] Example 1

[0037] 1. Mother strain preparation

[0038] Medium (g / L): Potato 200 (cooked liquid), glucose 20, peptone 2, yeast powder 2, agar 15, pH natural. Select the preservation of the mother species in sterile conditions to pick up 5 mm diameter mycelium block inoculated into the above medium plate, inoculation 25℃ after culture, 7d after the mycelium full of medium surface.

[0039] 2. Preparation of original species

[0040] Solid medium: sawdust 40%, corn meal 2%, cotton seed hull 30%, chaff 10%, wheat bran 15%, sucrose 1%, lime 1%, gypsum 1%, pH natural.

[0041] According to the proportion of the formula, the materials are accurately weighed, mixed and then water is added to 65% moisture content, and then put into 8cm x 28cm x 0.005cm polypropylene plastic bags, sealed with a collar, and the prepared cultivation bags are sterilized in a high-pressure steam sterilization pot at 121℃ for 2h, and then taken out when the temperature of the cultivation bags drops to 60-70℃, and then cooled to 28℃, and then 5g of solid original species is inoculated and placed in a 25℃ dark culture box until the bag is full.

[0042] 3. Preparation of cultivation species

[0043] Solid medium: sawdust 40%, corn meal 2%, cotton seed hull 30%, chaff 10%, wheat bran 15%, sucrose 1%, lime 1%, gypsum 1%, pH natural.

[0044] According to the proportion of the formula, the materials are accurately weighed, mixed and then water is added to 65% moisture content, and then put into 8cm x 28cm x 0.005cm polypropylene plastic bags, sealed with a collar, and the prepared cultivation bags are sterilized in a high-pressure steam sterilization pot at 121℃ for 2h, and then taken out when the temperature of the cultivation bags drops to 60-70℃, and then cooled to 28℃, and then 5g of solid original species is inoculated and placed in a 25℃ dark culture box until the bag is full.

[0045] 4. Preparation of cultivation bag

[0046] Culture medium: sawdust 33%, cotton seed hull 50%, bran 15%, lime 1%, gypsum 1%, pH natural.

[0047] According to the proportion of the formula, the materials are accurately weighed, mixed and then water is added to 65% moisture content, and then put into 8cm x 28cm x 0.005cm polypropylene plastic bags, sealed with a collar, and the prepared cultivation bags are sterilized in a high-pressure steam sterilization pot at 121℃ for 2h, and then taken out when the temperature of the cultivation bags drops to 60-70℃, and then cooled to 28℃, and then 5g of solid original species is inoculated and placed in a 25℃ dark culture box until the bag is full.

[0048] 5. Mushroom management

[0049] The bags reaching physiological maturity are moved to the mushroom house, and after opening the bag mouth, they are placed neatly on the bed frame. The relative humidity of the room air is kept above 90%, the illumination is 200-300 lx, the temperature is controlled at 18°C, ventilation is controlled, and primordia appear after 16 days. The fruiting bodies are harvested when the cap is opened by 40-60%. The bioconversion rate is 103.25%.

[0050] Example 2

[0051] 1. Mother culture preparation

[0052] Culture medium (g / L): potato 200 (boiled liquid), glucose 20, agar 15, pH natural. The preserved mother culture is inoculated under sterile conditions with 5 mm diameter mycelial blocks onto the above-mentioned culture medium plate, and after inoculation at 25°C, the culture is incubated, and after 7 days, the mycelium covers the surface of the culture medium.

[0053] 2. Original culture preparation

[0054] Liquid culture medium (g / L): soybean powder 10, corn powder 20, KH2PO4 1, MgSO4 1, peptone 5, pH 6.5. After adding according to the proportion, sterilize at 121°C for 30 min.

[0055] Prepare the culture medium according to the proportion of the above-mentioned several or all materials, sterilize at 121°C for 30 min; under sterile conditions, take 5 blocks of mycelial white, dense, healthy and uncontaminated mother culture plate mycelial blocks with a puncher with a diameter of 5 mm, inoculate into 250 ml of a triangular flask, and the liquid volume is 90 ml. After inoculation, stand for 12 h, and then place in a 25°C, 180 r / min speed shaker for 7 days.

[0056] 3. Cultivation of seed preparation

[0057] Liquid culture medium (g / L): wood powder (100 mesh) 20, corn powder 10, KH2PO4 1, MgSO4 1, peptone 3, bubble enemy 0.5, pH 6.5.

[0058] Add 30 L of the above-mentioned culture medium to a 50 L fermenter, sterilize at 121°C for 30 min. Inoculate the liquid original culture according to the inoculation amount of 10% of the culture medium volume, and culture for 10 d. The culture conditions are as follows: air volume is 1.0 m 3 / h, tank pressure is 0.03 MPa, and culture temperature is 25°C.

[0059] 4. Cultivation of seed preparation

[0060] Culture material: sawdust 33%, cottonseed hull 50%, bran 15%, lime 1%, gypsum 1%, pH natural.

[0061] The materials are weighed according to the formula, mixed, and then water is added to a moisture content of 65%. The mixture is put into a 8cm x 28cm x 0.005cm polypropylene plastic bag, sealed with a collar, and the prepared bag is sterilized in a high-pressure steam sterilization pot at 121°C for 4h. When the temperature of the bag drops to 60-70°C, it is taken out and cooled to 28°C. 15ml of liquid strain is inoculated into each bag. The bag is cultured at 25°C in the dark, and the bag is full after 51d.

[0062] 5. Mushroom management

[0063] The bags that reach physiological maturity are moved to the mushroom house, the bag opening is opened, and the bags are placed neatly on the bed frame. The relative humidity of the room air is kept above 90%, the light is 200-300lx, the temperature is controlled at 20°C, the ventilation is controlled, and the primordia appear after 16d. The fruiting bodies are harvested when the cap is opened 40-60%. The biological conversion rate is 66.37%.

[0064] Morphology of fruiting body after domestication

[0065] The cap of Kaiao mushroom CS12 is 20-60mm wide, hemispherical to conical, and the color is "brown" to "dark brown" when the fruiting body is immature, and "smoke gray" to "mouse gray" when it is mature. The middle part is darker, the edge is lighter, the gills are radial, short and soft (when young) to slightly hairy, and sticky when wet. The flesh is white. The gills are white, curved, sparse, and have no edges. The stipe is 30-300 x 5-40mm, from grayish white to brown, with white scales, no annulus and rhizomorphs. The biological conversion rate is 66.37%-120.23%.

[0066] The relevant nutritional components of the cultivated Dongfangxiaochangqiaomushroom according to the method of Example 1 are determined, and the results are shown in Table 1.

[0067] Table 1 Determination of the content of relevant nutritional components of fresh fruiting bodies of Example 1

[0068]

[0069] It is necessary to point out that the above examples and comparative examples are only limited to further explanation and understanding of the technical solutions of the present application, and cannot be understood as further limiting the technical solutions of the present application. The inventions and creations of non-outstanding essential features and significant progress made by those skilled in the art still belong to the protection scope of the present application.

Claims

1. A method for artificial cultivation of Leptolegnia orientalis, characterized by, Comprising the following steps: (1) Mother preparation: Select the preserved strain under sterile conditions to pick up 5mm diameter mycelium block to inoculate into culture medium plate or test tube, inoculate 25℃ to mycelium to grow full of culture medium surface; The culture medium is made of the following raw materials: potato broth 200g / L, glucose 20g / L, agar 15g / L, peptone 2-15g / L, yeast powder 1-10g / L, pH natural; (2) Original preparation: (a) Liquid original preparation Original liquid medium (g / L): soybean powder 10-100, corn powder 10-40, rapeseed cake powder 10-50, KH2PO4 1-5, MgSO4 1-5, peptone 5-20, yeast powder 1-10, pH 5.5-7.5; The above several or all materials are accurately weighed according to the formula to prepare the medium, 121℃ sterilization for 30min; Select the white, dense, healthy and non-polluted mother plate or test tube, pick up 2-6 pieces of 5mm diameter mycelium block under sterile conditions, inoculate into 100-5000ml of triangular flask, the liquid volume is 35-1500ml, inoculate and stand for 12-36h, then place in 25℃, 100-300r / min speed shaker for 5-12 days; (b) Solid original preparation Original solid medium: sawdust 40-80%, corn powder 1-10%, bran 10-30%, cotton seed hull 10-30%, wheat bran 10-35%, sucrose 1-5%, lime 1-2%, gypsum 1-2%, pH natural; The above several or all materials are accurately weighed according to the formula to prepare the medium, mix well, then add water to 55-65% moisture content, put into 8 cm×28 cm×0.005 cm polypropylene plastic bag, seal with sleeve ring, the prepared original bag is sterilized in high pressure steam sterilization pot for 2h-4h, when the temperature of the cultivation bag drops to 60-70℃, take out, cool to 28℃, select the white, dense, healthy and non-polluted plate, pick up 2-6 pieces of 1cm diameter mycelium block under sterile conditions, inoculate into the bag, place in 25℃ incubator for dark culture until the bag is full. (3) Cultivation preparation: (a) Liquid cultivation preparation Liquid medium (g / L) for cultivated species: wood powder 100 mesh 20-200, bran 50-200, soybean meal 10-100, glucose 5-100, corn meal 10-40, peptone 1-10, potassium dihydrogen phosphate 1-5, magnesium sulfate 0.2-2, bubble enemy 0.1-2, VB1 0.002-0.5, pH 5.5-7.5; accurately weigh the above several or all materials according to the formula to prepare the medium, add the above medium according to 1 / 2-2 / 3 liquid volume of the fermenter, sterilize at 121℃ for 30 min, cool to 25℃, then inoculate liquid stock culture at 5%-20% of the volume of the medium in the fermenter, and cultivate for 5-20 d; the cultivation conditions are as follows: aeration volume is 20-40 L / 1.0 m 3 / h, tank pressure is 0.03 MPa, and cultivation temperature is 25℃. (b) Solid cultivation preparation Cultivation solid medium: sawdust 40-80%, corn powder 1-10%, bran 10-30%, cotton seed hull 10-30%, wheat bran 10-35%, sucrose 1-5%, lime 1-2%, gypsum 1-2%, pH natural; The above several or all materials are accurately weighed according to the formula to prepare the medium, mix well, then add water to 55-65% moisture content, put into 8 cm×28 cm×0.005 cm polypropylene plastic bag, seal with sleeve ring, the prepared original bag is sterilized in high pressure steam sterilization pot for 2h-4h, when the temperature of the cultivation bag drops to 60-70℃, take out, cool to 28℃, inoculate 15-20ml liquid original or 1-10g solid original, place in 25℃ dark culture until the bag is full; (4) Cultivation bag preparation: Culture material: sawdust 20-80%, camellia shell powder 10-40%, cotton seed hull 20-90%, bran 1-20%, sucrose 1-5%, lime 1-3%, gypsum 1-3%, pH natural; Accurately weigh the above several or all materials according to the formula proportion, mix well, then add water to 55-65% moisture content, put into 8 cm x 28 cm x 0.005 cm polypropylene plastic bags, seal with a collar, sterilize the prepared cultivation bags in a high-pressure steam sterilization pot at 121 ℃ for 2-4 h, take out when the temperature of the cultivation bags drops to 60-70 ℃, cool to 28 ℃, inoculate 20-35 ml of liquid strain or 5-10 g of solid strain, and cultivate at 25 ℃ in the dark until the bag is full; (5) Mushroom management: (a) Non-covering soil cultivation The bags are moved to the mushroom house when they reach physiological maturity. After opening the bag, they are placed neatly on the bed frame, keeping the relative humidity of the room above 90%, the light intensity at 100-500 lx, and the temperature at 15-25 o C. Pay attention to ventilation. The primordium appears in 10-20 days, and the fruiting body is harvested when the cap is 40-60% open. (b) Covering soil cultivation Move the physiologically mature mushroom bags to the layer frame frame of the mushroom house, cut off the upper plastic bag membrane along the upper edge of the bag material, open 2-3 small openings on both sides of the bag to prevent water accumulation, cover soil between the bags and on the material to 2-4 cm above the material surface, and pour water thoroughly after covering the soil. The primordium appears in 10-25 days, and the fruiting body is harvested when the cap is opened 40-60%. The oriental small long bridge fungus is obtained by wild mushroom collection, isolation, identification and pure culture, named as Kaiomushroom CS12, has been preserved in China Typical Culture Collection Center, the preservation number is CCTCC NO: M 20242547, and the preservation date is November 13, 2024.

Images