Novel GlnH protein variant and method for producing L-glutamic acid using same

Abstract

The present invention relates to a novel variant of a GlnH protein and a method for producing L-glutamic acid using the same, the variant of the GlnH protein being capable of efficiently producing L-glutamic acid from a recombinant microorganism comprising the variant by changing protein activity by replacing one or more amino acids in the amino acid sequence constituting the GlnH protein.

Description

Technical Field

[0001] The present invention relates to a novel variant of GlnH protein and a method for producing L-glutamic acid using the same. Background Art

[0002] L-glutamic acid is a representative amino acid produced by microbial fermentation. Its salt form, monosodium L-glutamate (MSG), balances and harmonizes the overall taste of food to increase the preference of meat, fish, chicken, vegetables, sauces, broths, and dressings. It can also enhance the taste of low-salt foods that reduce salt to 30%, so it is widely used as a seasoning for household and processed food production.

[0003] Simply studying the fermentation pathway of L-glutamate, glucose mainly goes through the glycolytic pathway, but a part of it is metabolized into two molecules of pyruvic acid through the pentose phosphate pathway. One of the molecules fixes CO 2 It becomes oxaloacetic acid, and another molecule combines with acetyl CoA, and pyruvate becomes citric acid. Oxaloacetic acid and citric acid enter the TCA cycle again to become α-ketoglutaric acid. Among them, due to the lack of oxidative metabolic pathways from α-ketoglutaric acid to succinic acid, and the close participation of isocitrate dehydrogenase and glutamate dehydrogenase, the reductive amino acid reaction of α-ketoglutaric acid is carried out efficiently, thereby generating L-glutamate.

[0004] The production of L-glutamic acid can utilize wild-type strains obtained in a natural state or mutants modified in a manner to improve their glutamic acid production capacity. In recent years, in order to improve the production efficiency of L-glutamic acid, microorganisms such as Escherichia coli and Corynebacterium, which are often used for the production of useful substances such as amino acids and nucleic acids, have been used as targets, and gene recombination technology has been applied to develop various recombinant strains or mutants with excellent L-glutamic acid production capacity and L-glutamic acid production methods using them. In particular, the following attempts have been made: direct mutations in genes such as enzymes, transcription factors, and transport proteins involved in the biosynthetic pathway of L-glutamic acid, or induction mutations in promoters that regulate their expression, thereby expanding the production of L-glutamic acid. However, the types of proteins such as enzymes, transcription factors, and transport proteins that are directly or indirectly related to the production of L-glutamic acid reach tens to hundreds of species, so whether the L-glutamic acid production capacity is increased according to the activity changes of such proteins, in fact, still requires a lot of research.

[0005] Prior art literature

[0006] Patent Literature

[0007] (Patent Document 1) U.S. Patent No. 6852516

[0008] (Patent Document 2) U.S. Patent No. 6962805 Summary of the invention

[0009] The object of the present invention is to provide novel GlnH protein variants.

[0010] In addition, an object of the present invention is to provide a polynucleotide encoding the above variant.

[0011] Another object of the present invention is to provide transformants other than humans comprising the above variant or polynucleotide.

[0012] Another object of the present invention is to provide a method for producing L-glutamic acid using the above transformant.

[0013] One embodiment of the present invention provides a GlnH protein variant selected from the group consisting of (1) to (3) below:

[0014] (1) a GlnH protein variant consisting of the amino acid sequence of SEQ ID NO: 4, in which the threonine 11 in the amino acid sequence of SEQ ID NO: 2 is replaced by isoleucine;

[0015] (2) a GlnH protein variant consisting of the amino acid sequence of SEQ ID NO: 6, in which the threonine at No. 165 in the amino acid sequence of SEQ ID NO: 2 is replaced with alanine; and

[0016] (3) A GlnH protein variant consisting of the amino acid sequence of SEQ ID NO: 8, in which the threonine at No. 11 in the amino acid sequence of SEQ ID NO: 2 is substituted with isoleucine and the threonine at No. 165 is substituted with alanine.

[0017] The "GlnH protein" used in the present invention is involved in substance transport as a periplasmic binding protein, and is particularly known to function as an extracellular sensor. The GlnH protein in the present invention is encoded by the glnH gene or the Cgl2750 gene, and may be a polypeptide having GlnH protein activity, but is not limited thereto.

[0018] The nucleic acid and protein sequence information of the above-mentioned GlnH protein can be obtained from known sequence databases (eg, GenBank, UniProt).

[0019] According to a specific example of the present invention, the GlnH protein may be encoded by the base sequence of SEQ ID NO:1, and may be composed of the amino acid sequence of SEQ ID NO:2.

[0020] The amino acid sequence of the GlnH protein according to the present invention or the base sequence encoding it may be composed of or necessarily contain a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% homology or identity with each sequence, and may have the original function. Here, "homology" or "identity" refers to the consistency rate (%) between the base sequence or amino acid sequence used as a reference and any other base sequence or amino acid sequence when the two sequences are aligned and analyzed in a manner that corresponds to the greatest extent.

[0021] According to one embodiment of the present invention, the GlnH protein or the gene encoding the GlnH protein may be derived from wild-type Corynebacterium glutamicum.

[0022] "Variant" used in the present invention refers to a variation in the base sequence of a gene encoding a protein, which is different from the original amino acid sequence of the protein. More specifically, the gene sequence variation is different according to the substitution, insertion, deletion, etc. of one or more bases or nucleotides in the sequence constituting the gene, and the polypeptide or protein translated thereby is a protein variant, and one or more amino acids in the N-terminus, C-terminus and / or the interior of the amino acid sequence are conservatively substituted and / or modified, thereby being different from the amino acid sequence before the variation, but maintaining the function or properties. Here, "conservative substitution" refers to replacing an amino acid with other amino acids with similar structure and / or chemical properties, which has little effect on the activity of the protein or polypeptide, or may have no effect at all. The amino acids are selected from alanine (Ala), isoleucine (Ile), valine (Val), leucine (Leu), methionine (Met), asparagine (Asn), cysteine ​​(Cys), glutamine (Gln), serine (Ser), threonine (Thr), phenylalanine (Phe), tryptophan (Trp), tyrosine (Tyr), aspartic acid (Asp), glutamic acid (Glu), arginine (Arg), histidine (His), lysine (Lys), glycine (Gly) and proline (Pro).

[0023] In addition, variants include variants in which one or more parts such as an N-terminal leader sequence or a transmembrane domain are deleted, or variants in which a part of the N- and / or C-terminus of a mature protein is deleted.

[0024] Compared with the protein before mutation, the ability of such a variant may be increased (enhanced), unchanged, or decreased (weakened). Here, "increase or enhancement" includes the following situations: the activity of the protein itself is increased compared with the protein before mutation; due to increased expression or increased translation of the gene encoding the protein, the overall enzyme activity in the cell is higher than that of the wild-type strain or the strain expressing the protein before mutation; and their combinations. In addition, "reduction or weakening" includes the following situations: the activity of the protein itself is reduced compared with the protein before mutation; due to hindering the expression of the gene encoding the protein or hindering translation, the overall enzyme activity in the cell is lower than that of the wild-type strain or the strain expressing the protein before mutation; and their combinations. In the present invention, variants can be mixed with variants, modifications, variant polypeptides, variant proteins, mutations, etc.

[0025] The GlnH protein variant according to the present invention may include an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% homology or identity with the amino acid sequence of SEQ ID NO: 4, 6 or 8, except for the variant position (amino acid residues 11 and / or 165). As long as the amino acid sequence maintains the function or characteristics of the above variant, it can be included without limitation.

[0026] Another aspect of the present invention provides a polynucleotide encoding the above-mentioned GlnH protein variant.

[0027] The "polynucleotide" used in the present invention is a polymer of nucleotides formed by long chain-like linkage of nucleotide monomers through covalent bonds, and is a DNA or RNA chain of a certain length or longer. More specifically, it refers to a polynucleotide fragment encoding the above-mentioned variant.

[0028] According to a specific example of the present invention, the polynucleotide may include a base sequence encoding an amino acid sequence of SEQ ID NO: 4, 6 or 8, for example, may include a base sequence of SEQ ID NO: 3, 5 or 7.

[0029] Another aspect of the present invention provides a vector comprising a polynucleotide encoding the above-mentioned GlnH protein variant.

[0030] Another aspect of the present invention provides a transformant comprising the above-mentioned GlnH protein variant or polynucleotide.

[0031] "Carrier (vector)" used in the present invention refers to all types of nucleic acid sequence transport structures used as a means for delivering and expressing target genes to host cells. Unless otherwise specified, the above-mentioned carrier can refer to inserting the nucleic acid sequence carried into the host cell gene for expression and / or expressing independently. Such a carrier includes the necessary regulatory elements that are operably connected in order to express the gene insert, "operably connected (operably linked)" refers to the functional combination of the target gene and its regulatory sequence with each other and connected in a manner that can carry out gene expression, and "regulatory elements" include promoters for implementing transcription, arbitrary operon sequences for regulating transcription, sequences encoding suitable mRNA ribosome binding sites, and sequences regulating the termination of transcription and translation.

[0032] The vector used in the present invention is not particularly limited as long as it can be replicated in the host cell, and any vector known in the art can be used. As an example of the above-mentioned vector, a plasmid, a cosmid, a virus and a phage in a natural state or a recombinant state can be cited. For example, as a phage vector or a cosmid vector, there are pWE15, M13, λMBL3, λMBL4, λIXII, λASHII, λAPII, λt10, λt11, Charon4A, Charon21A, etc., and as a plasmid vector, there are pBR system, pUC system, pBluescriptII system, pGEM system, pTZ system, pCL system and pET system, etc., but it is not limited thereto.

[0033] The above-mentioned vector can be representatively constructed as a vector for cloning or a vector for expression. The vector for expression can use conventional vectors used in the art for expressing foreign genes or proteins in plants, animals or microorganisms, and can be constructed by various methods well known in the art.

[0034] The "recombinant vector" used in the present invention can be constructed with prokaryotic cells or eukaryotic cells as hosts, can be replicated independently of the genome of the host cell, or can be sutured to the genome itself. The above-mentioned host cell is capable of replicating the vector and may include a replication origin as a specific base sequence for starting replication. For example, when the vector used is an expression vector and a prokaryotic cell is used as the host, it generally includes a strong promoter (e.g., pLλ promoter, CMV promoter, trp promoter, lac promoter, tac promoter, T7 promoter) that can enable transcription, a ribosome binding site for the initiation of translation, and a transcription / translation termination sequence. When eukaryotic cells are used as hosts, the replication origins initiated in the eukaryotic cells contained in the vector include f1 replication origin, SV40 replication origin, pMB1 replication origin, adenovirus replication origin, AAV replication origin, and BBV replication origin, but are not limited thereto. In addition, promoters derived from the genome of mammalian cells (e.g., metallothionein promoter) or promoters derived from mammalian viruses (e.g., adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter, tk promoter of HSV) can be used, and usually have a polyadenylation sequence as a transcription termination sequence.

[0035] The above-mentioned recombinant vector may include a selection marker, which is used to screen transformants (host cells) transformed by the vector. In the culture medium treated with the above-mentioned selection marker, only cells expressing the selection marker can survive, so transformed cells can be screened. As representative examples, the above-mentioned selection markers include ampicillin, kanamycin, streptomycin, chloramphenicol, etc., but are not limited thereto.

[0036] By inserting the recombinant vector into the host cell, a transformant can be prepared, and the transformant can be obtained by introducing the recombinant vector into a suitable host cell. The host cell is a cell that can stably and continuously clone or express the expression vector, and any host cell known in the art can also be used.

[0037] When prokaryotic cells are transformed to produce recombinant microorganisms, Escherichia coli strains such as E. coli JM109, E. coli BL21, E. coli RR1, E. coli LE392, E. coli B, E. coli X1776, E. coli W3110, and E. coli XL1-Blue; Bacillus strains such as Corynebacterium strains, Bacillus subtilis, and Bacillus thuringiensis; various enteric bacteria and strains such as Salmonella typhimurium, Serratia marcescens, and Pseudomonas strains can be used as host cells, but are not limited thereto.

[0038] When eukaryotic cells are transformed to produce recombinant microorganisms, yeast (e.g., Saccharomyces cerevisiae), insect cells, plant cells, and animal cells can be used as host cells, for example, Sp2 / 0, CHO K1, CHO DG44, PER.C6, W138, BHK, COS7, 293, HepG2, Huh7, 3T3, RIN, MDCK cell lines, etc., but are not limited to these.

[0039] As used herein, “transformation” refers to the phenomenon of introducing foreign DNA into host cells to cause artificial genetic changes, and “transformant” refers to a host cell into which foreign DNA has been introduced and in which the expression of the target gene is stably maintained.

[0040] In the above transformation, a suitable vector introduction technique is selected according to the host cell, so that the target gene or the recombinant vector containing the same can be expressed in the host cell. For example, the vector introduction can be carried out by electroporation, heat shock, calcium phosphate (CaPO 4 ) precipitation, calcium chloride (CaCl 2 ) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, lithium acetate-DMSO method, or a combination thereof, but is not limited thereto. As long as the transformed gene can be expressed in the host cell, it can be included, without being limited to being inserted into the chromosome of the host cell or being located outside the chromosome.

[0041] The transformant includes cells transfected, transformed or infected with the recombinant vector according to the present invention in vivo or in vitro, and can be used as the same term as a recombinant host cell, a recombinant cell or a recombinant microorganism.

[0042] The transformant of the present invention may not include humans.

[0043] According to one embodiment of the present invention, the transformant may be a strain of the genus Corynebacterium.

[0044] Examples of the Corynebacterium strain include Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium callunae, Corynebacterium suranareeae, Corynebacterium lubricantis, Corynebacterium doosanense, Corynebacterium efficiens, Corynebacterium uterequi, Corynebacterium stationis, Corynebacterium pacaense, Corynebacterium singulare, Corynebacterium humireducens, and Corynebacterium spp. marinum), Corynebacterium halotolerans, Corynebacterium spheniscorum, Corynebacterium freiburgense, Corynebacterium striatum, Corynebacterium canis, Corynebacterium ammoniagenes, Corynebacterium renale, Corynebacterium pollutisoli, Corynebacterium imitans, Corynebacterium caspium, Corynebacterium testudinoris, Corynebacterium seudopelargi, or Corynebacterium flavescens, but is not limited thereto.

[0045] The transformant in the present invention may be a strain comprising the above-mentioned GlnH protein variant or a polynucleotide encoding it, or a vector containing it; a strain expressing the above-mentioned GlnH protein variant or polynucleotide; or a strain having activity against the above-mentioned GlnH protein variant, but is not limited thereto.

[0046] The transformant of the present invention may include other protein variants or gene mutations in addition to the above-mentioned GlnH protein variants.

[0047] According to one embodiment of the present invention, the transformant may have the ability to produce L-glutamic acid.

[0048] The above-mentioned transformant may naturally have the ability to produce L-glutamic acid, or may be artificially endowed with the ability to produce L-glutamic acid.

[0049] According to one embodiment of the present invention, the activity of the GlnH protein variant is changed in the transformant, so that the L-glutamic acid production capacity can be improved.

[0050] As used in the present invention, "productivity is improved" means that the productivity of L-glutamic acid is increased compared to the parent strain. The parent strain refers to a wild type or mutant strain that is the object of mutation, including the object directly to be mutated or the object transformed by a recombinant vector, etc. In the present invention, the parent strain may be a wild type Corynebacterium strain without or with L-glutamic acid production ability, or a Corynebacterium strain mutated from the wild type.

[0051] The transformant according to the present invention has a GlnH protein variant introduced therein, thereby changing the activity of the GlnH protein variant and showing an increased L-glutamic acid production capacity compared to a strain containing the protein before mutation (parent strain). More specifically, the transformant may have an increased L-glutamic acid production capacity of at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% compared to the parent strain, or may have an increased L-glutamic acid production capacity of 1.1 times, 1.5 times, 2 times, 2.5 times, 3 times, 3.5 times, 4 times, 4.5 times, 5 times, 5.5 times, 6 times, 6.5 times, 7 times, 7.5 times, 8 times, 8.5 times, 9 times, 9.5 times or 10 times, but is not limited thereto. As an example, the transformant containing the above-mentioned GlnH protein variant can increase the production of L-glutamic acid by 5% or more, specifically, by 5 to 50% (preferably 10 to 40%), compared to the parent strain.

[0052] The composition comprising the transformant according to the present invention can be used as a composition for L-glutamic acid production.

[0053] Another aspect of the present invention provides a method for producing L-glutamic acid, comprising the steps of: culturing the transformant in a culture medium; and recovering L-glutamic acid from the transformant or the culture medium in which the transformant is cultured.

[0054] The above-mentioned culture can be carried out according to suitable culture medium and culture conditions known in the art, and those skilled in the art can easily adjust the culture medium and culture conditions for use. Specifically, the above-mentioned culture medium can be a liquid culture medium, but is not limited thereto. The culture method can include, for example, batch culture, continuous culture, fed-batch culture, or a combination thereof, but is not limited thereto.

[0055] According to a specific example of the present invention, the above-mentioned culture medium must meet the requirements of specific strains in a suitable manner and can be appropriately changed by those skilled in the art. Regarding the culture medium of Corynebacterium strains, reference can be made to known literature (Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington DC, USA, 1981), but it is not limited thereto.

[0056] According to a specific example of the present invention, the culture medium may contain various carbon sources, nitrogen sources and trace element components. As the carbon source that can be used, sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, cellulose, etc. are included; oils and fats such as soybean oil, sunflower oil, castor oil, coconut oil, etc.; fatty acids such as palmitic acid, stearic acid, linoleic acid; alcohols such as glycerol and ethanol; organic acids such as acetic acid. These substances can be used alone or in the form of a mixture, but are not limited to this. As the nitrogen source that can be used, peptone, yeast extract, broth, malt extract, corn steep liquor, soybean meal and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate can be included. Nitrogen sources can also be used alone or in the form of a mixture, but are not limited to this. As a source of phosphorus that can be used, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or corresponding sodium-containing salts can be included, but are not limited to this. In addition, the culture medium may contain metal salts such as magnesium sulfate or ferrous sulfate required for growth, but is not limited to this. In addition, essential growth substances such as amino acids and vitamins may be included. In addition, precursors suitable for the culture medium may be used. The above-mentioned culture medium or individual components may be added to the culture solution in batches or continuously in a suitable manner during the culture process, but are not limited thereto.

[0057] According to a specific example of the present invention, during the culture process, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid and sulfuric acid can be added to the microbial culture solution in an appropriate manner to adjust the pH of the culture solution. In addition, during the culture process, a defoaming agent such as fatty acid polyethylene glycol ester can be used to suppress the generation of bubbles. Further, in order to maintain the aerobic state of the culture solution, oxygen or oxygen-containing gas (such as air) can be injected into the culture solution. The temperature of the culture solution can generally be 20°C to 45°C, for example, 25°C to 40°C. The culture time can continue until the desired production of the useful substance is obtained, for example, it can be 10 to 160 hours.

[0058] According to a specific example of the present invention, in the above-mentioned step of recovering L-glutamic acid from the cultured transformant or the culture medium of the cultured transformant, the produced L-glutamic acid can be collected or recovered from the culture medium according to the culture method and using a suitable method known in the art. For example, centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, fractional dissolution (e.g., ammonium sulfate precipitation), chromatography (e.g., ion exchange, affinity, hydrophobicity and size exclusion) and other methods can be used, but are not limited thereto.

[0059] According to a specific example of the present invention, in the step of recovering L-glutamic acid, the culture medium may be subjected to low-speed centrifugation to remove biomass, and the obtained supernatant may be separated by ion exchange chromatography.

[0060] According to a specific example of the present invention, the step of recovering L-glutamic acid may include a process of purifying L-glutamic acid.

[0061] The GlnH protein variant according to the present invention is obtained by replacing one or more amino acids in the amino acid sequence constituting the GlnH protein to change the protein activity, so that L-glutamic acid can be efficiently produced by a recombinant microorganism containing the variant. BRIEF DESCRIPTION OF THE DRAWINGS

[0062] Figure 1 The structure of plasmid pK19msb according to one embodiment of the present invention is shown. DETAILED DESCRIPTION

[0063] The present invention will be described in more detail below, but such description is provided for illustrative purposes only to help understand the present invention, and the scope of the present invention is not limited to such illustrative description.

[0064] Example 1. Preparation of strains expressing GlnH protein variants

[0065] In order to confirm the effects of a variant in which the threonine at position 11 in the amino acid sequence of the GlnH protein (SEQ ID NO: 2) is substituted with isoleucine (T11I, SEQ ID NO: 4), a variant in which the threonine at position 165 is substituted with alanine (T165A, SEQ ID NO: 6), and a variant in which the threonine at position 11 is substituted with isoleucine and the threonine at position 165 is substituted with alanine (T11I+T165A, SEQ ID NO: 8) on the production of L-glutamate, vectors expressing the above GlnH protein variants and strains introduced with the above vectors were prepared.

[0066] 1-1. Preparation of transformation vector

[0067] PCR was performed using genomic DNA of Corynebacterium glutamicum ATCC13869 as a template, using primer pairs of primers 1 and 2, and primer pairs of primers 3 and 6. Two PCR products of about 0.5 kb and 1 kb in size amplified by PCR were mixed and used as templates, and overlapping PCR was performed using primer pairs of primers 1 and 6 to connect them into one fragment (P1).

[0068] PCR was performed using genomic DNA of Corynebacterium glutamicum ATCC13869 as a template, using primer pairs of primers 1 and 4, and primer pairs of primers 5 and 6, to obtain fragments of about 1 kb and 0.5 kb in size. These were mixed and used as templates, and overlapping PCR was performed using primer pairs of primers 1 and 6 to obtain a fragment (P2).

[0069] Using the genomic DNA of Corynebacterium glutamicum ATCC13869 as a template, PCR was performed using a primer pair of primers 1 and 2, a primer pair of primers 3 and 4, and a primer pair of primers 5 and 6, and 3 PCR products of about 0.5 kb were obtained. These were mixed and used as a template, and overlapping PCR was performed using a primer pair of primers 1 and 6 to connect them into one fragment (P3).

[0070] The pK19msb vector (SEQ ID NO: 9) was treated with restriction enzyme smaI (NEB), and then cloned using fragments P1, P2, and P3 and T4 ligase. The three vectors constructed in this way were named pK_glnH (T11I), pK_glnH (T165A), and pk_glnH (T11I + T165A).

[0071] Pfu premix (bioneer) was used for all PCRs. After denaturation at 95°C for 5 minutes, the reaction was repeated 30 times at 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1 minute, and then reacted at 72°C for 5 minutes.

[0072] The primer sequences used for vector preparation are shown in Table 1 below.

[0073]

Table 1

[0074] Primer name SEQ ID NO Primer sequence (5'-3') Primer 1 SEQ ID NO 10 GAGACGTTGTCGTTGGTGCG Primer 2 SEQ ID NO 11 CGCGTGATGAGTGGAGGG Primer 3 SEQ ID NO 12 CCCTCCACTCATCACGCG Primer 4 SEQ ID NO 13 GTCGGTGATCGCGACGGAAC Primer 5 SEQ ID NO 14 GTTCCGTCGCGATCACCGAC Primer 6 SEQ ID NO 15 TTATCCTTCATCGTTTTCTGTCCC

[0075] 1-2. Preparation of L-glutamic acid-producing strain introduced with GlnH protein variant

[0076] Using the above three vectors, mutant strains were prepared as follows.

[0077] Each vector was prepared so that the final concentration was 1 μg / μl or more, and after electroporation of Corynebacterium glutamicum U3 (KCCM13218P) (reference: Tauch et al., FEMS Microbiology letters 123 (1994) 343-347), 1 ml of a regeneration medium (containing 18.5 g / l of brain heart infusion and 91 g / l of sorbitol) was added, and heat-treated at 46°C for 6 minutes. After treatment, the cells were transferred to a 15 ml cap tube, cultured at 30°C for 2 hours, and smeared on a selection medium (containing 5 g / l of tryptone, 5 g / l of NaCl, 2.5 g / l of yeast extract, 18.5 g / l of brain heart infusion powder, and 15 g / l of agar) containing 20 mg / l of kanamycin. The colonies generated by culturing at 30°C for 72 hours were cultured in BHI medium (18.5 g / l brain heart extract) for 15 hours to induce secondary recombination and diluted to 10 -2 ~10 -3 , and applied to a screening medium supplemented with 10% sucrose, thereby isolating colonies. The isolated colonies were cultured in two screening mediums supplemented with kanamycin and sucrose, respectively, to screen strains that had no kanamycin resistance and had growth ability in a medium containing sucrose. They were named glnH (T11I), glnH (T165A), and glnH (T11I + T165A), respectively.

[0078] Experimental Example 1. Evaluation of L-glutamic acid production ability of strains introduced with GlnH protein variants

[0079] The L-glutamic acid production abilities of Corynebacterium glutamicum U3 as the parent strain and mutant strains into which GlnH protein variants were introduced (glnH(T11I), glnH(T165A), and glnH(T11I+T165A)) were compared.

[0080] In a 100 mL flask containing 10 ml of the glutamic acid production medium shown in Table 2 below, each strain (parent strain or variant) was inoculated at 1% by volume and cultured at 30° C. with shaking at 200 rpm for 48 hours. After the culture was completed, the concentration of L-glutamic acid in the medium was measured using HPLC (Agilent), and the results are shown in Table 3 below.

[0081]

Table 2

[0082] composition content glucose 70g / L <![CDATA[(NH 4 ) 2 SO 4 ]]> 5g / L <![CDATA[MgSO 4 ]]> 0.4g / L Urea 2g / L Soybean hydrolysate 15ml / L <![CDATA[KH 2 AFTER 4 ]]> 1g / L <![CDATA[FeSO 4 ]]> 10mg / L <![CDATA[MnSO 4 ]]> 10mg / L Thiamine_HCl 200ug / L Biotin 2ug / L <![CDATA[CaCO 3 ]]> 5％

[0083]

Table 3

[0084]

[0085] As shown in Table 3 above, it was confirmed that the mutant strains glnH(T11I), glnH(T165A) and glnH(T11I+T165A) into which the GlnH protein variants were introduced had L-glutamic acid production increased by a minimum of 13.0% and a maximum of 22.2% compared to the parent strain by replacing the threonine 11 in the amino acid sequence of the GlnH protein with isoleucine and / or replacing the threonine 165 with alanine.

[0086] So far, the present invention has been studied around its preferred embodiments. It will be appreciated by those skilled in the art that the present invention can be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments should be considered from an illustrative perspective rather than a restrictive perspective. The scope of the present invention is shown in the claims rather than in the above description, and should be interpreted as all differences within the scope of their equivalents are included in the present invention.

[0087]

Collection Information

[0088] Name of depository institution: Korea Collection of Microorganisms (KCCM)

[0089] Accession number: KCCM13218P

[0090] Collection date: June 29, 2022

[0091] Classification and nomenclature of biological material: Corynebacterium glutamicum.

Claims

1. A GlnH protein variant selected from the group consisting of the following (1) to (3): (1) a GlnH protein variant consisting of the amino acid sequence of SEQ ID NO: 4, in which the threonine 11 in the amino acid sequence of SEQ ID NO: 2 is replaced by isoleucine; (2) a GlnH protein variant consisting of the amino acid sequence of SEQ ID NO: 6, in which the threonine at No. 165 in the amino acid sequence of SEQ ID NO: 2 is replaced with alanine; and (3) A GlnH protein variant consisting of the amino acid sequence of SEQ ID NO: 8, in which the threonine at No. 11 in the amino acid sequence of SEQ ID NO: 2 is substituted with isoleucine and the threonine at No. 165 is substituted with alanine.

2. A polynucleotide encoding the variant according to claim 1.

3. A transformant comprising the variant according to claim 1 or the polynucleotide according to claim 2.

4. The transformant according to claim 3, wherein The transformant is a Corynebacterium strain.

5. The transformant according to claim 3, wherein The transformant has L-glutamic acid-producing ability.

6. A method for producing L-glutamic acid, comprising the following steps: A step of culturing the transformant according to claim 3 in a culture medium; as well as A step of recovering L-glutamic acid from the transformant or the medium in which the transformant is cultured.

Images