Novel lipid nanoparticle as well as preparation method and application thereof

Abstract

The invention relates to a lipid nanoparticle. The lipid nanoparticle comprises ionizable lipid, phospholipid, polyethylene glycol-lipid and sterol, wherein the sterol has a structure # imgabs0 # as shown in the following formula (I), and R1, R2, R3, ring A, ring B, ring C, ring D and T are defined in the specification; and the hardness of the lipid nanoparticles is 28 to 105 MPa. The invention also relates to a preparation method of the lipid nanoparticles and application of the lipid nanoparticles in preparation of pharmaceutical compositions for preventing or treating infectious diseases, fatty liver, tumors and autoimmune diseases.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine and specifically relates to a novel lipid nanoparticle, which comprises a sterol (a derivative fused with three cyclohexyl groups and one cyclopentyl group) having a cyclopentane polyhydrophenanthrene structure, a phospholipid, an ionizable lipid and a polyethylene glycol-lipid, and the hardness of the particle ranges from 28 to 105 MPa; the present invention also relates to the lipid nanoparticle composition used in the preparation of a pharmaceutical composition for preventing or treating infectious diseases, fatty liver, tumors and autoimmune diseases. Background Art

[0002] Messenger RNA (mRNA) was first discovered in the early 1960s and was delivered into cells in the 1970s, successfully expressing proteins. Unlike DNA-based protein expression technologies, mRNA does not need to enter the cell nucleus to fulfill its function, and therefore does not insert into the original genome and cause genetic mutations. Over the past few decades, the use of mRNA to induce rapid protein production has been realized, and its application in treating infectious diseases, cancer, and rare genetic diseases, as well as in cell and gene manipulation, has attracted the attention of the scientific community. Moreover, research on mRNA modification and delivery platform design has also efficiently and rapidly promoted the development of mRNA technology. In particular, during the global outbreak of COVID-19, the successful launch of mRNA vaccines from Pfizer / BioNTech and Moderna and their effectiveness in preventing the spread of the virus finally brought mRNA technology into the public eye.

[0003] mRNA is a single-stranded long polynucleotide, which is easily degraded by ribonucleases. In addition, the cell membrane further hinders the entry of mRNA into the cell to perform protein transfection through electrostatic repulsion. Therefore, a carrier is needed to protect mRNA from degradation and to efficiently transport mRNA into the target cell in order to realize the function of mRNA. At present, various types of non-viral vectors have been developed to achieve efficient delivery of mRNA, mainly including: protein-mRNA complexes, lipid carriers (such as lipid nanoparticles Lipid Nanoparticles), polymer carriers, mixed carriers, etc. Among them, lipid nanoparticles (LNP) have also been proven to be a good carrier for mRNA delivery, but in the actual delivery process, they encounter various barriers, which hinder the delivery of mRNA.

[0004] First, the uptake efficiency of lipid nanoparticles by immune cells is low, resulting in unsatisfactory immune effects. Second, when LNPs are internalized by cells, the ionizable cationic lipids ionize in an acidic environment, destroying the endosomal membrane, thereby achieving endosomal escape of the LNPs. However, recent studies have shown that most LNPs are trapped in endosomes for degradation or flow out of the cell, with only a small portion (2%) reaching the cytosol. Therefore, improving the efficiency of their endosomal escape is an urgent problem that needs to be solved.

[0005] Therefore, it is necessary to develop a new lipid nanoparticle LNP that can be efficiently taken up by immune cells to achieve excellent immune effects and can efficiently deliver therapeutic agents, especially mRNA. Summary of the Invention

[0006] The first aspect of the present invention provides a lipid nanoparticle composition comprising: an ionizable lipid, a phospholipid, a polyethylene glycol-lipid, and a sterol, wherein the sterol has the structure of the following formula (I):

[0007]

[0008] Wherein, R1, R2, R3 are the same or different, each independently H or C1-C4 alkyl, and wherein R1, R2 and R3 are methyl, the T part is 1,5-dimethylhexyl The tilde represents the attachment site of this moiety to the rest of the formula (I),

[0009] Ring A is a saturated cyclohexyl group, and Ring D is a saturated cyclopentyl group.

[0010] Ring B and Ring C are independently saturated or unsaturated cyclohexyl groups, wherein the unsaturated cyclohexyl groups each independently contain 1, 2 or 3 double bonds;

[0011] The T portion is a C4-C8 alkyl group or a C4-C8 alkenyl group; the C4-C8 alkyl group or the C4-C8 alkenyl group is optionally substituted with one or more identical or different substituents selected from the following: a C1-C4 alkyl group, a C1-C4 alkylene group, or a C2-C4 alkenyl group;

[0012] wherein, under the condition that the T moiety is 1,5-dimethylhexyl, the A ring, the B ring and the C ring are saturated cyclohexyl and the D ring is a saturated cyclopentyl, or at least one of R1 and R2 is a C1-C4 alkyl group;

[0013] The hardness of the lipid nanoparticles is 28 to 105 MPa, preferably 40 to 90 MPa, and more preferably 60 to 85 MPa.

[0014] A second aspect of the present invention provides a method for preparing the lipid nanoparticle composition of the present invention.

[0015] The second aspect of the present invention provides use of the lipid nanoparticle composition described in the first aspect in preparing a pharmaceutical composition for preventing or treating infectious diseases, fatty liver, tumors and autoimmune diseases.

[0016] In the present invention, lipid nanoparticles contain ionizable lipids, polyethylene glycol-lipids, phospholipids and sterols of formula (I). By adjusting the unsaturation of the cyclopentaphenanthrene main part (composed of A, B, C, and D rings fused together) and the aliphatic hydrocarbon tail (T part) in the structure of formula (I) and introducing specific selection of substituents, the hardness of LNP is controlled within an appropriate range (28 to 105 MPa), thereby improving the delivery efficiency of LNP for therapeutic agents and the uptake efficiency of LNP by immune cells, thereby achieving effective treatment and immunity.

[0017] Furthermore, the specific combination of the sterol of formula (I) and the specific phospholipid is conducive to further improving the delivery efficiency of LNP for the therapeutic agent, improving the preventive and therapeutic effects of the therapeutic agent, including cell uptake efficiency, transfection efficiency, tumor inhibition, prevention and treatment of diseases such as influenza, fatty liver, autoimmune diseases, etc.

[0018] Surprisingly, the inventors found that the above-mentioned beneficial technical effects of LNP can be achieved by adjusting the hardness of LNP. In the present invention, the hardness of the lipid nanoparticle composition ranges from 28 to 105 MPa, preferably from 40 to 90 MPa, and more preferably from 60 to 85 MPa. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 The particle sizes of different LNPs are shown;

[0020] Figure 2 The particle size PDI of different LNPs is shown;

[0021] Figure 3 Shown are the mRNA encapsulation rates of different LNPs;

[0022] Figure 4 The hardness of different LNPs is shown;

[0023] Figure 5 The mean fluorescence intensity of DC2.4 cells that took up different LNPs is shown;

[0024] Figure 6 Shown are the average fluorescence intensities of EGFP-mRNA expression in DC2.4 cells after transfection of different LNPs;

[0025] Figure 7The relationship between the hardness of different LNPs and the mean fluorescence intensity of EGFP-mRNA expression after transfection in DC2.4 cells is shown;

[0026] Figure 8 Shown are the fluorescence intensities of draining lymph nodes in mice administered different LNPs by intramuscular injection;

[0027] Figure 9 The figure shows the proportion of positive DCs (i.e., dendritic cells that took up LNPs) in the draining lymph nodes of mice given different LNPs by intramuscular injection;

[0028] Figure 10 The figure shows the expression level of luci-mRNA in the draining lymph nodes after intramuscular injection of six LNP series (SM102-LNP series, Lipid9-LNP series, ALC0315-LNP series, (D-Lin-MC6-DMA)-LNP series, (CKK-E12)-LNP series, and (OF-Deg-Lin)-LNP series);

[0029] Figure 11 The IgG antibody binding titer is shown after LNP containing S protein mRNA of the novel coronavirus Omicron variant was injected into mice intramuscularly;

[0030] Figure 12 Shows the survival rate of mice after administration of different LNPs encapsulating influenza virus H1N1 mRNA vaccine;

[0031] Figure 13 Shown are tumor volumes in mice following administration of different LNPs encapsulating HPV mRNA;

[0032] Figure 14 The proportion of IFN-γ-positive CD8 T cells in tumors of mice administered with different LNPs encapsulating HPV mRNA is shown;

[0033] Figure 15 Shown are the AST levels in serum of mice administered LNPs encapsulating CTA protein mRNA by intravenous injection.

[0034] Figure 16 Shown are the serum ALT levels in mice administered LNPs encapsulating CTA protein mRNA by intravenous injection.

[0035] Figure 17 Shown are triglyceride levels in the liver of mice administered LNPs encapsulating CTA protein mRNA by intravenous injection.

[0036] Figure 18Shown are the levels of cholesterol in the liver of mice administered LNPs encapsulating CTA protein mRNA by intravenous injection.

[0037] Figure 19 The figure shows the ratio of Treg cells to CD4+ T cells in the lymphocytes of mice injected with different LNPs encapsulating long-acting IL-2 mutant protein mRNA.

[0038] Figure 20 The figure shows the ratio of Treg cells to CD4+ T cells in the spleen of mice injected with different LNPs encapsulating long-acting IL-2 mutein mRNA.

[0039] Figure 21 The figure shows the ratio of Treg cells to CD4+ T cells in the spinal cord of mice injected with different LNPs encapsulating long-acting IL-2 mutant protein mRNA.

[0040] Figure 22 The graph shows the expression levels of luci-mRNA in the draining lymph nodes after intramuscular injection of five series of LNPs (A1-LNP series, F1-LNP, F2-LNP, D2-LNP, and C1-LNP series). DETAILED DESCRIPTION

[0041] Below, embodiments of the LNP having a hardness within a specific range according to the present invention are described in detail with appropriate reference to the accompanying drawings. However, unnecessary detailed descriptions may be omitted. For example, detailed descriptions of well-known matters or repeated descriptions of substantially identical structures may be omitted. This is to avoid unnecessary length in the following description and to facilitate understanding by those skilled in the art. Furthermore, the accompanying drawings and the following description are provided to facilitate a thorough understanding of the present application by those skilled in the art and are not intended to limit the subject matter described in the claims.

[0042] As used herein, "ranges" are defined in terms of lower and upper limits. A given range is defined by selecting a lower limit and an upper limit, the selected lower and upper limits defining the boundaries of the particular range. Ranges defined in this manner may be inclusive or exclusive and may be combined arbitrarily, i.e., any lower limit may be combined with any upper limit to form a range. For example, if ranges of 28 to 105 and 60 to 85 are listed for a particular parameter, it is understood that ranges of 60 to 105 and 28 to 85 are also contemplated.

[0043] Unless otherwise specified, all embodiments, optional embodiments, and preferred embodiments of the present application can be combined with each other to form a new technical solution.

[0044] Unless otherwise specified, all technical features, optional technical features, and preferred technical features of this application can be combined with each other to form a new technical solution.

[0045] Unless otherwise specified, the terms "include" and "comprising" used in this application may be open-ended or closed-ended. For example, "include" and "comprising" may mean that other components not listed may also be included or that only the listed components are included.

[0046] definition

[0047] Unless otherwise specified, in the context of the present invention, the substituents each have the following meanings:

[0048] Sterols, also known as sterols, are a type of steroid and are steroids containing hydroxyl groups. They all have cyclopentanepolyhydrophenanthrene as their basic structure and contain hydroxyl groups, hence the name sterol compounds.

[0049] In the context of the present invention, alkyl refers to a straight-chain or branched alkyl group having the number of carbon atoms specified in each case. Examples include the following: methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, 1-methylpropyl, tert-butyl, n-pentyl, isopentyl, 1-ethylpropyl, 1-methylbutyl, 2-methylbutyl, 3-methylbutyl, n-hexyl, 1-methylpentyl, 2-methylpentyl, 3-methylpentyl, 4-methylpentyl, 3,3-dimethylbutyl, 1-ethylbutyl and 2-ethylbutyl, 1,5-dimethylhexyl, n-undecyl, n-tridecyl, n-pentadecyl, and n-heptadecyl. For example, C1-C8 alkyl is a straight-chain or branched alkyl group having 1 to 8 carbon atoms.

[0050] In the context of the present invention, alkylene is a straight-chain divalent alkyl radical having the number of carbon atoms specified in each case. For example, C1-C4-alkylene is a divalent radical of a straight-chain or branched alkyl radical having 1 to 4 carbon atoms, which includes but is not limited to the following radicals: methylene (=CH2, -CH2-), ethane-1,2-diyl (-CH2CH2-), ethane-1,1-diyl (=CH-CH3), propane-1,3-diyl, propane-1,1-diyl, propane-1,2-diyl, propane-2,2-diyl, butane-1,4-diyl, butane-1,2-diyl, butane-1,3-diyl and butane-2,3-diyl.

[0051] In the context of the present invention, alkenyl is a straight-chain or branched alkenyl radical having the number of carbon atoms specified in each case and at least one double bond. Examples include the following: vinyl, allyl, isopropenyl and n-but-2-en-1-yl, 1,5-dimethylhexyl-1-ene (—(CH 3 )CH═CHCH 2 CH 2 (CH 3 )CH 2 ), 1,5-dimethylhexyl-3-ene, 1,5-dimethylhexyl-5-ene, 1,5-dimethylhexyl-1,3-diene, 1,5-dimethylhexyl-1,4-diene, 1,5-dimethylhexyl-1,5-diene, 1,5-dimethylhexyl-2,4-diene, 1,5-dimethylhexyl-3,5-diene. Unless otherwise indicated, or the structure clearly indicates the stereo configuration, the structures of the compounds of the present invention may exist in different stereoisomeric forms, i.e. in the form of configurational isomers or optionally also in the form of conformers (enantiomers and / or diastereomers, including atropisomers). Therefore, the present invention includes enantiomers and diastereomers and their respective mixtures.

[0052] Where the compounds of the present invention are capable of existing in tautomeric forms, the present invention includes all tautomeric forms.

[0053] lipid nanoparticles

[0054] A first aspect of the present invention provides a lipid nanoparticle composition comprising: an ionizable lipid, a phospholipid, a polyethylene glycol-lipid, and a sterol;

[0055] Wherein, the sterol has the structure of the following formula (I):

[0056]

[0057] in,

[0058] R1, R2, R3 are the same or different, each independently H or C1-C4 alkyl, and under the condition that R1, R2 and R3 are all methyl, the T part is 1,5-dimethylhexyl The tilde represents the attachment site of this moiety to the rest of the formula (I),

[0059] Ring A is a saturated cyclohexyl group, and Ring D is a saturated cyclopentyl group.

[0060] Ring B and Ring C are independently saturated or unsaturated cyclohexyl groups, wherein the unsaturated cyclohexyl groups each independently contain 1, 2 or 3 double bonds;

[0061] The T portion is a C4-C8 alkyl group or a C4-C8 alkenyl group; the C4-C8 alkyl group or the C4-C8 alkenyl group is optionally substituted with one or more identical or different substituents selected from the following: a C1-C4 alkyl group, a C1-C4 alkylene group, or a C2-C4 alkenyl group;

[0062] Wherein, under the condition that the T portion is 1,5-dimethylhexyl, the A ring, the B ring, and the C ring are saturated cyclohexyl and the D ring is a saturated cyclopentyl, or at least one of R1 and R2 is a C1-C4 alkyl group;

[0063] The hardness of the lipid nanoparticles is 28 to 105 MPa, preferably 40 to 90 MPa, and more preferably 60 to 85 MPa.

[0064] Sterols

[0065] The lipid nanoparticles of the present invention contain a sterol or a stereoisomer or solvate thereof. The compounds of formula (I) described above provide a broad definition of the compounds of the present invention. The optional, preferred, more preferred, particularly preferred and most preferred substituents or ranges of the groups listed in formula (I) of the present invention will be described below. These substituents or ranges can be combined in any way, and the compounds formed thereby constitute part of the present invention.

[0066] Preferably, the T portion is a C5-C7 alkyl group or a C5-C7 alkenyl group; the C5-C7 alkyl group or the C5-C7 alkenyl group is optionally substituted by one or more identical or different substituents selected from the group consisting of methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, 1-methylpropyl, tert-butyl, methylene (=CH2), ethane-1,1-diyl (=CH-CH3), propane-1,1-diyl, propane-2,2-diyl, butane-1,1-diyl, butane-2,2-diyl, butane-3,3-diyl, propenyl (-CH=CHCH3), allyl (-CH2CH=CH3), 1-butenyl (-CH=CHCH2CH3), 2-butenyl (-CH2CH=CHCH3), and 3-butenyl (-CH2CHCH=CH2);

[0067] Preferably, the B ring is an unsaturated cyclohexyl group having 1 or 2 double bonds, wherein the 2 double bonds are preferably conjugated double bonds;

[0068] Preferably, the C ring is an unsaturated cyclohexyl group having 1 or 2 double bonds, wherein the 2 double bonds are preferably conjugated double bonds;

[0069] Optionally, the B ring and the C ring share a double bond (also referred to as sharing a double bond, or having the same double bond);

[0070] Optionally, the double bonds of ring B and ring C are conjugated double bonds.

[0071] In a preferred embodiment, the sterol is of the following formula (I-1),

[0072]

[0073] in,

[0074] Numbers 1 to 27 represent the numbers of carbon atoms;

[0075] R1, R2, and R3 are the same or different and are each independently H or methyl;

[0076] Ring A, Ring B, Ring C and Ring D together form a condensed hydrocarbon ring, the condensed positions of which are carbon atoms numbered 5, 10, 8, 9, 13 and 14; wherein Ring A is a saturated cyclohexyl group, Ring D is a saturated cyclopentyl group,

[0077] Ring B and Ring C are independently saturated or unsaturated cyclohexyl;

[0078] Optionally, when Ring B or Ring C is an unsaturated cyclohexyl group, it contains 1, 2 or 3 double bonds, and the double bond is present in at least one of the following positions: between two adjacent carbon atoms numbered 8 and 9 (i.e., between two adjacent carbon atoms in the fused position, which is a double bond shared by Ring B and Ring C), between two adjacent carbon atoms numbered 5 and 6, between two adjacent carbon atoms numbered 7 and 8, and between two adjacent carbon atoms numbered 9 and 11; in particular, when it contains 2 or 3 double bonds, the double bonds are conjugated double bonds;

[0079] The T portion is a portion consisting of carbon atoms numbered 20 to 27 having R4, which is an alkyl group (C4-C8 alkyl, preferably C5-C7 alkyl) or an alkenyl group (C4-C8 alkenyl, preferably C5-C7 alkenyl), wherein the alkenyl group preferably has 1 or 2 double bonds, and the double bond is located between any two adjacent carbon atoms among R4 and / or carbon atoms numbered 20 to 27, preferably between two adjacent carbon atoms numbered 22 and 23, between two adjacent carbon atoms numbered 24 and 25, or between two adjacent carbon atoms numbered 25 and 26,

[0080] R4 is hydrogen, methyl, ethyl, methylene (=CH2) or ethane-1,1-diyl (=CH-CH3); and,

[0081] When R1, R2 and R3 are all methyl, the T portion is the following formula (I-2): alkyl (1,5-dimethylhexyl) or,

[0082] Under the condition that the T portion is an alkyl group of formula (I-2), the A ring, the B ring and the C ring are saturated cyclohexyl groups and the D ring is a saturated cyclopentyl group, or at least one of R1 and R2 is a methyl group,

[0083] The tilde represents the attachment point where this moiety is linked to the rest of the moiety of formula (I-1).

[0084] In a specific embodiment, the sterol is selected from the group consisting of campesterol, β-sitosterol, streptosterol, dehydrocholesterol, rapeseed sterol, stigmasterol, erythrostosterol, spongasterol, fuccasterol, ergosterol, dehydroergosterol, dihydrocholesterol, campesterol, sitostanol, cactasterol, spinasterol, δ7-avenasterenol, yeast sterol, blunt leaf alcohol, grass sterol, 4-methyl-7-enecholesterol, limonadienol, cycloartanol; preferably campesterol, β-sitosterol, dehydrocholesterol, rapeseed sterol, fuccasterol, ergosterol, dehydroergosterol, sitostanol, δ7-avenasterenol.

[0085] The structural formula of sterol is shown in Table 1 below:

[0086] Table 1

[0087]

[0088]

[0089]

[0090]

[0091]

[0092] In the present invention, the molar percentage of sterol is 25% to 48%, preferably 30% to 45%, based on the total molar amount of ionizable lipid, phospholipid, polyethylene glycol-lipid and sterol contained in the lipid nanoparticles.

[0093] phospholipids

[0094] In the present invention, the lipid nanoparticles comprise phospholipids, including but not limited to 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycerophosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0Diether PC), 1-oleoyl-2-cholesteryl hemisuccinyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16LysoPC), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine, 1,2-diachidonoyl-sn-glycero-3-phosphocholine, 1,2-docosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16.0PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-docosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), and sphingomyelin.

[0095] In a specific embodiment of the present invention, the phospholipid is of formula (II):

[0096]

[0097] wherein R6 and R7 are independently selected from C 10 -C 20 -alkyl;

[0098] R8, R9, R 10 Independently of each other, they are selected from H, C1-C4 alkyl, preferably methyl or ethyl.

[0099] The phospholipid compounds of formula (II) may exist in different isomeric forms.

[0100] In another embodiment, the phospholipid has the structure of formula (II-1):

[0101]

[0102] Wherein R4 and R5 are independently selected from C 10 -C 20 -alkyl;

[0103] R6, R7, and R8 are independently selected from H, methyl, or ethyl.

[0104] Preferably, examples of C10-C20-alkyl groups include, but are not limited to, decyl and its isomers, undecyl and its isomers, dodecyl and its isomers, tridecyl and its isomers, tetradecyl and its isomers, pentadecyl and its isomers, hexadecyl and its isomers, heptadecyl and its isomers, octadecyl and its isomers, nonadecyl and its isomers, eicosyl and its isomers.

[0105] Preferably, examples of the C1-C4 alkyl group include, but are not limited to, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, 1-methylpropyl, and tert-butyl.

[0106] In another specific embodiment of the present invention, the phospholipid is selected from dilauroyl phosphatidylcholine DLPC, dimyristoyl phosphatidylcholine DMPC, dipalmitoyl phosphatidylcholine DPPC, distearoyl phosphatidylcholine DSPC, dilauroyl phosphatidylethanolamine DLPE, dimyristoyl phosphatidylethanolamine DMPE, dipalmitoyl phosphatidylethanolamine DPPE, and distearoyl phosphatidylethanolamine DSPE.

[0107] In a preferred embodiment, the phospholipid is selected from at least one compound of the following formulae (i-1) to (i-4) and (ii-1) to (ii-4):

[0108]

[0109] In the present invention, the molar percentage of phospholipids is 3% to 20%, preferably 5% to 17%, based on the total molar amount of ionizable lipids, phospholipids, polyethylene glycol-lipids and sterols contained in the lipid nanoparticles.

[0110] In the present invention, the molar ratio of the sterol of formula (I) to phospholipid is 1: 1 to 10: 1, preferably 1.5: 1 to 8: 1, thereby further regulating the hardness of lipid nanoparticles, so that the delivery efficiency of lipid nanoparticles is improved. This is mainly due to the interaction between sterol and phospholipid. Specifically, sterol is located in the bilayer of phospholipid, and the hydroxyl group of sterol is attached to the hydrophilic head group of phospholipid, and the aliphatic hydrocarbon tail T of sterol extends to the hydrophobic center of LNP, produces sorting effect for the long-chain alkyl of phospholipid by van der Waals force, increases hydrophobic layer thickness, reduces LNP permeability and increases its stability, thus affecting the hardness of lipid nanoparticles.

[0111] Optionally, the sum of the molar amounts of sterol and phospholipid accounts for 40% to 55%, based on the total molar amount of ionizable lipid, phospholipid, polyethylene glycol-lipid, and sterol being 100%.

[0112] In a preferred embodiment, the lipid nanoparticles comprise a specific combination of any one of f-3, b-2, a-3, e-3, b-3, d-1, and d-2 shown in Table 1 and DSPC, and the hardness of the lipid nanoparticles is 66 to 81 MPa, for example, 73 to 81 MPa, 76 to 81 MPa, or 73 to 86 MPa; thereby further improving the encapsulation efficiency of the bioactive agent, improving the uptake efficiency of the bioactive agent by immune cells, increasing the transfection efficiency of the bioactive agent by cells, and enhancing the enrichment of the bioactive agent in the lymph nodes, anti-tumor effect, and in vivo immune effect.

[0113] In one embodiment, the lipid nanoparticles comprise: ionizable lipids, phospholipids, polyethylene glycol-lipids, and sterols, wherein the ionizable lipids are SM102, Lipid 9, D-Lin-MC3-DMA, ALC 0315, cKK-E12, OF-Deg-Lin, the phospholipid is selected from at least one of the compounds of formula (i-1) to (i-4) and formula (ii-1) to (ii-4), the sterol is selected from at least one of campesterol, β-sitosterol, chain sterol, dehydrocholesterol, rapeseed sterol, stigmasterol, erythrol, spongosterol, fuccasterol, ergosterol, dehydroergosterol, dihydrocholesterol, campesterol, sitostanol, cactasterol, spinasterol, δ7-avenasterol, yeast sterol, blunt leaf alcohol, grass sterol, 4-methyl-7-ene cholesterol, limonadienol, and cycloartanol, and the hardness of the lipid nanoparticles is 28 to 105 MPa.

[0114] In another specific embodiment, the lipid nanoparticles comprise: ionizable lipids, phospholipids, polyethylene glycol-lipids, and sterols, wherein the ionizable lipids are at least one of SM102, Lipid 9, D-Lin-MC3-DMA, ALC 0315, cKK-E12, and OF-Deg-Lin, the phospholipids are compounds of formula (i-4) (DSPC), and the sterols are selected from at least one of β-sitosterol, dehydrocholesterol, rapeseed sterol, fuccasterol, ergosterol, dehydroergosterol, sitostanol, δ7-avenasterenol, cactus sterol, spinach sterol, dehydroergosterol, and spongosterol, and the hardness of the lipid nanoparticles is 35 to 99 MPa, for example, 66 to 81 MPa, 73 to 81 MPa, 76 to 81 MPa, or 73 to 86 MPa.

[0115] In yet another specific embodiment, the lipid nanoparticles comprise: ionizable lipids, phospholipids, polyethylene glycol-lipids, and sterols, wherein the ionizable lipids are at least one of SM102, Lipid 9, D-Lin-MC3-DMA, ALC 0315, cKK-E12, and OF-Deg-Lin, the phospholipids are compounds of formula (i-4) (DSPC), the polyethylene glycol-lipids are DMP-PEG2000, and the sterols are selected from at least one of β-sitosterol, dehydrocholesterol, rapeseed sterol, fuccasterol, ergosterol, dehydroergosterol, sitostanol, δ7-avenasterenol, cactus sterol, spinach sterol, dehydroergosterol, and spongosterol, and the hardness of the lipid nanoparticles is 35 to 99 MPa, for example, 66 to 81 MPa, 73 to 81 MPa, 76 to 81 MPa, or 73 to 86 MPa.

[0116] Ionizable lipids

[0117] In the present invention, the lipid nanoparticles contain ionizable lipids, examples of which include but are not limited to 3-(didodecylamino)-N1,N1,4-tridodecyl-1-piperazineethylamine (KL10), N1-[2-(didodecylamino)ethyl]-N1,N4,N4-tridodecyl-1,4-piperazinediethylamine (KL22), 14,25-ditridecyl-15,18,21,24-tetraaza-triacontane (KL25), 1,2-dilinoleyloxy-N,N-dimethylamino 1,2-Dioleyloxy-N,N-dimethylaminopropane (DLinDMA), 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA), 4-(dimethylamino)butyric acid heptathriacontac-6,9,28,31-tetraen-19-yl ester (DLin-MC3-DMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), 1,2-dioleyloxy-N,N-dimethylaminopropane (DOD MA), 2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (octyl-CLinDMA), (2R)-2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (octyl-CLinDMA), MA(2R)), (2S)-2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z-,12Z)-octadec-9,12-dien-1-yloxy]propan-1-amine (octyl-CLinDMA(2S)), (12Z,15Z)-N,N-dimethyl-2-nonylheneicosaf-12,15-dien-1-amine, N,N-dimethyl-1-{(1S,2R)-2-octylcyclopropyl}heptadecan-8-amine. Additional exemplary charged or ionizable lipids that can form part of the nanoparticle compositions of the present invention include lipids (e.g., lipid 5) described in Sabnis et al., "A Novel Amino Lipid Series for mRNA Delivery: Improved Endosomal Escape and Sustained Pharmacology and Safety in Non-human Primates," Molecular Therapy, Vol. 26, No. 6, 2018, which is incorporated herein by reference in its entirety.

[0118] In a specific embodiment of the present invention, the ionizable lipid comprises a cationic lipid, which is preferably selected from one of SM102, Lipid 9, D-Lin-MC3-DMA, ALC 0315, cKK-E12, 7C1, OF-Deg-Lin, or any combination thereof.

[0119]

[0120] In the present invention, the molar percentage of the ionizable lipid is 40% to 60%, preferably 45% to 55%, based on the total molar amount of the ionizable lipid, phospholipid, polyethylene glycol-lipid and sterol contained in the lipid nanoparticles.

[0121] polyethylene glycol-lipid

[0122] In the present invention, the lipid nanoparticles comprise polyethylene glycol-lipids, examples of which include, but are not limited to, PEGylated diacylglycerols (PEG-DAG), such as 1-(monomethoxy-polyethylene glycol)-2,3-dimyristoylglycerol (PEG-DMG); PEGylated phosphatidylethanolamine (PEG-PE); PEG succinate diacylglycerols (PEG-S-DAG), such as 4-O-(2',3'-di(tetradecanoyloxy)propyl-1-O-(ω-methoxy(polyethoxy)ethyl)succinate (PEG-S-DMG); PEGylated ceramide (PEG-cer); or PEG dialkoxypropylcarbamates, such as ω-methoxy(polyethoxy)ethyl-N-(2,3-di(tetradecyloxy)propyl)carbamate or 2,3-di(tetradecyloxy)propyl-N-(ω-methoxy)(polyethoxy)ethyl)carbamate.

[0123] In a specific embodiment of the present invention, the polyethylene glycol-lipid is selected from phosphatidylethanolamine-polyethylene glycol 2000 (DSPE-PEG2000), distearoylphosphatidylglycerol-polyethylene glycol 2000, dilauroylphosphatidylglycerol-polyethylene glycol 2000, dioleoylphosphatidylglycerol-polyethylene glycol 2000, dimyristoylphosphatidylglycerol-polyethylene glycol 2000, dimyristoylglycerol-polyethylene glycol 2000, dilinoylphosphatidylglycerol-polyethylene glycol 2000, dieucoylphosphatidylglycerol-polyethylene glycol 2000, 1-palmitoyl-2-oleoylphosphatidylglycerol-polyethylene glycol 2000, or dipalmitoylphosphatidylglycerol-polyethylene glycol 2000. Preferably, it is dimyristoylglycerol-polyethylene glycol 2000 (DMP-PEG2000).

[0124] In the present invention, the molar percentage of polyethylene glycol-lipid is 1% to 2%, preferably 0.8% to 1.8%, based on the total molar amount of ionizable lipid, phospholipid, polyethylene glycol-lipid and sterol contained in the lipid nanoparticles.

[0125] In the present invention, the molar ratio of the ionizable lipid, phospholipid, sterol, and polyethylene glycol-lipid in the lipid nanoparticles is (28-40):(4-14):(15-35):1, preferably (30-35):(5-12):(20-30):1, and most preferably 33.33:6.67:1:25.67.

[0126] In the present invention, lipid nanoparticles can be prepared using methods commonly used in the art, such as microfluidics, high-pressure homogenization, emulsification precipitation, and ultrasonic dispersion.

[0127] The preparation of the lipid nanoparticles of the present invention comprises the following steps:

[0128] S1: dissolving an ionizable lipid, a phospholipid, a polyethylene glycol-lipid, and a sterol in an organic solvent to obtain a lipid mixture;

[0129] S2: uniformly mixing the lipid mixture with the bioactive agent to obtain a lipid nanoparticle precursor solution;

[0130] S3: After the lipid nanoparticle precursor solution is encapsulated, the organic solvent is removed by dialysis to obtain lipid nanoparticles.

[0131] In one embodiment, the preparation of the lipid nanoparticles of the present invention comprises the following steps:

[0132] S1-1: dissolving an ionizable lipid, a phospholipid, a polyethylene glycol-lipid, and a sterol in an organic solvent (e.g., ethanol) to obtain a lipid mixture;

[0133] S2-1: Using a microfluidic chip or a T-type mixer, the lipid mixture is uniformly mixed with a bioactive agent such as mRNA at a molar ratio of 1:1 to 12:1, preferably 6:1 (N:P) to obtain a lipid nanoparticle precursor solution.

[0134] S3-1: After encapsulation is completed on the nanomedicine manufacturing equipment, the organic solvent (such as ethanol) is removed by dialysis to obtain the lipid nanoparticles of the present invention.

[0135] In steps S1 and S1-1, the molar ratio of ionizable lipid, phospholipid, polyethylene glycol-lipid, and sterol is (28-40):(4-14):(15-35):1, preferably (30-35):(5-12):(20-30):1. In a specific embodiment, the molar ratio of ionizable lipid, phospholipid, polyethylene glycol-lipid, and sterol is 50:10:1.5:38.5, as shown in Table 1.

[0136] In steps S2 and S-1, the bioactive agent (e.g., mRNA) is in the form of an aqueous solution, i.e., mRNA in a 10 mM citrate buffer at pH 4. The lipid mixture and the bioactive agent are mixed in a microfluidic device at a total flow rate of 14 to 20 mL / min, with the lipid mixture serving as the organic phase and the aqueous solution of the bioactive agent serving as the aqueous phase. The organic phase to aqueous phase flow rate ratio is 1:2 to 1:6.

[0137] "N / P" refers to the nitrogen to phosphorus ratio, which is calculated by calculating the molar ratio of the tertiary amine groups of the ionizable lipid, such as the cationic lipid, to the phosphate units in the nucleic acid molecule, as described in Example 1.

[0138] In steps S3 and S3-2, encapsulation was completed using a microfluidic device in a clean bench at room temperature. The dialysis operating conditions were as follows: the obtained lipid nanoparticle precursor solution was placed in a dialysis bag with a molecular weight cutoff of 100,000 Daltons and dialyzed at 4°C in the dark for 18 to 22 hours. The liquid used for dialysis was sterile 1× PBS.

[0139] In the present invention, the particle size of the lipid nanoparticles is 50 nm to 200 nm, preferably 60 nm to 130 nm, and optionally 60 nm to 100 nm. The polydispersity index (PDI) of the lipid nanoparticles is 0.1 to 0.3, optionally 0.1 to 0.25, for example 0.1 to 0.23. The hardness of the lipid nanoparticles is 28 to 105 MPa, for example 28 to 103 MPa, 28 to 99 MPa, 45 to 89 MPa, 64 to 89 MPa, 71 to 89 MPa, 66 to 81 MPa, 73 to 81 MPa, 76 to 81 MPa, or 73 to 86 MPa.

[0140] In the present invention, the encapsulation efficiency of the lipid nanoparticles for the bioactive agent is 80-99%, and the bioactive agent is a nucleic acid, preferably mRNA.

[0141] The particle size and polydispersity index (PDI) of lipid nanoparticles were measured using a dynamic light scattering particle size analyzer, and the hardness was measured using an atomic force microscope. The key chamber of the atomic force microscope is the cantilever, which is a leaf spring. There is a tip at the end of the cantilever that can scan the sample surface line by line. The force between the tip and the sample can be attractive or repulsive, both of which cause the cantilever to deflect toward or away from the sample. Affected by the deflection of the cantilever, the detection laser will fall on different parts of the photodetector, generating different electrical signals. The atomic force microscope (AFM) uses a tiny probe to scan the sample surface and record its surface topology and mechanical properties. When the probe contacts the sample surface, the hardness information of the sample can be obtained by measuring the force of the probe movement. As the probe moves across the sample surface, it will experience varying degrees of bending and deformation. These changes will be detected and used to calculate the hardness of the sample.

[0142] bioactive agents

[0143] In the present invention, the lipid nanoparticles further comprise a bioactive agent, which includes one or more of a nucleic acid, an antitumor agent, an antibiotic, an immunomodulator, an anti-inflammatory agent, an agent acting on the central nervous system, an antigen or a fragment thereof, a peptide, a protein, an antibody, a vaccine and a small molecule; preferably, the nucleic acid is RNA, messenger RNA (mRNA), antisense oligonucleotide, DNA, a plasmid, ribosomal RNA (rRNA), microRNA (miRNA), transfer RNA (tRNA), small interfering RNA (siRNA) and small nuclear RNA (snRNA).

[0144] The mRNA may be mRNA associated with viral infection or survival, mRNA associated with metabolic diseases (e.g., liver disease), mRNA associated with tumorigenesis or cell transformation, immunomodulatory mRNA, or mRNA associated with inflammation or autoimmunity, etc. Alternatively, the mRNA is mRNA for treating or preventing any one of cancer, tumors (especially malignant tumors), liver disease, hepatitis, diabetes, gout, rheumatism, rheumatoid arthritis, Alzheimer's disease, and cardiovascular disease.

[0145] In a specific embodiment, the mRNA is luci-mRNA, GFP-mRNA, S protein mRNA of the new coronavirus variant or H1N1 NAmRNA, antigen mRNA of human papillomavirus (HPV) or CTA protein mRNA.

[0146] In the present invention, the type of encapsulated bioactive agent has negligible effect on the particle size, PDI and hardness of lipid nanoparticles.

[0147] use

[0148] Lipid nanoparticles are used in preparing pharmaceutical compositions for preventing or treating infectious diseases, tumors and autoimmune diseases.

[0149] The infectious disease is selected from the group consisting of: norovirus, Ebola virus, coronavirus, cytomegalovirus, dengue virus, Zika virus, coxsackie virus, enterovirus, hepatitis virus, herpes simplex virus, human papillomavirus, influenza virus, Marburg virus, measles virus, polio virus, rabies virus, rotavirus, and measles virus;

[0150] The tumor is selected from the group consisting of lung cancer, gastric cancer, rectal cancer, colon cancer, anal cancer, esophageal cancer, pancreatic cancer, skin cancer, malignant melanoma, breast cancer, bladder cancer, kidney cancer, thyroid cancer, nasopharyngeal cancer, cervical cancer, ovarian malignant tumor, central nervous system tumor, lymphoma,

[0151] The autoimmune disease is selected from the group consisting of rheumatoid arthritis, systemic lupus erythematosus, ankylosing spondylitis, Sjögren's syndrome; Hashimoto's thyroiditis, toxic diffuse goiter; autoimmune hemolytic anemia, idiopathic thrombocytopenic purpura; inflammatory bowel disease; psoriasis; glomerulonephritis, nephrotic syndrome; preferably, the inflammatory bowel disease is selected from the group consisting of ulcerative colitis and Crohn's disease.

[0152] Lipid nanoparticles are used in the preparation of pharmaceutical compositions for preventing or treating cancer, tumors (especially malignant tumors), liver diseases (such as fatty liver), hepatitis, diabetes, gout, rheumatism, rheumatoid arthritis, Alzheimer's disease, and cardiovascular diseases.

[0153] The lipid nanoparticles of the present invention are used to increase the encapsulation efficiency of bioactive agents, improve the uptake efficiency of bioactive agents by immune cells, increase the transfection efficiency of cells for bioactive agents, and enhance the enrichment of bioactive agents in lymph nodes, anti-tumor effects, and in vivo immune effects. The bioactive agent is S protein mRNA or H1N1 NA cDNA of the new coronavirus Omicron variant, antigen mRNA or CTA protein mRNA of human papillomavirus (HPV); or improve the delivery efficiency of the active ingredients luci-mRNA and EGFP-mRNA.

[0154] Example

[0155] Unless otherwise specified, the chemical reagents used in the examples are conventional commercial reagents, and the solvents do not require further treatment. The technical means used in the examples are conventional means familiar to those skilled in the art.

[0156] Unless otherwise stated, the reactions in the examples were carried out at room temperature and pressure; unless otherwise stated, all temperatures are in degrees Celsius.

[0157] Example 1: Lipid Nanoparticles

[0158] 1.1 Preparation method

[0159] S1: Preparation of lipid mixture

[0160] The following components (ionizable lipid SM-102 (purchased from Avanti), phospholipid DSPC (purchased from Avanti), pegylated lipid DMP-PEG2000 (purchased from Avanti), and sterol (selected from one of A-1 to A-3, B-1 to B-5, C-1 to C-2, D-1 to D-2, E-1 to E-3, F-1 to F-4, G-1 to G-4, and H-2 to H-3 shown in Table 1)) were dissolved and mixed in ethanol in a ratio of 50:10:1.5:38.5 (by mole) to obtain a lipid mixture. The total concentration of the above components was 10 mmol / L.

[0161] S2: Preparation of lipid nanoparticle precursors

[0162] A microfluidic chip was used to uniformly mix the lipid mixture obtained in the above step S1 as the organic phase and the active ingredient (mRNA, the specific type is described in the following examples) as the aqueous phase at a flow rate of 1:3. The total flow rate was 16 ml / min, N:P = 6:1, and the active ingredient was sodium citrate buffer (pH = 4, 10 mM) containing mRNA, and the concentration of mRNA was 0.09174 mg / ml.

[0163] Wherein, "N / P" is the molar ratio of the tertiary amine group of the cationic lipid to the phosphate unit in the nucleic acid molecule, which is obtained by the following formula:

[0164] N / P=C N / C P

[0165] C N =C1*n1*V1

[0166] C P =C 核酸 *V 核酸 / M 碱基平均

[0167] Where C1, V1, and n1 are the molar concentration, volume, and number of tertiary amine groups of the ionizable lipid, respectively;

[0168] C 核酸 is the mass concentration of nucleic acid, M 碱基平均 330g / mol, V 核酸 is the volume of nucleic acid.

[0169] S3: Preparation of lipid nanoparticles

[0170] On a nanomedicine manufacturing device (Atson MPE-L2), encapsulation was completed at room temperature, the prepared LNPs were collected, and placed in a dialysis bag (molecular weight cutoff of 100,000 Daltons) and dialyzed in sterile 1×PBS at 4°C in the dark for 20 hours. The liquid in the dialysis bag was then collected and placed in an ultrafiltration tube (specification: 10 kDa), which was placed in a centrifuge (Thermo Scientific Megafuge ST1 Plus) and centrifuged at 3000 rpm for 15 min. The sample in the ultrafiltration tube was the LNP sample of the present invention. Table 3 shows the lipid mixture components of the comparative examples A-1, H-2, and H-3 and the LNP of the present invention, as well as the molar percentage of each component, based on the molar percentage of each component being 100%.

[0171] Table 3

[0172]

[0173]

[0174] Luci-mRNA was purchased from Hefei Alfa Biotechnology Co., Ltd. (Alfa-2102)

[0175] In Example 1, the active ingredient mRNA is luci-mRNA, and its open reading frame sequence SEQ ID NO.1 is as follows:

[0176]

[0177] 1.2 Testing of physical and chemical parameters

[0178] 1. Particle size, PDI test methods and test results:

[0179] The LNP samples prepared above were tested using a dynamic light scattering particle size analyzer (Zetasizer Nano ZS (Malvern)) with PBS buffer as the detection medium and a detection temperature of 25°C to determine the particle size and polydispersity index (PDI) of the lipid nanoparticle LNP samples. Figure 1 、 Figure 2 shown.

[0180] From the data in Table 5, it can be seen that the particle size of the LNP samples prepared in Example 1 is 60 nm to 129 nm, and the polydispersity index (PDI) is 0.1 to 0.23, indicating that the LNP particles are uniform in size and have good dispersibility.

[0181] 2. Encapsulation efficiency determination method and results:

[0182] The encapsulation efficiency reflects the degree of encapsulation of the encapsulated substance (e.g., active ingredient mRNA), and thus the amount of encapsulated mRNA. The higher the encapsulation efficiency, the more active ingredient mRNA is encapsulated in the LNP.

[0183] The determination method is as follows:

[0184] The reagents used in the assay were from the Quant-iT RiboGreen RNA kit (Thermo Fisher, R11490);

[0185] (1) Pretreatment for total amount measurement: 20 μL (test solution) + 20 μL (RNase-free Triton-X100) + 960 μL (DEPC water) were mixed and blown evenly. Let it stand at room temperature for 1 hour. It is normal to produce a large number of small bubbles during the blowing process.

[0186] (2) Pretreatment for extraparticle content measurement: 40 μL (test solution) + 360 μL (DEPC water);

[0187] (3) Standard curve: Dilute the standard (100 μg / mL) in the above kit to 2 μg / mL. Specifically, take 4 μL (standard) and mix it with 196 μL (1×TE) to obtain a stock solution of the standard. Then, take 100 μL, 50 μL, 10 μL, 2 μL, and 0 μL of the stock solution of the standard, respectively, and add them to an opaque black 96-well plate. Wells with less than 100 μL are filled to 100 μL with 1×TE (Tris-EDTA buffer).

[0188] (4) Add the sample obtained by the treatment of step (1) or (2) to an opaque black 96-well plate at 100 μL / well, and blow it evenly again before adding the sample (at least 3 parallel wells, and protect from light throughout the process);

[0189] (5) Dye preparation and use: Dilute the dye stock solution in the kit 200-fold with 1×TE to the working concentration, then add 100 μL of dye per well to the 96-well plate prepared in steps (3) and (4) above, and detect after 8-10 minutes;

[0190] (6) Detection: Fluorescence intensity at the emission wavelength was measured using a microplate reader (SpectraMax iD5) by FL fluorescence detection (excitation 480 nm, emission 520 nm);

[0191] (7) Data processing: Plot the relationship between the fluorescence intensity of each well in step (3) and the corresponding standard concentration, which is the standard curve;

[0192] According to the fluorescence intensity of the sample obtained by the treatment of step (1) in the determination step (4), the corresponding concentration × 50 (dilution factor) is obtained from the standard curve, which is the total RNA concentration (C in the following formula RNA-LNP溶液体系中全部RNA );

[0193] According to the fluorescence intensity of the sample obtained by the treatment in step (2) in the determination step (4), the corresponding concentration × 10 (dilution factor) is obtained from the standard curve, which is the free RNA concentration (C in the following formula 游离RNA ).

[0194] The solution to be tested is the LNP sample obtained by the above preparation method 1.1.

[0195] The encapsulation efficiency was calculated by the following formula:

[0196]

[0197] Depend on Figure 3 As shown in Table 5, the encapsulation efficiency of the LNP sample prepared in Example 1 is 80-90%, and the encapsulation efficiency is excellent.

[0198] 3. LNP hardness test and results:

[0199] LNP hardness was characterized using an atomic force microscope (JPK Instruments AG, Berlin, Germany, model JPK Nanowizard 3). The LNP sample obtained by the above preparation method was dispersed in deionized water and then applied to a mica or silicon wafer. The mica or silicon wafer was placed under a cantilever beam and an external force of 0.5 N was applied for measurement. The measurement unit is Young's modulus (MPa), which is used to characterize the LNP hardness.

[0200] like Figure 4 As shown in Table 5, the hardness of the LNP of the present invention is 28-99 MPa. The hardness of the LNP can be effectively adjusted by introducing alkyl or alkenyl substituents into the tail T portion of the sterol compound of formula (I-1) or adjusting the degree of unsaturation and the position of the olefinic bond.

[0201] Application Examples

[0202] Preparation of the preparation: Unless otherwise stated, in the application examples of the present invention, the LNP preparations administered were prepared by diluting the LNP samples with culture medium or 1x PBS (purchased from Zhongshan Jinqiao, catalog number: ZLI-9063). In the cell experiments measured in vitro, RPMI 1640 culture medium was used for dilution so that the concentration of the active substance mRNA was 1 μg / ml. In the animal experiments measured in vivo, 1x PBS was used for dilution to obtain the following LNP preparations: for Examples 4, 5 and 13, the LNP preparations prepared after dilution contained 40 μg / ml DiD; for Examples 6 and 12, the LNP preparations prepared after dilution contained 40 μg / ml active substance mRNA; for Examples 7, 8, 9 and 10, the LNP preparations prepared after dilution contained 200 μg / ml active substance mRNA; for Example 11, the LNP preparations prepared after dilution contained 50 μg / ml active substance mRNA.

[0203] Cell culture medium: RPMI 1640 medium Manufacturer: Gibco Catalog number: 11875176

[0204] In vitro assay

[0205] Example 2: Determination of in vitro uptake efficiency of LNPs encapsulating luci-mRNA

[0206] Test method (uptake efficiency was determined by flow cytometry):

[0207] 1. 200,000 DC2.4 cells (purchased from ATCC) were seeded per well of a 24-well plate. After 24 hours, a sample LNP formulation containing an equal amount of DiD label (50 ng, DiD is a lipophilic dialkyl carbocyanine dye purchased from Beyotime) was added.

[0208] The preparation process of the DiD-labeled sample LNPs was similar to that described in step 1.1 of Example 1, except that in step S1, after preparing a 10 mmol / L lipid mixture, the lipid mixture was mixed with DiD dye at a mass ratio of 400:1 (total lipid mass: DiD dye mass). The amount of DiD contained in the resulting DiD-labeled sample LNPs was determined by fluorescence quantification (excitation 640 nm, emission 680 nm).

[0209] 2. Incubate in a 5% CO2, 37°C constant temperature incubator for 1 hour;

[0210] 3. After the incubation, the cells were blown off directly and collected in a 1.5 mL EP tube. The cells were centrifuged at 3000 rpm and 4°C for 5 min in a refrigerated high-speed centrifuge.

[0211] 4. Remove the supernatant and add 200 μl 1× PBS (purchased from Solebol, containing potassium dihydrogen phosphate, disodium hydrogen phosphate, sodium chloride, and potassium chloride) to resuspend the cells;

[0212] 5. Adjust the flow cytometer (manufacturer: BECKMAN, model: CytoFLEX), specify the number of cells to be collected (allevents: 10,000), load the sample for detection, and measure the average fluorescence intensity of positive cells.

[0213] Figure 4 Table 5 shows the hardness of LNP of Comparative Examples A-1, H-2, H-3 and Examples. Figure 5 Table 7 shows the uptake effect of LNPs of Comparative Examples A-1, H-2, H-3 and Examples by DC2.4 cells. It can be seen that compared with the LNPs of Comparative Example A-1 with a lower hardness and the LNPs of Comparative Examples H-2 and H-3 with a higher hardness, the uptake effect of the LNPs of the Examples of the present invention is improved, and the hardness thereof is in the range of 28 to 103, especially the LNPs with a hardness of 45 to 89 (Examples F-1, F-4, G-2, G-1, G-4, F-2, F-3, B-2, A-3, E-3, B-3, D-1, D-2, C-2, A-2, Figure 5 The uptake effect (from F-1 to A-2) shown on the abscissa is significantly improved; among them, the LNPs of Examples A-3, E-3, B-3, D-1, and D-2 have the best uptake effect, with hardness ranging from 73 to 81. This shows that the increased hardness of LNPs imparted by modifying the sterol structure (mainly by introducing substituents into the tail T portion and adjusting the unsaturation and double bond position of the sterol) facilitates LNP entry into cells within a certain range.

[0214] Example 3: Determination of in vitro expression of LNPs encapsulating EGFP-mRNA

[0215] Test method:

[0216] 1. Seed 200,000 DC2.4 cells per well in a 24-well plate and transfect after 24 hours;

[0217] 2. Add the corresponding amount of LNP preparation encapsulating EGFP mRNA according to 0.5 μg of EGFP mRNA per well;

[0218] 3. After incubation in a 5% CO2, 37°C constant temperature incubator for 18 hours, the transfection efficiency was determined by flow cytometry.

[0219] 4. After the culture is completed, the cells were blown off directly and collected in a 1.5 mL EP tube. Centrifuge in a refrigerated high-speed centrifuge at 3000 rpm and 4°C for 5 min.

[0220] 5. Remove the supernatant and add 200 μl 1× PBS to resuspend the cells.

[0221] 5. Adjust the flow cytometer to determine the number of cells to be collected (all events: 10,000), load the sample for detection, and measure the mean fluorescence intensity of positive cells.

[0222] The LNP sample was prepared in a similar manner to that of Example 1, except that the active ingredient mRNA was EGFP-mRNA, and its open reading frame sequence SEQ ID NO. 2 was as follows:

[0223] AUGGUGAGCAAGGGCGAGGAGCUGUUCACCGGGGUGGUGCCCAUCCUGGUCGAGCUGGACGGCGACGUAAACGGCCACAAGUUCAGCGUGUCCGGCGAGGGCGAGGGCGAUGCCACCUACGGCAAGCUGACCCUGAAGUUCAUCUGCACCACCGGCAAGCUGCCCGUGCCCUGGCCCACC CUCGUGACCACCCUGACCUACGGCGUGCAGUGCUUCAGCCGCUACCCGACCACAUGAAGCAGCACGACUUCUUCAAGUCCGCCAUGCCCGAAGGCUACGUCCAGGAGCGCACCAUCUUCUUCAAGGACGACGGCAACUACAAGACCCGCGCCGAGGUGAAGUUCGAGGGCGACACCCUG GUGAACCGCAUCGAGCUGAAGGGCAUCGACUUCAAGGAGGACGGCAACAUCCUGGGGCACAAGCUGGAGUACAACUACAACAGCCACAACGUCUAUAUCAUGGCCGACAAGCAGAAGAACGGCAUCAAGGUGAACUUCAAGAUCCGCCACAACAUCGAGGACGGCAGCGUGCAGCUCGCC GACCACUACCAGCAGAACACCCCCAUCGGCGACGGCCCCGUGCUGCUGCCCGACAACCACUACCUGAGCACCCAGUCCGCCCUGAGCAAAGACCCCAACGAGAAGCGCGAUCACAUGGUCCUGCUGGAGUUCGACCGCCGCCGGGAUCACUCUCGGCAUGGACGAGCUGUACAAGUAA

[0224] EGFP-mRNA was purchased from Hefei Alfa Biotechnology Co., Ltd. (Alfa-2201).

[0225] Figure 4 Table 5 shows the hardness of LNP of Comparative Examples A-1, H-2, H-3 and the Examples of the present invention. Figure 6 The expression efficiency of EGFP mRNA of LNPs of the comparative example and the embodiment of the present invention after transfection of DC2.4 cells is shown. Figure 7 The relationship between the hardness of LNPs of the comparative example and the embodiment of the present invention (the curve marked with circles) and the expression efficiency of EGFP mRNA after transfection of DC2.4 cells (the curve marked with squares) is shown, that is, Figure 4 and Figure 6 The graph is drawn to show the relationship between the hardness of LNP and its encapsulated EGFP-mRNA transfected DC2.4 cells. It can be seen that compared with the comparative example, the expression efficiency of the LNPs of the present invention is improved (hardness of 28 to 103), especially the LNPs with a hardness of 64 to 89 (Examples F-2, F-3, B-2, A-3, E-3, B-3, D-1, D-2, C-2, A-2, etc. Figure 6 The expression efficiency (shown on the horizontal axis) increased significantly from F-2 to A-2; among them, the LNPs of Examples A-3, E-3, B-3, D-1, and D-2 had the best expression efficiency, with hardness ranging from 73 to 81. This indicates that the increased hardness of the LNPs imparted by introducing substituents and adjusting the degree of unsaturation to produce sterols of different structures is beneficial to the mRNA expression efficiency of the LNPs after transfection into cells within a certain range.

[0226] Animal experiments

[0227] Example 4: Determination of the Lymph Node Accumulation Ability of LNPs in Vivo

[0228] Experimental animals: SPF-grade female BALB / c mice, 6-8 weeks old, weighing 18-22 g, purchased from Beijing Weitonglihua Laboratory Animal Technology Co., Ltd., production license number: SXCK (Beijing) 2016-0006. All animals were acclimated for at least 7 days before the experiment and had free access to food and water during the experiment. The experimental period was 12 / 12 h light / dark cycle, the room temperature was 20-26°C, and the humidity was 40-70%.

[0229] Experimental Methods: Female BALB / c mice were administered an equal amount of DiD-labeled sample LNP formulation (the sample LNP described in Example 2 above) via intramuscular injection (into the tibialis anterior muscle of the mouse hind leg) at a dose of 2 μg of DiD per mouse. Twelve hours after administration, chemiluminescence analysis of the accumulation of fluorescently labeled LNPs in draining lymph nodes was performed using a small animal in vivo imaging system. At 12 hours, the mice were sacrificed, and their draining lymph nodes were removed and placed in an instrument (In Vivo Imaging system, model Xenogen IVIS Spectrum, Perkin Elmer). The parameters were set (fluorescence mode, automatic exposure time, excitation wavelength of 640 nm, and emission wavelength of 680 nm) to measure the accumulation of LNPs in draining lymph nodes.

[0230] Figure 4 Table 5 shows the hardness of LNP of Comparative Examples A-1, H-2 and H-3 and the Examples of the present invention, Figure 8The fluorescence intensity of the LNPs of the comparative example and the embodiment of the present invention in the draining lymph nodes is shown. It can be seen that compared with the comparative example, the enrichment degree of the LNPs of the embodiment of the present invention in the draining lymph nodes is improved (hardness is 28 to 103), especially the LNPs with a hardness of 45 to 89 (Examples F-1, F-4, G-2, G-1, G-4, F-2, F-3, B-2, A-3, E-3, B-3, D-1, D-2, C-2, A-2, as shown in FIG. Figure 8 The enrichment level in the draining lymph nodes (from F-1 to A-2) shown on the abscissa significantly increased; among them, the LNPs of Examples A-3, E-3, B-3, D-1, and D-2 showed the best enrichment in the draining lymph nodes, with hardness ranging from 73 to 81. This indicates that the increased hardness imparted by sterols of different structures is beneficial to the enrichment of LNPs in the draining lymph nodes within a certain range.

[0231] Example 5: Determination of LNP uptake capacity by DCs in vivo

[0232] Female BALB / c mice were administered an equal amount of DiD-labeled sample LNP formulation (sample LNP as described in Example 2 above) via intramuscular injection (into the tibialis anterior muscle of the mouse hind leg) at a dose of 2 μg DiD per mouse. Chemiluminescence detection of the enrichment of fluorescently labeled LNP in the draining lymph nodes was performed using a small animal in vivo imaging system 12 hours after administration. At 12 hours, the mice were sacrificed, and their draining lymph nodes were removed and ground. 0.2 ml of 1× PBS was then added to each draining lymph node to prepare a single-cell suspension. Flow cytometry (flow rate: 30 μL / min) was used to determine the percentage of positive dendritic cells (DCs) (DCs that took up LNPs) in vivo, based on the total number of DC cells.

[0233] Figure 4 Table 5 shows the hardness of LNP of Comparative Examples A-1, H-2, H-3 and the Examples of the present invention. Figure 9 The figure shows the percentage of positive DCs in the draining lymph nodes after intramuscular injection of the LNPs of the comparative examples and the embodiments of the present invention, that is, the percentage of dendritic cells that have taken up LNPs. It can be seen that compared with the comparative examples, the percentage of positive DCs in the draining lymph nodes of the LNPs of the embodiments of the present invention is improved (hardness is 28 to 103), especially the LNPs with a hardness of 64 to 89 (Examples F-2, F-3, B-2, A-3, E-3, B-3, D-1, D-2, C-2, A-2, as shown in FIG. Figure 9The percentage of positive DCs in the draining lymph nodes (from F-2 to A-2) produced by the LNPs shown on the abscissa significantly increased; among them, the LNPs of Examples A-3, E-3, B-3, D-1, D-2, and C-2 produced the highest percentage of positive DCs in the draining lymph nodes, with hardness ranging from 73 to 86. This indicates that the increased hardness of the LNPs imparted by sterols of different structures is beneficial to improving the uptake of LNPs by dendritic cells within a certain range.

[0234] Example 6: Determination of mRNA delivery capacity of LNPs containing different types of ionizable lipids and sterols in draining lymph nodes after intramuscular injection

[0235] The ionizable lipids used in the experiment are shown in Table 2.

[0236] LNP samples encapsulating luci mRNA were prepared according to the method of Example 2 above, wherein the ionizable lipids used were the specific compounds shown in Table 2. For the LNP series with the same ionizable lipids, the only difference was that they contained different sterols as shown in Table 1. For female BALB / c mice, the LNP formulation encapsulating lucimRNA was administered by intramuscular injection (into the tibialis anterior muscle of the mouse hind leg), and the injection dose was such that each mouse was injected with 2 μg of luci mRNA. 24 hours after administration, bioluminescence detection was performed using a small animal in vivo imaging system. At 24 hours, the mice were sacrificed, and their draining lymph nodes were removed and placed in an instrument (named In Vivo Imaging system, model Xenogen IVIS Spectrum, manufacturer Perkin Elmer). The parameters were set (bioluminescence mode was selected and exposure time was selected as automatic) to measure the expression level of LNP-encapsulated luci-mRNA in the draining lymph nodes.

[0237] Here, a series of LNPs obtained by combining the same ionizable lipid with different sterols shown in Table 1 are named as ionizable lipid-LNP series, such as SM102-LNP series. Figure 10The expression levels of luci-mRNA in the draining lymph nodes of 6 series of LNPs (SM102-LNP series, Lipid9-LNP series, ALC0315-LNP series, (D-Lin-MC6-DMA)-LNP series, (CKK-E12)-LNP series, (OF-Deg-Lin)-LNP series) after intramuscular injection are shown. It can be seen that the trends of luci-mRNA expression in the draining lymph nodes of each series of LNPs are similar. Specifically, compared with Comparative Examples A-1, H-2, and H-3, the expression levels of luci-mRNA produced by the LNPs of the embodiments of the present invention are all improved. This shows that in the LNPs of the present invention, the ionizable lipids used are not particularly limited and can achieve the purpose of the present invention. Further, the expression levels of luci-mRNA produced by these 6 series of LNPs are compared, and the expression level of luci-mRNA produced by the SM102-LNP series is the highest, which is better than the other 5 series of LNPs.

[0238] Example 7: Immunogenicity Study of LNPs Encapsulating S Protein mRNA

[0239] The LNP sample encapsulating S protein mRNA was obtained according to the preparation method of Example 1, except that the active ingredient was the S protein mRNA of the new coronavirus Omicron variant (purchased from Hefei Alfa Biotechnology Co., Ltd. (Alfa-0128)), and the components of the lipid mixture: sterols, ionizable lipids, phospholipids, and polyethylene glycol-lipids are shown in Table 3.

[0240] The LNP sample containing S protein mRNA was used in an immunization study in BALB / c mice. 6-8 week old female BALB / c mice (nine mice per group) were administered intramuscularly twice, on Day 0 and Day 14, with 10 μg of the S protein mRNA-containing LNP formulation (50 μL injection volume). Fourteen days after the second immunization, S protein-specific IgG antibodies were detected by indirect ELISA, and IgG binding titers were calculated by fitting a dose-response curve.

[0241] The S protein cDNA is shown in SEQ ID NO.3:

[0242]

[0243] Figure 4 Table 5 shows the hardness of LNP of Comparative Example A-1 and the embodiment of the present invention, Figure 11 Table 7 shows the IgG antibody binding antibody titer after intramuscular injection of the LNP containing S protein mRNA prepared above. Figure 11 As shown in Table 7, compared with the comparative examples, the LNPs of the embodiments of the present invention can improve the IgG antibody binding antibody titer (hardness of 28 to 99), especially for LNPs with a hardness of 71 to 89 (Examples B-2, A-3, E-3, B-3, D-1, D-2, C-2, A-2, Figure 11 As shown on the horizontal axis, from B-2 to A-2, IgG antibody binding titers were significantly increased. Among them, the LNPs of Examples E-3, B-3, D-1, and D-2 had the best IgG antibody binding titers, with hardness ranging from 76 to 81. This shows that the increased hardness of LNPs imparted by sterols of different structures is beneficial to increasing IgG antibody binding titers within a certain range.

[0244] Example 8: Aerosol Inhalation of LNPs Encapsulating Influenza Virus H1N1 mRNA Vaccine for Prevention of Influenza Virus H1N1 Infection

[0245] LNPs encapsulating influenza virus H1N1 mRNA vaccine were obtained according to the preparation method of Example 1, except that the active ingredient encoding influenza virus H1N1 NA mRNA (purchased from Hefei Alfa Biotechnology Co., Ltd. (Alfa-0608)) was used, and the components of the lipid mixture: sterols, ionizable lipids, phospholipids, and polyethylene glycol-lipids are shown in Table 3.

[0246] Mice were placed in a nose-only exposure system constructed from a transparent PVC container and an animal restraint. The custom nose-only exposure system was connected using a custom 3D-printed nose cone made of flexible thermoplastic polyurethane material, and the nebulizer was then placed on the port. After each drop of nebulization, the port was checked until the vaporized dose disappeared (approximately 15-45 seconds per drop), and then the droplet addition continued. LNP formulations containing H1N1 NA mRNA were administered by nebulization as described above, at a dose such that each mouse received 20 μg of H1N1 mRNA (100 μl volume). After the last drop of water mist dissipated, the mice were removed from the restraint. Nasal nebulization was performed once according to the above steps on days 3 and 2 before infection. Control mice were mock-administered with an equal amount of PBS. Mice were anesthetized with isoflurane and infected with 1.5×LD50 of influenza A PR8. Survival curves were continued until 20 days after infection.

[0247] The H1N1 NA cDNA sequence SEQ ID NO. 4 is shown below:

[0248]

[0249] Figure 4 Table 5 shows the hardness of LNP of Comparative Example A-1 and the embodiment of the present invention, Figure 12 Table 7 shows the survival rate of mice after immunization with different LNPs containing influenza virus H1N1 NA mRNA vaccine prepared above. It can be seen that compared with Comparative Example A-1, the LNPs of the present invention improved the survival rate of mice (hardness of 28 to 99), especially the LNPs with a hardness of 71 to 89 (Examples B-2, A-3, E-3, B-3, D-1, D-2, C-2, A-2, etc. Figure 12 The results (shown on the horizontal axis, from B-2 to A-2) significantly improved the survival rate of mice; the LNPs of Examples A-3, E-3, B-3, D-1, and D-2 showed the most excellent effects, with hardness ranging from 73 to 81. This demonstrates that the increased hardness of the LNPs imparted by the sterols of different structures is beneficial for improving the immunity and survival rate of mice within a certain range.

[0250] Example 9: LNPs encapsulating HPV mRNA for tumor treatment

[0251] HPV mRNA-encapsulated LNPs were prepared according to the preparation method of Example 1, except that the active ingredient was human papillomavirus (HPV) antigen mRNA (purchased from Hefei Alfa Biotechnology Co., Ltd. (Alfa-0310)). The components of the lipid mixture: sterols, ionizable lipids, phospholipids, and polyethylene glycol-lipids are shown in Table 3.

[0252] The obtained different LNPs were used for C57BL / 6 mouse immunization test. The specific operation was as follows: 8-10 week old SPF grade C57BL / 6 female mice (purchased from Weitonglihua) were inoculated on the back for 10 5 HPV antigen-positive tumor cells were then subcutaneously injected with different LNP formulations encapsulating LNP-HPV mRNA vaccines on days 4, 7, and 13 after tumor cell inoculation. The injection dose was such that each mouse was injected with 10 μg LNP-HPV mRNA. The mice were sacrificed on day 20 to detect the tumor volume and the proportion of IFN-γ-positive CD8 T cells in the tumor.

[0253] HPV cDNA is shown in SEQ ID NO.5:

[0254]

[0255] Figure 4 Table 5 shows the hardness of LNP of Comparative Example A-1 and the embodiment of the present invention, Figure 13 Table 7 shows the tumor volume in mice after administration of different LNPs encapsulating HPV mRNA. It can be seen that compared with Comparative Example A-1, the LNPs of the present invention have improved ability to inhibit tumor growth (hardness of 28 to 99), especially the LNPs with a hardness of 45 to 89 (Examples F-1, F-4, G-2, G-1, G-4, F-2, F-3, B-2, A-3, E-3, B-3, D-1, D-2, C-2, A-2, Figure 13 The ability to inhibit tumor growth is significantly enhanced (as shown on the horizontal axis, from F-1 to A-2); among them, the LNPs of Examples F-3, B-2, A-3, E-3, B-3, D-1, and D-2 exhibit the most excellent inhibitory effects, with hardness ranging from 66 to 81. This demonstrates that the increased hardness of the LNPs imparted by the use of sterols of different structures is beneficial for improving the therapeutic properties of anti-tumor vaccines and enhancing their anti-tumor activity within a certain range.

[0256] Figure 14 The proportion of IFN-γ-positive CD8 T cells in the tumor is shown in mice given different LNPs encapsulating HPV mRNA. IFN-γ is a cytokine that spleen cells can efficiently produce after stimulation with HPV antigen-derived peptides, which indicates that vaccine immunity induces HPV antigen-specific cellular immune responses. It can be seen that compared with Comparative Example A-1, the proportion of positive CD8 T cells produced by the LNPs of the embodiments of the present invention is increased (hardness of 28 to 103), especially the LNPs with a hardness of 45 to 89 (Examples F-1, F-4, G-2, G-1, G-4, F-2, F-3, B-2, A-3, E-3, B-3, D-1, D-2, C-2, A-2, as shown in Figure 2). Figure 14 The ratio of positive CD8 T cells generated (as shown in the horizontal axis from F-1 to A-2) increased significantly; among them, the LNPs of Examples F-3, B-2, A-3, E-3, B-3, D-1, and D-2 had the best effect, with hardness ranging from 66 to 81. This shows that the increased hardness of LNPs imparted by sterols of different structures is beneficial to improving the immune response of vaccines within a certain range.

[0257] Example 10: LNPs encapsulating CTA protein mRNA for the treatment of fatty liver

[0258] LNPs encapsulating CTA protein mRNA were obtained according to the preparation method of Example 1, except that CTA protein mRNA (purchased from Hefei Alfa Biotechnology Co., Ltd. (Alfa-0902)) was used as the active ingredient, and the components of the lipid mixture: sterols, ionizable lipids, phospholipids, and polyethylene glycol-lipids are shown in Table 3.

[0259] C57 male mice were fed a 45% high-fat diet (purchased from Weitonglihua) at the age of 4 weeks to establish a HFD model, which lasted for 16 weeks, and the weight changes of the mice were monitored. On day 0, intravenous injection of the LNP preparation encapsulating CTA protein mRNA prepared above was started, and the injection dose was such that each mouse was intravenously injected with 20 μg of CTA protein mRNA. The injection was performed once every two days for a total of 5 times, and the weight changes of the mice were recorded. After the treatment experiment, the mice were sacrificed. The blood, heart, liver, spleen, lungs, and kidneys of the mice were collected. The AST and ALT indicators of the mouse serum were detected. The liver was taken to detect the triglyceride and cholesterol content of the mouse liver.

[0260] The CTA protein cDNA is shown in SEQ ID NO.6:

[0261]

[0262] Figure 15 、 16 , 17, and 18 respectively show the levels of AST and ALT in the serum and the levels of triglycerides and cholesterol in the liver of mice that were intravenously injected with LNPs encapsulating CTA protein mRNA. Among them, the lower the levels of AST, ALT, triglycerides, and cholesterol, the better the therapeutic effect. It can be seen that compared with Comparative Example A-1, the therapeutic effect of the LNPs of the embodiments of the present invention on the liver is improved (hardness of 28 to 99), especially the LNPs with a hardness of 71 to 89 (Examples B-2, A-3, E-3, B-3, D-1, D-2, C-2, A-2, Figures 15 to 18 The therapeutic effect on the liver is significantly improved (as shown on the horizontal axis from B-2 to A-2); among them, the LNPs of Examples E-3, B-3, D-1, and D-2 have the best uptake effect, with hardness ranging from 76 to 81. This shows that the increased hardness of LNPs imparted by sterols of different structures is beneficial to improving the therapeutic effect of mRNA therapeutics on fatty liver within a certain range.

[0263] Example 11: LNPs encapsulating mRNA of long-acting IL-2 mutant proteins for the treatment of autoimmune diseases

[0264] Test method:

[0265] LNPs encapsulating long-acting IL-2 mutant protein mRNA were obtained according to the preparation method of Example 1, except that the active ingredient was long-acting IL-2 mutant protein mRNA (purchased from Hefei Alfa Biotechnology Co., Ltd. (Alfa-0405)). The components of the lipid mixture: sterols, ionizable lipids, phospholipids, and polyethylene glycol-lipids are shown in Table 3.

[0266] Model establishment steps: C57BL / 6 female mice were subcutaneously injected with 100 μg of MOG35-55 peptide (absin) emulsified in CFA (Thermo Scientific) and 30 mg of M. tuberculosis H37Ra (BD). In addition, the mice were intraperitoneally injected with 0.01 mg / kg pertussis toxin (Sigma), and then again with 0.01 mg / kg pertussis toxin (Sigma) 2 days later.

[0267] On days -3, 0, 3, and 6, the LNP formulation encapsulating the long-acting IL-2 mutein mRNA prepared above was injected intravenously at a dose of 5 μg per mouse, where day 0 refers to the day the model was established. On day 18 after immunization (day -3 above), the spleen, inguinal lymph nodes, and spinal cord were isolated and the proportion of Treg cells was measured.

[0268] The long-acting IL-2 mutant protein cDNA is shown in SEQ ID NO.7:

[0269] ATGTACAGCATGCAGCTCGCATCCTGTGTCACATTGACACTTGTGCTCCTTGTCAACAGCGCACCCACTTCAAGTCCCACTTCAAGCTCTACAGCGGAAGCACAGCAGCAGCAGCAGCAGCAGCAGC AGCAGCAGCAGCACCTGGAGCAGCTGTTGATGGACCTACAGGAGCTCCTGAGCAGGATGGAGAATTACAGGAACCTGAAACTCCCCAGGATGCTCACCTTCAAATTTTACTTGCCCAAGCAGGCCACA GAATTGAAAGATCTTCAGTGCCTAGAAGATGAACTTGGACCTCTGCGGCATGTTCTGGATTTGACTCAAAGCAAAAGCTTTCAATTGGAAGATGCTGAGAATTTCATCAGCAATATCAGAGTAACTG TTGTAAAACTAAAGGGCTCTGACAACACATTTGAGTGCCAATTCGATGATGAGTCAGCAACTGTGGTGGACTTTCTGAGGAGATGGATAGCCTTCTGTCAAAGCATCATCTCAACAAGCCCTCAATAA

[0270] Figure 19 、 Figure 20 、 Figure 21The ratio of Treg cells to CD4+T cells in the lymph nodes, spleen and spinal cord of mice to which different LNPs encapsulating long-acting IL-2 mutant protein mRNA were injected is shown respectively. The higher the ratio of Treg cells to CD4+T cells, the better the therapeutic effect of autoimmune diseases. It can be seen that compared with Comparative Example A-1, the therapeutic effects produced by the LNPs of the embodiments of the present invention are all improved (hardness of 28 to 103), especially the LNPs with a hardness of 45 to 89 (Examples F-1, F-4, G-2, G-1, G-4, F-2, F-3, B-2, A-3, E-3, B-3, D-1, D-2, C-2, A-2, as shown in Figure 2). Figures 19 to 21 The therapeutic effect (as shown in the horizontal axis from F-1 to A-2) is significantly improved; among them, the LNPs of Examples F-3, B-2, A-3, E-3, B-3, D-1, and D-2 have the best therapeutic effects, with hardness ranging from 66 to 81. This shows that the increased hardness of LNPs imparted by sterols of different structures is beneficial to improving the therapeutic effect of mRNA therapeutics for autoimmune diseases within a certain range.

[0271] Example 12: Determination of the in vivo mRNA delivery capacity of LNPs containing different phospholipids and sterols

[0272] The phospholipids used in the experiment are shown in Table 4.

[0273]

[0274]

[0275] LNP samples were prepared according to the method of Example 1 above, wherein different combinations of sterols and phospholipids contained therein are shown in Table 6, the specific structures of sterols are listed in Table 1, and the specific structures of phospholipids are listed in Table 4 (number i-4 is DSPC described herein).

[0276] For female BALB / c mice, an equal amount of DiD-labeled sample LNP preparation prepared in Example 2 was administered intramuscularly (into the tibialis anterior muscle of the mouse hind leg). The dose injected was such that each mouse was injected with 2 μg of luci-mRNA. 24 hours after administration, bioluminescence detection was performed using a small animal in vivo imaging system. At 24 hours, the mice were sacrificed, and their draining lymph nodes were removed and placed in an instrument (named In Vivo Imaging system, model Xenogen IVIS Spectrum, manufacturer PerkinElmer). The parameters were set (bioluminescence mode was selected, and exposure time was selected as automatic) to measure the expression level of LNP-encapsulated luci-mRNA in the draining lymph nodes.

[0277] Here, a series of LNPs obtained by combining the same sterol with different phospholipids shown in Table 4 are named sterol-LNP series, for example, the A1-LNP series (sterol A1 is cholesterol, F1 is cactasterol, F2 is spinasterol, D2 is dehydroergosterol, and C1 is spongasterol, and the specific structures are shown in Table 1).

[0278] Figure 22 5 series of LNPs (A1-LNP series, F1-LNP, F2-LNP, D2-LNP, C1-LNP series) are shown after intramuscular injection, in the draining lymph nodes, luci-mRNA expression. It can be seen that compared with the comparative example A1-LNP series, the expression of luci-mRNA produced by the LNPs of the remaining 4 series is larger; compared with the LNPs in the same series, that is, when using the same sterol and different phospholipids, as the fatty chain length of the phospholipid increases, the hardness of the LNP increases therewith, and the luci-mRNA expression increases. Thus it is shown that by the interaction of phospholipids and sterols, the hardness of lipid nanoparticles (as shown in Table 6) can be regulated, thereby effectively improving the expression of therapeutic agents such as mRNA encapsulated by LNPs.

[0279] Example 13

[0280] LNP samples were prepared according to the method of Example 1, wherein the components of the lipid mixture: sterol, ionizable lipid, phospholipid, polyethylene glycol-lipid were as shown in Table 8, and the molar ratio of sterol to phospholipid was changed.

[0281] The LNP samples were tested according to the method of Example 4. The results are shown in Table 8.

[0282]

[0283]

[0284]

[0285]

[0286]

[0287] In summary, the embodiments of the present invention demonstrate that LNPs containing bioactive agent mRNA have improved delivery efficiency and disease prevention and treatment effects when their hardness is 28 to 105; the hardness of the LNP is preferably 71 to 89, more preferably 73 to 83.

[0288] The hardness of LNP is achieved by using sterols with specific structures (for example, introducing an alkyl or alkenyl substituent at the T tail of the sterol structure of formula (I-1) or adjusting the unsaturation or position of the double bond of the sterol). Furthermore, the hardness of LNP can be further optimized by using a combination of specific phospholipids and sterols, thereby further improving the delivery efficiency of LNP and the effect of preventing and treating diseases.

[0289] It should be noted that the present application is not limited to the above-mentioned embodiments. The above-mentioned embodiments are merely examples, and any embodiments having substantially the same structure and effect as the technical concept within the scope of the present application are all included in the technical scope of the present application. In addition, without departing from the scope of the present application, any other embodiments that can be conceived by those skilled in the art and that combine some of the constituent elements in the embodiments are also included in the scope of the present application.

Claims

1. A lipid nanoparticle comprising: an ionizable lipid, a phospholipid, a polyethylene glycol-lipid, and a sterol; in, The sterol has the following structure: Wherein, R1, R2, R3 are the same or different, each independently H or C1-C4 alkyl, and where R1, R2 and R3 are all methyl, the T part is 1,5-dimethylhexyl The tilde represents the attachment point of this moiety to the rest of the formula (I), Ring A is a saturated cyclohexyl group, and ring D is a saturated cyclopentyl group. Ring B and Ring C are independently saturated or unsaturated cyclohexyl groups, wherein the unsaturated cyclohexyl groups each independently contain 1, 2 or 3 double bonds; The T portion is a C4-C8 alkyl group or a C4-C8 alkenyl group; the C4-C8 alkyl group or the C4-C8 alkenyl group is optionally substituted by one or more identical or different substituents selected from the following: the substituents are C1-C4 alkyl group, C1-C4 alkylene group, or C2-C4 alkenyl group; Wherein, under the condition that the T portion is 1,5-dimethylhexyl, the A ring, the B ring and the C ring are saturated cyclohexyl and the D ring is a saturated cyclopentyl, or at least one of R1 and R2 is a C1-C4 alkyl group; The hardness of the lipid nanoparticles is 28 to 105 MPa, preferably 40 to 90 MPa, and more preferably 60 to 85 MPa.

2. The lipid nanoparticle according to claim 1, wherein in the formula (I) of the sterol, Ring B is an unsaturated cyclohexyl group having 1 or 2 double bonds, wherein the 2 double bonds are preferably conjugated double bonds; Ring C is an unsaturated cyclohexyl group having 1 or 2 double bonds, wherein the 2 double bonds are preferably conjugated double bonds; or The B ring and the C ring may share a double bond, or the double bonds of the B ring and the C ring may be conjugated double bonds.

3. The lipid nanoparticle according to claim 2, wherein the sterol is of the following formula (I-1): in, The numbers 1 to 27 represent the numbers of carbon atoms; R1, R2, and R3 are the same or different and are each independently H or methyl; Ring A, Ring B, Ring C and Ring D together form a condensed hydrocarbon ring, the condensed positions of which are carbon atoms numbered 5, 10, 8, 9, 13 and 14; wherein Ring A is a saturated cyclohexyl group, Ring D is a saturated cyclopentyl group, Ring B and Ring C are independently saturated or unsaturated cyclohexyl; Optionally, when the B ring or the C ring is an unsaturated cyclohexyl group, it contains 1, 2 or 3 double bonds, and the double bonds exist in at least one of the following positions: between two adjacent carbon atoms numbered 8 and 9, between two adjacent carbon atoms numbered 5 and 6, between two adjacent carbon atoms numbered 7 and 8, and between two adjacent carbon atoms numbered 9 and 11; in particular, when it contains 2 or 3 double bonds, the double bonds are conjugated double bonds; The T portion is a portion consisting of carbon atoms numbered 20 to 27 having R4, which is an alkyl or alkenyl group, in which the alkenyl group preferably has 1 or 2 double bonds, and the double bond is located between any two adjacent carbon atoms in R4 and / or carbon atoms numbered 20 to 27; preferably between two adjacent carbon atoms numbered 22 and 23, between two adjacent carbon atoms numbered 24 and 25, or between two adjacent carbon atoms numbered 25 and 26, R4 is hydrogen, methyl, ethyl, methylene (=CH2) or ethane-1,1-diyl (=CH-CH3); and, When R1, R2 and R3 are all methyl, the T part is an alkyl group of the following formula (I-2): or, Under the condition that the T part is an alkyl group of formula (I-2), the A ring, the B ring and the C ring are saturated cyclohexyl groups and the D ring is a saturated cyclopentyl group, or at least one of R1 and R2 is a methyl group, The tilde It indicates the attachment point of this moiety to the rest of the moiety of formula (I-1).

4. The lipid nanoparticle according to claim 1, wherein the sterol is selected from at least one of the following sterols: Campesterol β-Sitosterol Chain sterol Dehydrocholesterol Brassicasterol Stigmasterol Erythrostane Spongosterol Fucosterol Ergosterol Dehydroergosterol Dihydrocholesterol Campestanol Sitostanol Cactosterol Spinachsterol δ7-Avenasterenol Yeastosterol Bletilla striata Graminosterol 4-Methyl-7-enecholestanol Limonadienol Cycloartanol in, Preferred are campesterol, β-sitosterol, dehydrocholesterol, brassicasterol, fuccasterol, ergosterol, dehydroergosterol, sitostanol or δ7-avenasterol.

5. The lipid nanoparticle according to claim 1, wherein the phospholipid is of formula (II): in, R6, R7 are independently selected from C 10 -C 20 -alkyl; R8, R9, R 10 Independently of each other, they are selected from H, C1-C4 alkyl, preferably methyl or ethyl.

6. The lipid nanoparticle according to claim 5, wherein the phospholipid is selected from dilauroyl phosphatidylcholine DLPC, dimyristoyl phosphatidylcholine DMPC, dipalmitoyl phosphatidylcholine DPPC, distearoyl phosphatidylcholine DSPC, dilauroyl phosphatidylethanolamine DLPE, dimyristoyl phosphatidylethanolamine DMPE, dipalmitoyl phosphatidylethanolamine DPPE, distearoyl phosphatidylethanolamine DSPE; Preferably, the phospholipid is selected from at least one compound of the following formulae (i-1) to (i-4), (ii-1) to (ii-4):

7. The lipid nanoparticle according to claim 1, wherein the molar ratio of sterol to phospholipid is 1:1 to 10:1, preferably 1.5:1 to 8:1; optionally, the sum of the molar amounts of sterol and phospholipid accounts for 40% to 55%, based on the total molar amount of ionizable lipids, phospholipids, polyethylene glycol-lipids, and sterols as 100%.

8. The lipid nanoparticle according to claim 1, wherein the ionizable lipid comprises a cationic lipid, preferably selected from one of SM102, Lipid 9, D-Lin-MC3-DMA, ALC 0315, cKK-E12, 7C1, OF-Deg-Lin, or any combination thereof.

9. The lipid nanoparticle according to claim 1, wherein The molar ratio of the ionizable lipid, phospholipid, sterol, and polyethylene glycol-lipid is (28-40):(4-14):(15-35):1, preferably (30-35):(5-12):(20-30):

1.

10. The lipid nanoparticle according to claim 1, further encapsulating a bioactive agent, preferably, the bioactive agent is a nucleic acid, preferably mRNA; in particular, the encapsulation rate of the lipid nanoparticle encapsulating the nucleic acid is 80-99%.

11. A method for preparing the lipid nanoparticles of claim 10, comprising the steps of: S1: dissolving an ionizable lipid, a phospholipid, a polyethylene glycol-lipid and a sterol in an organic solvent to obtain a lipid mixture; S2: uniformly mixing the lipid mixture with the bioactive agent to obtain a solution of lipid nanoparticle precursor; S3: After the lipid nanoparticle precursor solution is encapsulated, the organic solvent is removed by dialysis to obtain lipid nanoparticles.

12. Use of the lipid nanoparticles according to any one of claims 1 to 10 in the preparation of a pharmaceutical composition for preventing or treating infectious diseases, fatty liver, tumors and autoimmune diseases, in particular for preparing a pharmaceutical composition for delivering a bioactive agent, preferably mRNA, to immune cells or lymph nodes.

Images