Stem cell induction medium and application thereof

Abstract

The invention discloses a stem cell induction culture medium and application thereof, and belongs to the technical field of biological cell culture. The culture medium provided by the invention is definite in component dosage, can ensure the quality of batches, and is suitable for induced differentiation from umbilical cord mesenchymal stem cells to chondroblasts. In the process of preparing the culture medium, the basic components provide nutrients needed in the stem cell induction process, the functional components promote stem cells to be induced and differentiated towards the cartilage direction, and the key additives such as the perilla seed extract and the beta-carotene are directly applied to the umbilical cord mesenchymal stem cell chondrogenesis induction culture medium. The cartilage differentiation efficiency of the umbilical cord mesenchymal stem cells is enhanced, and the effects of maintaining the phenotype of the cartilage cells and avoiding calcification of the cartilage cells are achieved.

Description

Technical Field

[0001] The invention belongs to the technical field of biological cell culture, and in particular relates to a stem cell induction culture medium and application thereof. Background Art

[0002] Mesenchymal stem cells (MSC) are a type of multipotent stem cells that exist in a variety of tissues (such as bone marrow, umbilical cord blood and umbilical cord tissue, placental tissue, adipose tissue, etc.). They have the ability to highly proliferate and self-renew, and have the potential for multidirectional differentiation. They can differentiate into cartilage, bone, skeletal muscle, tendon, fat, dermis and nerve cells under different induction conditions. Current clinical trials have confirmed that MSCs can be used for tissue repair and treatment of mesenchymal tissue genetic defect diseases, such as: blood system diseases, cardiovascular diseases, cirrhosis, nervous system diseases, partial meniscus resection of the knee joint injury repair, autoimmune diseases, etc.

[0003] Umbilical cord mesenchymal stem cells have the potential to differentiate into chondrocytes. Existing stem cell induction culture media often enhance the ability of umbilical cord mesenchymal stem cells to differentiate into chondrocytes by adding exogenous growth factors during the in vitro induction culture of umbilical cord mesenchymal stem cells to differentiate into chondrocytes.

[0004] Common difficulties in the process of umbilical cord mesenchymal stem cell chondrogenesis include low expression of type II collagen when inducing stem cells into chondrocytes in vitro, which makes it difficult to maintain the chondrocyte phenotype, and high expression of type X collagen indicates chondrocyte hypertrophy, which may cause calcification and affect cartilage function. In view of the difficulties in inducing umbilical cord mesenchymal chondrogenesis, it is of great significance to develop a culture medium that can promote the efficient chondrogenesis of umbilical cord mesenchymal stem cells, maintain the chondrocyte phenotype and reduce chondrocyte calcification. Summary of the invention

[0005] In view of the above-mentioned prior art, the purpose of the present invention is to provide a stem cell induction culture medium and its application. The stem cell induction culture medium provided by the present invention can enhance the ability of umbilical cord mesenchymal stem cells to differentiate into cartilage while ensuring the expression of cartilage-specific markers and reducing the calcification problem during the induction process.

[0006] To achieve the above object, the present invention adopts the following technical solutions: In a first aspect, the present invention provides a stem cell induction medium, which is composed of a basic culture component, 0.1-0.2 mg / mL sodium pyruvate, 0.1-0.2 ng / mL dexamethasone, 15-20 ng / mL TGF-β1, 3-5 mg / L riboflavin, 3-5 mg / L perilla seed extract and 3-5 mg / L β-carotene.

[0007] The sodium pyruvate, dexamethasone, TGF-β1 and riboflavin are functional ingredients; the perilla seed extract and β-carotene are key additives.

[0008] The basic culture components of the stem cell induction medium are: L-isoleucine 80-100 mg / L, L-glutamine 580-600 mg / L, L-phenylalanine 70-75 mg / L, L-methionine 20-30 mg / L, L-serine 40-45 mg / L, L-threonine 90-100 mg / L, L-tryptophan 16-18 mg / L, L-valine 90-95 mg / L, glycine 30-35 mg / L, choline chloride 5-8 mg / L, D-calcium pantothenate 5-6 mg / L, vitamin B6 hydrochloride 5-6 mg / L, folic acid 5-6 mg / L, sodium carboxymethyl cellulose 0.5-1 mg / L, nicotinamide 3-4 mg / L, trypsin 0.05-0.08 mg / ml, thiamine hydrochloride 3-5mg / L, anhydrous magnesium sulfate 96-98mg / L, potassium chloride 400-410mg / L, sodium chloride 6200-6210mg / L, sodium dihydrogen phosphate dihydrate 125-130mg / L, D-glucose 1000-1005mg / L, L-cystine dihydrochloride 62-65mg / L, inositol 6-8mg / L, sodium bicarbonate 1000-1200mg / L and phenol red 12-15mg / L.

[0009] Preferably, the stem cell induction medium comprises 80 mg of L-isoleucine, 580 mg of L-glutamine, 70 mg of L-phenylalanine, 20 mg of L-methionine, 40 mg of L-serine, 90 mg of L-threonine, 16 mg of L-tryptophan, 90 mg of L-valine, 30 mg of glycine, 5 mg of choline chloride, 5 mg of D-calcium pantothenate, 5 mg of vitamin B6 hydrochloride, 5 mg of folic acid, 0.5 mg of sodium carboxymethyl cellulose, 3 mg of nicotinamide, 0.05 mg of trypsin, 3 mg of thiamine hydrochloride, 96 mg of anhydrous magnesium sulfate, 400 mg of potassium chloride, 6200 mg of sodium chloride, 125 mg of sodium dihydrogen phosphate dihydrate, 1000 mg of D-glucose, 62 mg of L-cystine dihydrochloride, 6 mg of inositol, 1000 mg of sodium bicarbonate, 12 mg of phenol red, 0.1 mg / mL sodium pyruvate, 0.1 ng / mL dexamethasone, and 15 ng / mL It is composed of TGF-β1, 3mg / L riboflavin, 3mg / L perilla seed extract and 3mg / L β-carotene.

[0010] The second aspect of the present invention provides the use of the above-mentioned stem cell induction medium in a product for promoting the induction and differentiation of stem cells into chondrocytes.

[0011] The product for promoting stem cell differentiation into chondrocytes is specifically characterized by enhancing the efficiency of stem cell differentiation into chondrocytes, maintaining the phenotype of chondrocytes, or avoiding calcification of chondrocytes.

[0012] The stem cells are umbilical cord mesenchymal stem cells.

[0013] Beneficial effects of the present invention: The medium components provided by the present invention have clear dosages, can ensure the quality between batches, and are suitable for inducing differentiation of umbilical cord mesenchymal stem cells into chondrocytes. In the process of configuring the medium, the basic components of the present invention provide the nutrients required in the stem cell induction process, and the functional components promote the induction and differentiation of stem cells into cartilage. Perilla seed extract and β-carotene mainly play anti-inflammatory, anti-aging, and tumor growth inhibition roles in existing reports. The present invention has found that the direct application of perilla seed extract and β-carotene as key additives in the umbilical cord mesenchymal stem cell cartilage induction medium enhances the ability of umbilical cord mesenchymal stem cells to differentiate into cartilage, ensures the expression of cartilage-specific markers, and has the effect of maintaining the chondrocyte phenotype and avoiding calcification. DETAILED DESCRIPTION

[0014] It should be noted that the following detailed descriptions are illustrative and are intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present application belongs.

[0015] The following detailed description is for illustrative purposes only and is intended to provide further explanation of the present application, rather than to limit the scope of the present invention.

[0016] The β-carotene (effective matter content 10%) used in the examples of the present invention was purchased from Shandong Jinchengda Biotechnology Co., Ltd.; the perilla seed extract (effective matter content 20:1) used was purchased from Shaanxi Zhoushi Shengze Health Technology Co., Ltd.

[0017] The umbilical cord mesenchymal stem cells used in this example are human umbilical cord mesenchymal stem cells purchased from Shanghai Kanglang Biotechnology Co., Ltd. The frozen cells were stored at -80°C.

[0018] Example 1: Preparation of stem cell induction medium Prepare stem cell induction medium according to the following formula: Basic ingredients: L-isoleucine 80mg, L-glutamine 580mg, L-phenylalanine 70mg, L-methionine 20mg, L-serine 40mg, L-threonine 90mg, L-tryptophan 16mg, L-valine 90mg, glycine 30mg, choline chloride 5mg, D-calcium pantothenate 5mg, vitamin B6 hydrochloride 5mg, folic acid 5mg, sodium carboxymethyl cellulose 0.5mg, niacinamide 3mg, trypsin 0.05mg, thiamine hydrochloride 3mg, anhydrous magnesium sulfate 96mg, potassium chloride 400mg, sodium chloride 6200mg, sodium dihydrogen phosphate dihydrate 125mg, D-glucose 1000mg, L-cystine dihydrochloride 62mg, inositol 6mg, sodium bicarbonate 1000mg and phenol red 12mg.

[0019] Functional substances: 0.1 mg / mL sodium pyruvate, 0.1 ng / mL dexamethasone, 15 ng / mL TGF-β1 and 3 mg / L riboflavin.

[0020] Key additives: Perilla seed extract 3mg / L and β-carotene 3mg / L.

[0021] Use a syringe to filter the prepared stem cell induction medium through a sterile filter membrane with a pore size of 0.22 μm, seal it and store it in a refrigerator at 4°C. Use it within 2 weeks.

[0022] Example 2: Preparation of stem cell induction medium Prepare stem cell induction medium according to the following formula: Basic ingredients: L-isoleucine 100mg, L-glutamine 600mg, L-phenylalanine 75mg, L-methionine 30mg, L-serine 45mg, L-threonine 100mg, L-tryptophan 18mg, L-valine 95mg, glycine 35mg, choline chloride 8mg, D-calcium pantothenate 6mg, vitamin B6 hydrochloride 6mg, folic acid 6mg, sodium carboxymethyl cellulose 1mg, niacinamide 4mg, trypsin 0.08mg, thiamine hydrochloride 5mg, anhydrous magnesium sulfate 98mg, potassium chloride 410mg, sodium chloride 6210mg, sodium dihydrogen phosphate dihydrate 130mg, D-glucose 1005mg, L-cystine dihydrochloride 65mg, inositol 8mg, sodium bicarbonate 1200mg and phenol red 15mg / L.

[0023] Functional substances: 0.2 mg / mL sodium pyruvate, 0.2 ng / mL dexamethasone, 20 ng / mL TGF-β1 and 5 mg / L riboflavin.

[0024] Key additives: Perilla seed extract 5mg / L and β-carotene 5mg / L.

[0025] Use a syringe to filter the prepared stem cell induction medium through a sterile filter membrane with a pore size of 0.22 μm, seal it and store it in a refrigerator at 4°C. Use it within 2 weeks.

[0026] Comparative Example 1: Configuration of stem cell induction medium Basic components: The configuration method is the same as in Example 1.

[0027] Functional substance: The preparation method is the same as that in Example 1.

[0028] Key additives: Perilla seed extract 3mg / L.

[0029] Use a syringe to filter the prepared stem cell induction medium through a sterile filter membrane with a pore size of 0.22 μm, seal it and store it in a refrigerator at 4°C. Use it within 2 weeks.

[0030] Comparative Example 2: Configuration of stem cell induction medium Basic components: The configuration method is the same as in Example 1.

[0031] Functional substance: The preparation method is the same as that in Example 1.

[0032] Key additives: β-carotene 3mg / L.

[0033] Use a syringe to filter the prepared stem cell induction medium through a sterile filter membrane with a pore size of 0.22 μm, seal it and store it in a refrigerator at 4°C. Use it within 2 weeks.

[0034] Experimental Example 1: Detection of the efficiency of culture medium in inducing chondrogenicity of umbilical cord mesenchymal stem cells (1) Take out the frozen human umbilical cord mesenchymal stem cells from liquid nitrogen and thaw them quickly in a 37°C water bath. Centrifuge at 1000 rpm for 5 minutes to remove the freezing solution, resuspend in DMEM / F12 medium (containing 10% FBS), and inoculate into a culture dish. Place it at 37°C and 5% CO 2 Culture in an incubator, replace fresh culture medium every 2-3 days, and when the cell density reaches 80%-90%, digest and passage with 0.25% trypsin, and select cells of the 5th generation for induction culture.

[0035] (2) Take four 6-well cell culture plates and mark them as experimental group 1, experimental group 2, experimental group 3 and control group. The stem cell induction medium used in the control group is different from the stem cell induction medium configured in Example 1 only in that it does not contain key additives.

[0036] Human umbilical cord mesenchymal stem cells cultured to P5 were cultured at 5×10 3 cells / cm 2The cells were inoculated in 6-well cell culture plates at a density of 1. 2 ml of the stem cell induction medium prepared in Example 1 was added to each well of the experimental group 1 and the plates were incubated at 37°C and 5% CO. 2 Incubate in the incubator for 12 days; add 2 ml of stem cell induction medium prepared in Comparative Example 1 to each well of Experimental Group 2 and place at 37°C, 5% CO 2 Incubate in the incubator for 12 days; add 2 ml of stem cell induction medium prepared in Comparative Example 2 to each well of Experimental Group 3 and place at 37°C, 5% CO 2 The cells were cultured in an incubator at 37°C and 5% CO for 12 days. 2 ml of stem cell induction medium prepared in the control group was added to each well of the control group. 2 The cells were cultured in an incubator at 4 °C for 12 days. During the culture process of each group, the culture medium was replaced every 3 days.

[0037] After induction, the supernatant was discarded, and 1 ml of 4% neutral formaldehyde solution was added to each well to fix the cells at room temperature for 30 minutes (in a fume hood). The fixative was discarded, washed twice with PBS, and 1 ml of Alcian blue staining solution was added to each well for staining at room temperature for 30 minutes. The Alcian blue staining solution was discarded, and the cells were washed three times with PBS to fully wash away the excess staining solution. 1 ml of PBS was added to each well, and the cells were observed and counted in an inverted microscope imaging system. The upper left, upper right, lower left, lower right, and middle 5 areas were selected for chondrocyte counting. The counting results showed that the relative counts of experimental group 1 were 7 times higher than those of the control group, the relative counts of experimental group 2 were 2 times higher than those of the control group, and the relative counts of experimental group 2 were 3 times higher than those of the control group. The counting results showed that experimental group 1 had the best effect in inducing umbilical cord mesenchymal stem cells to differentiate into chondrocytes.

[0038] Experimental Example 2: Determination of the chondrogenic differentiation performance of culture medium from umbilical cord mesenchymal stem cells 1. Test methods (1) Take three 6-well cell culture plates and mark them as experimental group 1, experimental group 2, and experimental group 3.

[0039] According to the umbilical cord mesenchymal stem cell induction culture method described in Experimental Example 1, human umbilical cord mesenchymal stem cells cultured to P5 were cultured at 5×10 3 cells / cm 2 The cells were inoculated in 6-well cell culture plates at a density of 1. 2 ml of the stem cell induction medium prepared in Example 1 was added to each well of the experimental group 1 and the plates were incubated at 37°C and 5% CO. 2 Incubate in the incubator for 28 days; add 2 ml of stem cell induction medium prepared in Comparative Example 1 to each well of Experimental Group 2 and place at 37°C, 5% CO 2 Incubate in the incubator for 28 days; 2 ml of the stem cell induction medium prepared in Comparative Example 2 was added to each well of the experimental group 3 and placed at 37°C, 5% CO 2The cells were cultured in an incubator for 28 days. During the culture process of each group, new culture medium was replaced every 3 days.

[0040] (2) Collect cells induced for 6 days, 12 days and 28 days from experimental group 1, experimental group 2 and experimental group 3 respectively, and add TRIZOL to lyse the cells. Add 200 μL of chloroform and vortex thoroughly, let stand at room temperature for 10 minutes, centrifuge at 12000g and 4℃ for 15 minutes, aspirate 400 μL of the upper layer into a 1.5mL RNase-free EP tube, add 600mL of isopropanol, vortex mix, let stand at room temperature for 10 minutes, centrifuge at 12000g and 4℃ for 15 minutes, discard the supernatant, precipitate to room temperature and dry, add 1mL of 75% alcohol for washing, centrifuge at 8000g and 4℃ for 7 minutes, discard the supernatant, precipitate to room temperature and dry, add 20mL of RNase, and extract the cellular RNA.

[0041] (3) Using RNA as a template, 1 μg of cell RNA was reverse transcribed into cDNA. Using the expression level of β-actin as an internal reference, the primer sequences shown in SEQ ID NO.1-SEQ ID NO.6 were used to perform qRT-PCR detection of COL2A1 (type II collagen) markers and COL10A1 (type X collagen) markers under the reaction conditions of 95℃ 3min, 95℃ 5sec, 60℃ 30sec, and 40 cycles. The template for detection of COL2A1 (type II collagen) markers was RNA induced for 6 days and 12 days, and the RNA induced for 28 days was used for detection of COL10A1 (type X collagen) markers.

[0042] β-actin-F:TCACTATTGGCAACGAGCGGTTC (SEQ ID NO. 1); β-actin-R:TCACTATTGGCAACGAGCGGTTC (SEQ ID NO. 2).

[0043] COL2A1-F: TACTGGAGTGACTGGTCCTAAG (SEQ ID NO.3); COL2A1-R: AACACCTTTGGGACCATTCTTT (SEQ ID NO. 4).

[0044] COL10A1-F:GGGCTTTCCTGGAGAAAAGG (SEQ ID NO.5); COL10A1-R: GAATCCTGGAATGCCTGGTG (SEQ ID NO. 6).

[0045] 2. Test results (1) COL2A1 (type II collagen) marker test results After 6 days of induction of differentiation, the expression level of COL2A1 mRNA relative to the internal reference β-actin mRNA in experimental group 1 was 3.52, the expression level of COL2A1 mRNA relative to the internal reference β-actin mRNA in experimental group 2 was 1.94, and the expression level of COL2A1 mRNA relative to the internal reference β-actin mRNA in experimental group 3 was 2.01.

[0046] After 12 days of induction of differentiation, the expression level of COL2A1 mRNA relative to the internal reference β-actin mRNA in experimental group 1 was 6.73, the expression level of COL2A1 mRNA relative to the internal reference β-actin mRNA in experimental group 2 was 2.83, and the expression level of COL2A1 mRNA relative to the internal reference β-actin mRNA in experimental group 3 was 2.95.

[0047] (2) COL10A1 (type X collagen) marker test results After 28 days of induction of differentiation, the expression level of COL10A1 mRNA relative to the internal reference β-actin mRNA in experimental group 1 was 0.15, the expression level of COL10A1 mRNA relative to the internal reference β-actin mRNA in experimental group 2 was 0.30, and the expression level of COL10A1 mRNA relative to the internal reference β-actin mRNA in experimental group 3 was 0.26.

[0048] 3. Results Analysis Type II collagen is a cartilage-specific marker that is continuously expressed by chondrocytes. It is an important component of the cartilage matrix and can maintain the chondrocyte phenotype. Type X collagen is a marker for detecting hypertrophic chondrocytes and is a key factor related to chondrocyte calcification. This test case indirectly reflects the chondrocyte phenotype maintenance ability and calcification level by detecting the expression of type II collagen and type X collagen.

[0049] From the test results, the culture medium of experimental group 1 can continuously express COL2A1 (type II collagen) cartilage-specific markers at a high level, and as the culture time increases, after 12 days of induction of differentiation using the culture medium of Example 1, a synergistic effect is produced in increasing the expression of COL2A1 (type II collagen) cartilage-specific markers, thereby continuously maintaining the chondrocyte phenotype. After 28 days of long-term induction of differentiation, the expression of COL10A1 (type X collagen) markers is maintained at a low level, indicating that the stem cell induction culture medium prepared in Example 1 has a good effect in reducing or even avoiding chondrocyte calcification.

[0050] The above description is only a preferred embodiment of the present application and is not intended to limit the present application. For those skilled in the art, the present application may have various modifications and variations. Any modification made within the spirit and principle of the present application shall be deemed to be appropriate. Equivalent replacements, improvements, etc. should all be included in the protection scope of this application.

Claims

1. A stem cell induction medium, characterized in that The stem cell induction medium is prepared from basic culture components, 0.1-0.2 mg / mL sodium pyruvate, 0.1-0.2 ng / mL dexamethasone, 15-20 ng / mL TGF-β1, 3-5 mg / L riboflavin, 3-5 mg / L perilla seed extract and 3-5 mg / L β-carotene.

2. The stem cell induction medium according to claim 1, characterized in that The basic culture components of the stem cell induction medium are: L-isoleucine 80-100 mg / L, L-glutamine 580-600 mg / L, L-phenylalanine 70-75 mg / L, L-methionine 20-30 mg / L, L-serine 40-45 mg / L, L-threonine 90-100 mg / L, L-tryptophan 16-18 mg / L, L-valine 90-95 mg / L, glycine 30-35 mg / L, choline chloride 5-8 mg / L, D-calcium pantothenate 5-6 mg / L, vitamin B6 hydrochloride 5-6 mg / L, folic acid 5-6 mg / L / L, sodium carboxymethyl cellulose 0.5-1mg / L, niacinamide 3-4mg / L, trypsin 0.05-0.08mg / ml, thiamine hydrochloride 3-5mg / L, anhydrous magnesium sulfate 96-98mg / L, potassium chloride 400-410mg / L, sodium chloride 6200-6210mg / L, sodium dihydrogen phosphate dihydrate 125-130mg / L, D-glucose 1000-1005mg / L, L-cystine dihydrochloride 62-65mg / L, inositol 6-8mg / L, sodium bicarbonate 1000-1200mg / L and phenol red 12-15mg / L.

3. The stem cell induction medium according to claim 1 or 2, characterized in that The stem cell induction medium comprises 80 mg of L-isoleucine, 580 mg of L-glutamine, 70 mg of L-phenylalanine, 20 mg of L-methionine, 40 mg of L-serine, 90 mg of L-threonine, 16 mg of L-tryptophan, 90 mg of L-valine, 30 mg of glycine, 5 mg of choline chloride, 5 mg of D-calcium pantothenate, 5 mg of vitamin B6 hydrochloride, 5 mg of folic acid, 0.5 mg of sodium carboxymethyl cellulose, 3 mg of nicotinamide, 0.05 mg of trypsin, 3 mg of thiamine hydrochloride, 96 mg of anhydrous magnesium sulfate, 400 mg of potassium chloride, 6200 mg of sodium chloride, 125 mg of sodium dihydrogen phosphate dihydrate, 1000 mg of D-glucose, 62 mg of L-cystine dihydrochloride, 6 mg of inositol, 1000 mg of sodium bicarbonate, 12 mg of phenol red, 0.1 mg / mL sodium pyruvate, 0.1 ng / mL dexamethasone, and 15 ng / mL It is composed of TGF-β1, 3mg / L riboflavin, 3mg / L perilla seed extract and 3mg / L β-carotene.

4. Use of the stem cell induction medium according to any one of claims 1 to 3 in a product for promoting the induction and differentiation of stem cells into chondrocytes.

5. The use according to claim 4, characterized in that: The product for promoting stem cell differentiation into chondrocytes is specifically characterized by enhancing the efficiency of stem cell differentiation into chondrocytes, maintaining the phenotype of chondrocytes, or reducing chondrocyte calcification.

6. The use according to claim 4, characterized in that: The stem cells are umbilical cord mesenchymal stem cells.