Use of PagGRF3a gene in promoting the development of secondary xylem of trees and / or dwarfing of trees

By overexpressing the PagGRF3a gene in poplars, and using recombinant vectors and Agrobacterium transformation method, the technical problems of secondary xylem development and dwarfing in poplars were solved, and wood yield and quality improvement was achieved.

CN120005940BActive Publication Date: 2025-07-22BEIJING FORESTRY UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510497025.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-04-21
Publication Date
2025-07-22
Estimated Expiration
2045-04-21

AI Technical Summary

Technical Problem

There is a lack of genetic function research in the prior art that can simultaneously promote the development and dwarf of the secondary xylem of poplar trees, affecting wood yield and quality.

Method used

By overexpressing the PagGRF3a gene, the recombinant vector pCAMBIA2300-35S-OCS was transformed. The Agrobacterium transformation method was used to achieve overexpression of the PagGRF3a gene in poplar trees, promoting the development and dwarf of the secondary xylem in the tree.

Benefits of technology

Overexpression of PagGRF3a gene slows down the growth of trees, advances the growth of secondary xylem, increases the width of xylem in the stem, and increases the proportion of xylem area in the stem, promoting the development of secondary xylem and tree dwarf.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120005940B_ABST
    Figure CN120005940B_ABST
Patent Text Reader

Abstract

The present invention provides the application of the PagGRF3a gene in promoting the secondary xylem development of trees and / or dwarfing of trees, belonging to the technical field of genetic engineering. The present invention firstly proposes that the PagGRF3a gene has the function of promoting the secondary xylem development of trees and / or dwarfing of trees. Overexpression of the PagGRF3a gene can cause the growth of trees to be retarded, the growth of secondary xylem to be advanced, the width of xylem in the stem to increase, and the ratio of the xylem area in the stem to the stem area to increase, indicating that overexpression of the PagGRF3a gene promotes the secondary xylem development and participates in the secondary growth of trees.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and specifically relates to the application of the PagGRF3a gene in promoting the development of tree secondary xylem and / or dwarfing trees. Background Art

[0002] Populus alba×Populus glandulosa‘84K’ Populus alba × Populus glandulosa is a fast-growing poplar variety with characteristics such as strong adaptability, fast growth rate, and high wood yield. 84K poplar can provide relatively abundant wood yield in a short time, and is especially suitable for industries such as pulp and wood processing, with broad application prospects.

[0003] Wood has extensive functions and important significance in real life. As a natural renewable resource, wood is not only an important raw material for construction, furniture, paper, and packaging materials, but also can be applied in fields such as energy, handicrafts, and artworks. The formation of wood is closely related to the development of tree secondary xylem. The cell division and differentiation of secondary xylem into structural cells such as wood fibers and vessels determine the properties of wood. The structure, density, and strength of wood are all affected by the development of secondary xylem during the growth of trees. After poplar trees are dwarfed, it is convenient for management and harvesting, and dwarfing can improve the stress resistance of poplar trees, promote branching and reproduction, and optimize the wood quality.

[0004] Currently, there is a lack of research on the gene functions in poplar trees that can both promote the development of tree secondary xylem and be beneficial to tree dwarfing. Summary of the Invention

[0005] In view of this, one of the purposes of the present invention is to provide the application of the PagGRF3a gene in promoting the development of tree secondary xylem or in dwarfing trees.

[0006] Another purpose of the present invention is to provide a method for promoting the development of tree secondary xylem and / or dwarfing trees.

[0007] In order to achieve the above invention purposes, the present invention provides the following technical solutions:

[0008] The present invention provides the application of the PagGRF3a gene in promoting the development of tree secondary xylem, and the nucleotide sequence of the PagGRF3a gene is as shown in SEQ ID No.1.

[0009] The present invention also provides the application of the PagGRF3a gene in dwarfing trees, and the nucleotide sequence of the PagGRF3a gene is as shown in SEQ ID No.1.

[0010] Preferably, it exerts its function through the overexpression of the PagGRF3a gene.

[0011] The present invention also provides the use of a biological material containing the PagGRF3a gene in promoting the development of secondary xylem in trees or in dwarfing trees, and the nucleotide sequence of the PagGRF3a gene is as shown in SEQ ID No. 1.

[0012] Preferably, the biological material includes a recombinant vector; the backbone vector of the recombinant vector includes pCAMBIA2300-35S-OCS .

[0013] Preferably, the tree includes poplar.

[0014] The present invention also provides a method for promoting the development of secondary xylem in trees and / or dwarfing trees, including the following steps: transforming a recombinant vector containing the PagGRF3a gene into a tree; the nucleotide sequence of the PagGRF3a gene is as shown in SEQ ID No. 1.

[0015] Preferably, the backbone vector of the recombinant vector includes pCAMBIA2300-35S-OCS ; the transformation method includes the Agrobacterium transformation method.

[0016] Preferably, the construction method of the recombinant vector includes the following steps: cloning the PagGRF3a gene from Populus alba × Populus glandulosa, and pCAMBIA2300-35S-OCS after digestion with XbaI and KpnI restriction endonucleases, ligating with the PagGRF3a gene.

[0017] Preferably, the nucleotide sequences of the primers for cloning are as shown in SEQ ID No. 3 and SEQ ID No. 4.

[0018] Beneficial effects of the present invention:

[0019] The present invention first proposes that the PagGRF3a gene has the function of promoting the development of secondary xylem in trees and / or dwarfing trees. Overexpression of the PagGRF3a gene can cause the growth of trees to be retarded, the growth of secondary xylem to be advanced, the width of xylem in the stem to increase, and the ratio of the xylem area in the stem to the stem area to increase, indicating that overexpression of the PagGRF3a gene promotes the development of secondary xylem and participates in the secondary growth of trees. Description of the drawings

[0020] Figure 1 It is a comparison diagram of the target gene sequence of the present invention and the sequencing result of Escherichia coli bacterial liquid;

[0021] Figure 2 It is the relative expression level in the comparison of wild-type Populus alba × Populus glandulosa (WT) and PagGRF3a overexpression lines ( PagGRF3a ) in the present invention; PagGRF3a of

[0022] Figure 3 Growth status diagram of wild-type 84K poplar (WT) and PagGRF3a overexpression lines (OE- PagGRF3a ) of the present invention after growing in the greenhouse for 2 months;

[0023] Figure 4 Growth status diagram of wild-type 84K poplar (WT) and PagGRF3a overexpression lines (OE- PagGRF3a ) of the present invention after growing in soil culture for two months, including transverse section diagrams of the 10th stem segment and related data analysis. In Figure A, it is a transverse section diagram stained with toluidine blue, scale bar = 200 μm; Figure B is the statistical result of the xylem width; Figure C is the statistical result of the proportion of secondary xylem in the stem; the error bars in Figures B and C represent the standard error calculated from three biological replicates, * represents the t-test result, ***P < 0.001. Detailed implementation manners

[0024] The present invention provides the application of the PagGRF3a gene in promoting the secondary xylem development of trees or in dwarfing trees. The nucleotide sequence of the PagGRF3a gene is ATGTCTCCAACTGAATCATCACGTGAAGAGAATGTTTACATGGCCAAGTTGGCTGAACAGGCAGAACGTTATGAAGAAATGGTGGAGTTTATGGAGAAAGTTGCGAAGACAGTCGATAATGAGGAGCTAACCATGGAGGAAAGGAACTTGCTCTCCGTGGCCTACAAAAATGTGATTGGAGCTAGGAGGGCTTCATGGAGGATCATCTCTTCCATTGAGCAGAAGGAAGAGAGTAGGGGAAATGAAGATCATGTCACAATCATCAAGGAGTATAGGGGAAAGATCGAAGCTGAGCTCTGCAAGATCTGTGACGGAATCTTGAGCCTCCTTGAGACACATCTTGTTCCCTCTGCCTCAGCTGCTGAGTCCAAGGTATTTTACCTCAAGATGAAGGGTGATTATCACAGGTATCTTGCCGAGTTTAAGACCGGGGCTGAGAGGAAGGAAGCTGCTGAGAGCACTTTGTTGTCTTACAAGTCTGCTCAGGATATTGCTCTTTCTGAACTGGCTCCTACCCACCCAATAAGGCTGGGGCTTGCACTTAACTTCTCTGTCTTCTACTATGAGATCCTTAACTCTCCTGATCGTGCTTGCAGTCTTGCTAAGCAGGCTTTTGATGAGGCTATTTCCGAGCTGGATACTTTGGGCGAGGAGTCTTACAAGGACAGCACATTGATCATGCAACTTCTCCGTGACAATCTGACACTCTGGACTTCTGATATCACGGATGATGCTGGGGATGAGATCAAGGAAGCATCAAAACGTGAATCAGGCGATGGGCCGCAGTGA (SEQ ID No.1).

[0025] In the present invention, the PagGRF3a gene is cloned from Populus alba × Populus glandulosa '84K' ( Populus alba × Populus glandulosa) The amino acid sequence of the protein encoded by the PagGRF3a gene of Populus alba×Populus glandulosa '84K' is MSPTESSREENVYMAKLAEQAERYEEMVEFMEKVAKTVDNEELTMEERNLLSVAYKNVIGARRASWRIISSIEQKEESRGNEDHVTIIKEYRGKIEAELCKICDGILSLLETHLVPSASAAESKVFYLKMKGDYHRYLAEFKTGAERKEAAESTLLSYKSAQDIALSELAPTHPIRLGLALNFSVFYYEILNSPDRACSLAKQAFDEAISELDTLGEESYKDSTLIMQLLRDNLTLWTSDITDDAGDEIKEASKRESGDGPQ (SEQ ID No.2). In the application described in the present invention, it preferably exerts its function through overexpression of the PagGRF3a gene. In the present invention, the promotion of secondary xylem development in trees preferably includes advancing the secondary growth of trees, increasing the width of xylem in the stem, and increasing the ratio of the xylem area in the stem to the stem area; the dwarfing of trees preferably includes retarding the growth of trees. In the present invention, the trees preferably include Populus, and the Populus preferably includes Populus alba×Populus glandulosa '84K'.

[0026] The present invention also provides the application of a biological material containing the PagGRF3a gene in promoting the secondary xylem development of trees or in dwarfing trees, and the nucleotide sequence of the PagGRF3a gene is as shown in SEQ ID No.1. In the present invention, the biological material preferably includes a recombinant vector; the backbone vector of the recombinant vector preferably includes pCAMBIA2300-35S- OCS . In the present invention, the trees preferably include Populus, and the Populus preferably includes Populus alba×Populus glandulosa '84K'.

[0027] The present invention also provides a method for promoting the secondary xylem development of trees and / or dwarfing trees, comprising the following steps: transforming a recombinant vector containing the PagGRF3a gene into a tree; the nucleotide sequence of the PagGRF3a gene is as shown in SEQ ID No.1.

[0028] In the present invention, the backbone vector of the recombinant vector preferably includes pCAMBIA2300-35S-OCS. The present invention has no special limitation on the specific source of the backbone vector. The construction method of the recombinant vector preferably includes the following steps: cloning the PagGRF3a gene from Populus alba×Populus glandulosa '84K', and then pCAMBIA2300-35S-OCSAfter digestion with XbaI and KpnI restriction endonucleases, it is connected to the PagGRF3a gene; the nucleotide sequence of the primers used for cloning is preferably as shown in SEQ ID No.3 and SEQID No.4; the connection method is preferably connected by homologous recombination. In the present invention, the transformation method preferably includes Agrobacterium transformation. After the transformation is completed, it is preferably further included to screen and identify resistance and obtain transgenic positive plants. In the present invention, the method for identifying transgenic positive plants is preferably a real-time fluorescence quantitative PCR (qRT-PCR) method, and the nucleotide sequences of the upstream primer and the downstream primer used for identification are shown in SEQ ID No.5 and SEQID No.6, respectively.

[0029] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0030] In the following embodiments, unless otherwise specified, all of them are conventional methods.

[0031] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0032] Example 1

[0033] Cloning of 84K Poplar PagGRF3a gene sequence:

[0034] Total RNA of wild-type 84K poplar plants (WT) was extracted using a plant RNA extraction kit (Adlai), and reverse transcription was performed using an RNA reverse transcription kit (Quanshijin) to prepare a 20 µL reaction system, see Table 1. After the reaction system was configured, it was mixed by pipetting, the reaction solution was centrifuged to the bottom of the centrifuge tube, placed in a PCR instrument, 42°C for 30 min, 85°C for 5 s, to obtain a cDNA solution, which was frozen in a -20°C refrigerator.

[0035] Table 1 cDNA reverse transcription system

[0036]

[0037] Referring to the 84K poplar genome sequence information provided by the 84K poplar genome database (https: / / db.cngb.org / search / ?q=CNP0000339), gene-specific primers were designed at both ends of the target gene sequence shown in the nucleotide sequence of SEQ ID No. 1, and XbaI and KpnI restriction sites and the recombinant homologous fragments on the vector were added to the primer sequence. The upstream and downstream primer sequences for PagGRF3a gene cloning were as shown in SEQ ID No. 3 (TTTGGAGAGGACAGGGTACCATGTCTCCAACTGAATCATCACGT ( PagGRF3a -F)) and SEQ ID No.4 (CACTGACAGAAAATTTCTAGACTGCGGCCCATCGCCTGATTCAC ( PagGRF3a -R)). The cDNA obtained above was used as a template, and a high-fidelity enzyme (Takara) and primers at both ends were used for PCR amplification to prepare a 20 µL reaction system, as shown in Table 2. After the reaction system was configured, it was mixed by pipetting, and the reaction solution was centrifuged to the bottom of the centrifuge tube, placed in a PCR instrument, and reacted at 98°C for 2 min in the PCR instrument; then (98°C, 10 s; 58°C, 15 s; 72°C, 50 s) for 35 cycles; and finally reacted at 72°C for 3 min.

[0038] Table 2 cDNA PCR reaction system

[0039]

[0040] After the reaction was completed, electrophoresis was performed and the target fragment was recovered using an agarose gel recovery kit (Adler), and the PCR recovery product was frozen in a -20°C refrigerator.

[0041] Example 2

[0042] Construction of plant expression vector:

[0043] use pCAMBIA2300-35S-OCS The vector was digested with XbaI and KpnI restriction endonucleases, and the target vector fragment was recovered using an agarose gel recovery kit (Adlai). The recovered linear expression vector was cloned using ClonExpress®ⅡOne Step CloningKit (Novozyme). pCAMBIA2300-35S-OCS The target gene PCR amplification product obtained in Example 1 was connected by homologous recombination. The reaction system is shown in Table 3. The reaction procedure is 37°C for 30 min. After the reaction, it was immediately placed on ice for transformation of competent E. coli.

[0044] Table 3 Homologous recombination reaction system

[0045]

[0046] The recombinant plasmid pCAMBIA2300-35S::PagGRF3a-OCS was transformed into Trans1-T1 (TransGen Biotech) competent Escherichia coli and screened on LB solid resistant medium (containing 50 mg / L kanamycin). The monoclonal colonies obtained were identified by colony PCR using the primers shown in SEQ ID No.3 and SEQ ID No.4. The PCR products were analyzed by electrophoresis to determine the positive clones. The positive clone bacterial liquid was sent to the company for sequencing verification. After confirming the successful construction of the expression vector, the sequencing alignment results are shown in Figure 1 .

[0047] Example 3

[0048] Obtaining of Populus alba×Populus glandulosa 84K plants overexpressing PagGRF3a:

[0049] 1. Transformation of Agrobacterium tumefaciens GV3101 and infection of leaves

[0050] The recombinant plasmid obtained in Example 2 was transformed into Agrobacterium tumefaciens GV3101 and screened on a resistant LB solid medium plate (containing 50 mg / L kanamycin and 50 mg / L rifampicin). Positive strains were picked for enlarged culture, and Populus alba×Populus glandulosa 84K was transformed by the Agrobacterium-mediated leaf disc method to obtain overexpression lines. The specific steps are as follows:

[0051] Preparation of Agrobacterium infection solution: Take 2 small conical flasks and add 20 mL of LB liquid medium, 500 μL of Agrobacterium bacterial liquid containing pCAMBIA2300-35S::PagGRF3a-OCS the expression vector, 20 μL of Kana and 20 μL of Rif, and culture on a shaker (28 °C, 200 rpm) for 16 h.

[0052] Pretreatment: In a laminar flow hood, select the young leaves of sterile seedlings that have grown in the rooting medium for one month. Use a sterile surgical blade to make horizontal incisions on the main veins of the leaves, and place them on the differentiation medium without adding antibiotics for 1 day (the culture conditions are 16 h light / 8 h dark, 25 °C).

[0053] Infection and co-culture: Perform the infection in a laminar flow hood. Immerse the pretreated leaves in the Agrobacterium bacterial liquid for 15 min, gently shake 2 - 3 times in the middle to ensure that the wounded parts of the leaves are fully in contact with the bacterial liquid. Then use sterile forceps to take out the leaves and place them on pre-sterilized filter paper to absorb the excess bacterial liquid. Finally, inoculate the infected leaves on the differentiation medium without adding antibiotics (the leaves are placed with the abaxial side up) and incubate them in the dark at 25 °C for 3 days.

[0054] Resistance culture: On a clean bench, place leaves that have been dark-treated for 3 days on pre-sterilized filter paper to absorb excess bacteria, and then transfer them to resistance differentiation medium for selective culture (16 h light / 8 h dark, temperature 25°C).

[0055] Subculture and selection culture: Replace the differentiated cultured leaves on a new resistance differentiation medium every week. After one month of selection culture, adventitious buds will grow from the wound parts of the leaves. In the clean bench, use sterile tweezers and a scalpel to cut out the leaf discs with adventitious buds, and continue to place them on a new resistance differentiation medium for growth.

[0056] Rooting culture: When the adventitious buds grow to 2 cm, use sterile tweezers and scalpels to cut off the adventitious buds individually on the clean bench and place them on the resistance rooting medium for rooting culture. After rooting, subculture and propagation are carried out. The medium for the first subculture and propagation is the resistance rooting medium. For subsequent subcultures, only timementin (final concentration is 200 mg / L) is added to the rooting medium.

[0057] The culture medium used in the above process is shown in Table 4. The following culture medium is diluted to 1L with distilled water and adjusted to pH=5.9 with NaOH and HCl. After preparation, it is placed in a sterilizer and sterilized at 121℃ for 20 min. The culture medium that needs to be added with antibiotics is added in the clean bench after the culture medium is sterilized.

[0058] Table 4 Culture medium preparation (1L)

[0059]

[0060] PagGRF3a overexpressing plants were screened by real-time fluorescence quantitative PCR (qRT-PCR). Specifically, total RNA of transgenic plants and wild-type plants was extracted using a plant RNA extraction kit (Adlai), reverse transcription was performed using an RNA reverse transcription kit (Quanshijin) (the specific method of reverse transcription was the same as in Example 1) to obtain cDNA, and qRT-PCR experiments were performed using Taq Pro UniversalSYBR qPCR Master Mix (Novozyme). The nucleotide sequences of the upstream primer and downstream primer used in the experiment were shown in SEQ ID No. 5 (GTTGCGAAGACAGTCGATAATG (qF)) and SEQ ID No. 6 (CTTCGATCTTTCCCCTATACTC (qR)), respectively, and the internal reference gene was 18SrRNA. The reaction system of qRT-PCR experiment is shown in Table 5. The qRT-PCR reaction program is 95℃ for 2 min; (95℃ for 5 s, 60℃ for 30 s) for 39 cycles; finally 95℃ for 5 s; 65℃ for 5 s; 95℃ for 15 s. Each sample was repeated three times. 18SrRNA was used as the internal reference gene for each plate of samples. Calculate the gene expression levels of each sample.

[0061] Table 5 qRT-PCR reaction system

[0062]

[0063] Compare the expression levels of the PagGRF3a gene in wild-type 84K poplar (labeled as WT) and PagGRF3a-overexpressing 84K poplar (labeled as PagGRF3a ). After qRT-PCR identification, compared with wild-type 84K poplar plants, the expression levels of the PagGRF3a gene in overexpressing plants were significantly increased, indicating that PagGRF3a gene-overexpressing transgenic 84K poplar plants were successfully obtained. Specifically, as shown in Figure 2 .

[0064] Example 4

[0065] Application of the PagGRF3a gene of Populus alba × Populus glandulosa in regulating the development of secondary xylem and dwarfing of Populus alba × Populus glandulosa:

[0066] Cultivate the PagGRF3a gene-overexpressing transgenic 84K poplar plants (labeled as OE- PagGRF3a or PagGRF3a ) obtained in Example 3 and wild-type 84K poplar (labeled as WT) in the greenhouse. The results of growing in the greenhouse for 2 months are shown in Figure 3 . Take the 10th stem segment of wild-type 84K poplar and PagGRF3a-overexpressing plants grown in the greenhouse for 2 months respectively. Embed the stem segment samples with resin, make semi-thin sections with a semi-thin microtome, stain the sections with toluidine blue, and take pictures and observe under an optical microscope. And use Image J software to analyze relevant indicators. The results show that at the 10th stem segment, the proportion of secondary xylem in the stem and the width of the xylem in OE- PagGRF3a are both greater than those in WT (see Figure 4 ). In summary, PagGRF3a promotes the development of secondary xylem in Populus alba × Populus glandulosa.

[0067] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and modifications can be made, and these improvements and modifications should also be regarded as the protection scope of the present invention.

Claims

1. Application of PagGRF3a gene in promoting the development of secondary xylem of trees, characterized in that, The nucleotide sequence of the PagGRF3a gene is shown in SEQ ID No. 1; it functions through overexpression of the PagGRF3a gene; the tree is a poplar tree.

2. Application of the PagGRF3a gene in tree dwarfing, characterized in that, The nucleotide sequence of the PagGRF3a gene is shown in SEQ ID No. 1; it functions through overexpression of the PagGRF3a gene; the tree is a poplar tree.

3. Use of a biological material containing the PagGRF3a gene in promoting the development of secondary xylem in trees or in dwarfing trees, characterized in that, The nucleotide sequence of the PagGRF3a gene is shown in SEQ ID No. 1; the tree is a poplar tree.

4. The application according to claim 3, wherein The biological material includes a recombinant vector; the backbone vector of the recombinant vector includes pCAMBIA2300-35S-OCS .

5. A method for promoting the development of secondary xylem in trees and / or dwarfing of trees, characterized in that, It includes the following steps: transforming a recombinant vector containing the PagGRF3a gene into a tree; the nucleotide sequence of the PagGRF3a gene is shown in SEQ ID No. 1; the tree is a poplar tree.

6. The method according to claim 5, wherein The backbone vector of the recombinant vector includes pCAMBIA2300-35S-OCS ; The transformation method includes the Agrobacterium-mediated transformation method.

7. The method according to claim 6, characterized in that, The construction method of the recombinant vector comprises the following steps: cloning the PagGRF3a gene from Populus alba×Populus glandulosa, and pCAMBIA2300-35S-OCS after digestion with XbaI and KpnI restriction endonucleases, ligating with the PagGRF3a gene.

8. The method according to claim 7, wherein The nucleotide sequences of the primers for cloning are shown in SEQ ID No. 3 and SEQ ID No. 4.

Citation Information

Patent Citations

  • PagFIP37 protein, encoding gene of PagFIP37 protein and application of encoding gene

    CN115927233A

  • Regulation and control effect of 84K poplar PagAPA1 gene in tree secondary xylem development

    CN117305356A