SgRNA knockout of RAB20 gene, RAB20 gene knockout cell line and application of sgRNA knockout in production of viruses and / or vaccines

Abstract

The invention relates to sgRNA for knocking out an RAB20 gene, an RAB20 gene knockout cell line and application of the sgRNA and the cell line in production of viruses and / or vaccines, and belongs to the technical field of gene engineering. The invention finds that overexpression of RAB20 in a host cell can inhibit replication of small RNA viridae viruses, and inhibition of RAB20 gene expression in the host cell can promote replication of small RNA viridae viruses. The sgRNA specifically targeting the RAB20 gene provided by the invention can specifically target the RAB20 gene, realize the knockout of the RAB20 gene and obtain an RAB20 gene knockout cell line, and the RAB20 gene knockout cell line is further used as a production cell line of the small RNA viridae virus and a vaccine thereof, so that the replication of the small RNA viridae virus can be remarkably promoted, and the virus titer and the antigen yield can be improved.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and in particular relates to sgRNA for knocking out a RAB20 gene, a RAB20 gene knockout cell line, and applications thereof in virus and / or vaccine production. Background Art

[0002] The Picornaviridae family is a very diverse family of viruses that not only threatens human health, but also has an important impact on the development of agriculture. Foot-and-mouth disease virus (FMDV) belongs to the Picornaviridae family, the genus FMDV, and can cause acute, febrile, and contact infectious diseases in even-toed ungulates. FMDV has 17 serotypes, including O, A, C, SAT1, SAT2, SAT3, and Asia1. There is no cross-immunity between the types, and animals infected with one type of FMDV can still be infected with another type of FMDV and become ill. Senecavirus disease is a viral infectious disease caused by Senecavirus A (SVA) of the Senecavirus genus of the Picornaviridae family, which mainly infects pigs. The disease is mainly transmitted through contact and can cause vesicular lesions in the nose and hoof of pigs. It is clinically difficult to distinguish from vesicular diseases such as foot-and-mouth disease and swine vesicular disease. Developing highly effective vaccines is an important measure to prevent and control the above-mentioned diseases, and screening cell lines that efficiently reproduce viruses will help prepare highly effective vaccines. Therefore, there is an urgent need to provide a cell line that can efficiently reproduce small RNA viruses.

[0003] RAB20 protein is a member of the Rab GTPase family and belongs to the small GTPase protein superfamily (Ras superfamily). It is mainly involved in regulating the transport and membrane dynamics of intracellular vesicles and plays an important role in a variety of physiological and pathological processes. However, there is no report on its relationship with the reproduction of small RNA viruses.

[0004] Gene editing technology is a technology that uses molecular biological methods to carry out targeted and precise mutation, modification or editing of genes in various cells. This technology has been widely used in research fields such as disease treatment, disease-resistant breeding, and genetic engineering. CRISPR / Cas9 gene editing technology is derived from the adaptive immune system of bacteria. It uses small molecule sgRNA to guide Cas protein to the target DNA sequence for targeted gene editing. CRISPR / Cas9 technology has brought about a breakthrough revolution in genome directed transformation, modification, regulation and application due to its high efficiency, accuracy, stability and relatively simple operation. It is widely used in basic research, agricultural improvement and gene therapy. If the problem of regulating the replication of small RNA viruses can be solved through genetic technology, it will be of great significance for disease prevention and control. Summary of the invention

[0005] In view of this, the object of the present invention is to provide the use of RAB20 protein or RAB20 gene as a target in the preparation of products regulating the replication of Picornaviridae viruses and / or vaccine production. By increasing the expression of the RAB20 gene, the replication of Picornaviridae viruses can be inhibited, and reducing the expression of the RAB20 gene can promote the replication of Picornaviridae viruses; sgRNA is used to knock out the RAB20 gene to prepare a cell line in which the gene-encoded protein function is lost, which is used for the production of Picornaviridae viruses and their vaccines, promotes the replication of Picornaviridae viruses, and increases the virus titer and antigen yield.

[0006] The present invention provides the use of RAB20 protein or RAB20 gene as a target in the preparation of products for regulating the replication of Picornaviridae viruses and / or the production of vaccines.

[0007] Preferably, the Picornaviridae virus comprises foot-and-mouth disease virus and / or Seneca virus.

[0008] Preferably, the regulatory effect is exerted by up-regulating or reducing the expression level of the RAB20 gene; up-regulating the expression level of the RAB20 gene can inhibit the replication of Picornaviridae viruses, and reducing the expression level of the RAB20 gene can promote the replication of Picornaviridae viruses.

[0009] Preferably, the method of reducing the expression level of the RAB20 gene includes interfering with the expression of the RAB20 gene or knocking out the RAB20 gene.

[0010] Preferably, the sgRNA for knocking out the RAB20 gene includes RAB20-sgRNA1 and / or RAB20-sgRNA2; the targeting sequence of the RAB20-sgRNA1 is shown as SEQ ID NO.1; and the targeting sequence of the RAB20-sgRNA2 is shown as SEQ ID NO.2.

[0011] The present invention provides an sgRNA for knocking out the RAB20 gene, wherein the sgRNA includes RAB20-sgRNA1 and / or RAB20-sgRNA2;

[0012] The targeting sequence of the RAB20-sgRNA1 is shown in SEQ ID NO.1;

[0013] The targeting sequence of the RAB20-sgRNA2 is shown in SEQ ID NO.2.

[0014] Preferably, the RAB20-sgRNA1 is a double-stranded fragment formed by annealing RAB20-sgRNA1-F and RAB20-sgRNA1-R; the RAB20-sgRNA2 is a double-stranded fragment formed by annealing RAB20-sgRNA2-F and RAB20-sgRNA2-R;

[0015] The gene sequence of RAB20-sgRNA1-F is shown in SEQ ID NO.3;

[0016] The gene sequence of RAB20-sgRNA1-R is shown in SEQ ID NO.4;

[0017] The gene sequence of RAB20-sgRNA2-F is shown in SEQ ID NO.5;

[0018] The gene sequence of the RAB20-sgRNA2-R is shown in SEQ ID NO.6.

[0019] The present invention provides a reagent or a kit for knocking out the RAB20 gene, wherein the reagent or the kit comprises the sgRNA.

[0020] Preferably, the reagent or kit further comprises a coding sequence of the Cas9 protein.

[0021] The present invention provides the use of the sgRNA or the reagent or the kit in preparing a cell line in which the function of a protein encoded by a RAB20 gene is lost.

[0022] The present invention provides a cell line in which the function of a protein encoded by a RAB20 gene is lost. The cell line is obtained by knocking out the RAB20 gene in a host cell by using the sgRNA or the reagent or the kit.

[0023] The present invention provides the use of the sgRNA, the reagent or the kit or the cell line in the production of Picornaviridae viruses and / or Picornaviridae virus vaccines.

[0024] Beneficial effects of the present invention:

[0025] The present invention provides the application of RAB20 protein or RAB20 gene as a target in the preparation of products regulating the replication of Picornaviridae viruses and / or vaccine production. Overexpression of RAB20 in host cells can inhibit the replication of Picornaviridae viruses, thereby reducing the amount of virus, and inhibiting the expression of RAB20 gene in host cells can promote the replication of Picornaviridae viruses. The present invention provides a sgRNA specifically targeting RAB20, which can specifically target the RAB20 gene, achieve knockout of the RAB20 gene, and has accurate targeting and high knockout efficiency. After knocking out the RAB20 gene, a cell line in which the RAB20 gene encoding protein function is lost is obtained, and the cell line is further used as a production cell line for Picornaviridae viruses and vaccines thereof, which can significantly promote the replication of Picornaviridae viruses, improve virus titer and antigen production, and contribute to the preparation of efficient vaccines, which is of great significance to the prevention and control of Picornaviridae viruses. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 Graph showing the effect of overexpression of RAB20 on FMDV replication.

[0027] Figure 2 Schematic diagram of sgRNA targeting the RAB20 genomic region.

[0028] Figure 3 This is a diagram of gene deletion mutation sequencing analysis in the RAB20-KO-1 cell line.

[0029] Figure 4 This is a diagram of gene deletion mutation sequencing analysis in the RAB20-KO-2 cell line.

[0030] Figure 5 This is a diagram showing the expression of RAB20 protein in RAB20 gene knockout cell lines detected by Western blot.

[0031] Figure 6 The cell viability test results of the RAB20 gene knockout cell line; ns means no significant difference.

[0032] Figure 7 This is a graph showing the difference in mRNA levels between FMDV-infected RAB20 gene knockout cell lines and control cells detected by RT-qPCR; where * indicates P < 0.05, and *** indicates P < 0.001.

[0033] Figure 8 This is a Western blot showing the difference in viral protein levels between FMDV-infected RAB20 gene knockout cell lines and control cells.

[0034] Fig. 9The results of indirect immunofluorescence analysis of FMDV-infected RAB20 gene knockout cell lines and control cells.

[0035] Fig.10 The figure shows the results of virus titer detection of RAB20 gene knockout cell line and control cells infected by FMDV; where ** indicates P < 0.01.

[0036] Fig.11 The graph shows the fluorescence analysis results of SVA-infected RAB20 gene knockout cell lines and control cells. DETAILED DESCRIPTION

[0037] The present invention provides the use of RAB20 protein or RAB20 gene as a target in the preparation of products regulating the replication of Picornaviridae viruses and / or vaccine production. The Picornaviridae viruses preferably include foot-and-mouth disease virus and / or Seneca virus.

[0038] In the present invention, the gene sequence of RAB20 is preferably as shown in SEQ ID NO.7, and the amino acid sequence is preferably as shown in SEQ ID NO.8.

[0039] In the present invention, it is preferred to play a regulatory role by increasing or decreasing the expression of the RAB20 gene; increasing the expression of the RAB20 gene can inhibit the replication of Picornaviridae viruses, and decreasing the expression of the RAB20 gene can promote the replication of Picornaviridae viruses. The present invention is not particularly limited to the method of increasing the expression of the RAB20 gene, and the conventional method of increasing the expression of the RAB20 gene in the art can be used, and the method of increasing the expression of the RAB20 gene preferably includes overexpressing the RAB20 gene. The method of reducing the expression of the RAB20 gene preferably includes interfering with the expression of the RAB20 gene or knocking out the RAB20 gene. The method of knocking out the RAB20 gene preferably includes gene editing, and the gene editing preferably includes knocking out the RAB20 gene using sgRNA. The sgRNA for knocking out the RAB20 gene preferably includes RAB20-sgRNA1 and / or RAB20-sgRNA2; the targeting sequence of the RAB20-sgRNA1 is shown in SEQ ID NO.1; the targeting sequence of the RAB20-sgRNA2 is shown in SEQ ID NO.2. The gene editing method preferably includes CRISPR / Cas9 gene editing technology.

[0040] The present invention provides an sgRNA for knocking out the RAB20 gene, wherein the sgRNA includes RAB20-sgRNA1 and / or RAB20-sgRNA2;

[0041] The targeting sequence of the RAB20-sgRNA1 is shown in SEQ ID NO.1;

[0042] The targeting sequence of the RAB20-sgRNA2 is shown in SEQ ID NO.2.

[0043] In the present invention, the RAB20-sgRNA1 is preferably a double-stranded fragment formed by annealing RAB20-sgRNA1-F and RAB20-sg RNA1-R; the RAB20-sgRNA2 is preferably a double-stranded fragment formed by annealing RAB20-sgRNA2-F and RAB20-sgRNA2-R;

[0044] The gene sequence of RAB20-sgRNA1-F is shown in SEQ ID NO.3;

[0045] The gene sequence of RAB20-sgRNA1-R is shown in SEQ ID NO.4;

[0046] The gene sequence of RAB20-sgRNA2-F is shown in SEQ ID NO.5;

[0047] The gene sequence of the RAB20-sgRNA2-R is shown in SEQ ID NO.6.

[0048] The present invention provides a reagent or a kit for knocking out the RAB20 gene, wherein the reagent or the kit comprises the sgRNA, and the reagent or the kit preferably further comprises a coding sequence of a Cas9 protein.

[0049] In one embodiment, the reagent or kit preferably includes a recombinant vector containing the sgRNA, the backbone vector of the recombinant vector preferably includes an expression vector PX459, and the recombinant vector is preferably obtained by digesting the PX459 vector with a restriction endonuclease Bbs I and then connecting it with the sgRNA with T4 ligase.

[0050] The present invention provides the use of the sgRNA or the reagent or the kit in preparing a cell line with loss of function of a protein encoded by the RAB20 gene. The cell line with loss of function of a protein encoded by the RAB20 gene preferably includes a RAB20 gene knockout cell line.

[0051] In the present invention, the method for preparing a cell line with loss of function of the protein encoded by the RAB20 gene is preferably to use sgRNA to cause loss of function of the protein encoded by the RAB20 gene in the host cell through gene editing technology, and the gene editing technology is preferably CRISPR / Cas9 technology. In one embodiment, the specific steps of the method preferably include: sgRNA is connected to the PX459 plasmid to obtain a recombinant plasmid that simultaneously expresses the Cas9 protein and the sgRNA sequence; the recombinant plasmid is transfected into PK-15 cells, and the RAB20 gene knockout cell line obtained is a cell line with loss of function of the protein encoded by the RAB20 gene.

[0052] The present invention provides a cell line in which the protein encoded by the RAB20 gene loses its function, wherein the cell line is obtained by knocking out the RAB20 gene in the host cell using the sgRNA or the reagent or the kit. The host cell preferably includes PK-15 cells.

[0053] The present invention provides the use of the sgRNA or the reagent or the kit or the cell line in the production of Picornaviridae virus and / or Picornaviridae virus vaccine. The cell line infected with Picornaviridae virus and the loss of RAB20 gene encoding protein function can significantly promote the replication of Picornaviridae virus, and improve the titer and antigen production of the virus. The Picornaviridae virus is preferably foot-and-mouth disease virus and / or Seneca virus.

[0054] In the present invention, the following definitions are made for relevant terms:

[0055] The term "protein function loss" refers to the process of knocking out, mutating or inserting a partial gene into a protein-encoding gene fragment, so that a frameshift mutation occurs in the gene-encoded protein, causing the gene-encoded protein to be unable to normally perform its biological function. The present invention knocks out the RAB20 gene in the host cell, resulting in the loss of function of the RAB20 gene-encoded protein, and then constructs a cell line with a loss of function of the RAB20 gene-encoded protein, and is used for the vaccine production of FMDV and SVA viruses. However, the present invention is not limited to the RAB20 gene knockout, and the function of the RAB20 gene-encoded protein can also be lost by other technical means, and is used to construct a cell line with a loss of function of the RAB20 gene-encoded protein.

[0056] The term "gene editing" refers to a directed transgenic technology that uses DNA site-directed homologous recombination to change the genetic information of cells or individual organisms, mainly including gene knockout, gene inactivation, gene knock-in, point mutation, deletion mutation, and large chromosome group deletion. "Gene knockout" refers to the specific deletion or inactivation of a specific gene in the genome of an organism by experimental means, so that it cannot express or produce functional proteins. The present invention uses gene knockout technology to knock out the RAB20 gene in the host cell, and the obtained monoclonal cell line with loss of function of the protein encoded by the RAB20 gene can promote the replication level of FMDV and SVA viruses; the present invention can also construct a cell line with loss of function of the protein encoded by the RAB20 gene by mutating the RAB20 gene in the host cell, or inserting a gene fragment, resulting in a frameshift mutation in the protein encoded by the RAB20 gene.

[0057] The term "sgRNA" stands for single-stranded guide RNA, which is a key component in the CRISPR / Cas9 gene editing system. Through its specific sequence, it guides the Cas9 nuclease to the target site in the genome to achieve precise gene editing.

[0058] The present invention utilizes CRISPR / Cas9 gene editing technology, by designing sgRNA targeting RAB20 gene, specifically knocking out RAB20 gene. And taking PK-15 cells as an example, the method of RAB20 gene knockout is described in detail. Although the present invention only knocks out RAB20 gene in PK-15 cells, and obtains RAB20 gene knockout cells, the method described in the present invention can be inferred and extended to the knockout of RAB20 gene in other host cells, and constructs a gene knockout cell line with enhanced FMDV, SVA virus replication and antigen expression.

[0059] The directional recognition and shearing of genes by CRISPR / Cas9 gene editing technology are realized by sgRNA and Cas9. SgRNA determines the targeting of Cas9 and also determines the cutting activity of Cas9. By designing sgRNA targeting specific genes, guiding Cas9 protein to bind to the specific sequence position of specific genes, cutting DNA double strands, causing gene double strand breaks, and generating random mutations under the action of the cell's own repair mechanism. Mutations such as deletion or insertion of nucleotides will cause the reading frame of the gene to change, and finally achieve the purpose of loss of gene-encoded protein function, and obtain a cell line with loss of gene-encoded protein function. The present invention aims to apply CRISPR / Cas9 gene editing technology, by in vitro and in vivo screening of sgRNA sequences for RAB20 gene, to achieve accurate and efficient knockout of RAB20 gene, and obtain a RAB20 gene knockout cell line that can promote FMDV, SVA virus replication and antigen expression, thereby providing new strategies and material support for the production of FMDV and SVA small RNA virus vaccines.

[0060] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0061] In the following embodiments, unless otherwise specified, all of them are conventional methods.

[0062] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0063] The FMDV (O / BY / CHA / 2010 strain) used in the following examples is preserved by the National Foot-and-Mouth Disease Reference Laboratory designated by the Ministry of Agriculture and Rural Affairs; the recombinant Seneca virus Re-SVA-EGFP labeled with EGFP is constructed and preserved by the Foot-and-Mouth Disease and Emerging Disease Epidemiology Team of the Lanzhou Veterinary Research Institute of the Chinese Academy of Agricultural Sciences (the preparation method of Re-SVA-EGFP is: using gene synthesis technology, the EGFP gene is fused with the Teschovirus 2A gene (T2A) to obtain the EGFP-T2A gene fragment, and the EGFP-T2A fusion gene is inserted between the Seneca virus genes 2A and 2B of the eukaryotic transcription plasmid prSVV / FJ-M (the eukaryotic transcription plasmid prSVV / FJ-M used is disclosed in the authorized invention patent "A Seneca virus recombinant nucleic acid, recombinant vaccine strain and its preparation method and application", ZL 202010212460.6), and the detailed preparation method is obtained according to the corresponding preparation method in the following reference: Chen Z.etal(2016). "Construction and characterization of a full-length cDNA infectiousclone of emerging porcine Senecavirus A". Virolog-y.2016,497:111-124).

[0064] Example 1

[0065] Effect of overexpression of RAB20 on FMDV replication

[0066] 1. Construction of RAB20 eukaryotic expression plasmid

[0067] Query the RAB20 gene sequence in the NCBI database and design primers, RAB20-NheI-F: CGTCTA G CTAGC ATGAGAAAGCCAGACGGGAAGATCG (SEQ ID NO. 9) (underlined NheI restriction site); RAB20-BamHI-R: CGC GGATCCGGCGCAGCACCCAGATCTG GTCCG (SEQ ID NO.10) (underlined for BamHI restriction site). RNA of PK-15 cells was extracted, reverse transcribed into cDNA, and used as a template to amplify the RAB20 gene (nucleotide sequence as shown in SEQ ID NO.7, amino acid sequence as shown in SEQ ID NO.8), nucleic acid electrophoresis was used to recover the amplified fragment, double digested with NheI and BamHI restriction endonucleases, and the pc DNA3.1 / myc vector plasmid was double digested with the same restriction endonucleases, and the RAB20 gene and the linearized vector fragment were purified and recovered respectively, connected at 4°C overnight with T4 ligase, transformed into DH5α competent cells, plasmids were extracted and sequenced, and the successfully constructed plasmid was named RAB20-Myc.

[0068] 2. Effect of overexpression of RAB20 on FMDV replication

[0069] PK-15 cells were seeded into 6-well plates and incubated at 37°C with 5% CO. 2 The cells were cultured in a cell culture incubator until the cell density reached about 70%, and then transfected with different doses (0 μg, 1 μg, 3 μg) of the RAB20 eukaryotic expression plasmid RAB20-Myc. After 24 hours, the cells were infected with FMDV and analyzed by Western-blot.

[0070] The results are as follows Figure 1 As shown, overexpression of RAB20 in PK-15 cells inhibited the protein abundance of FMDV virus in a dose-dependent manner.

[0071] Example 2 Construction of RAB20 gene knockout PK-15 cell line

[0072] 1. Design of sgRNA target

[0073] According to the RAB20 gene sequence in the NCBI database, the sgRNA sequence RAB20-sgRNA1 was designed at position 361 in the first exon region of the RAB20 gene, and the sgRNA sequence RAB20-sgRNA2 was designed at position 21073 in the second exon region of the RAB20 gene. See the schematic diagram Figure 2 .

[0074] The targeting sequence of RAB20-sgRNA1 is: AAAAGCACGATCTTCCCGTC (SEQ ID NO. 1);

[0075] RAB20-sgRNA1-F (5′-CACCGAAAAGCACGATCTTCCCGTC-3′, SEQ ID NO. 3) and RAB20-sgRNA1-R (5′-AAACGACGGGAAGATCGTGCTTTTC-3′, SEQ ID NO. 4) were synthesized according to the targeting sequence of RAB20-sgRNA1;

[0076] The targeting sequence of RAB20-sgRNA2 is: CGACTGCCTCTTCGCCATCG (SEQ ID NO. 2);

[0077] RAB20-sgRNA2-F (5'-CACCGCGACTGCCTCTTCGCCATCG-3', SEQ ID NO. 5) and RAB20-sgRNA2-R (5'-AAACCGATGGCGAAGAGGCAGTCGC-3', SEQ ID NO. 6) were synthesized according to the targeting sequence of RAB20-sgRNA2;

[0078] 2. Construction of PX459-RAB20-sgRNA recombinant plasmid

[0079] The synthesized sgRNA upstream and downstream sequences were diluted to 10 μmol / L, 22.5 μL each was taken, and 10×PCR buffer 5 μL was added to prepare a 50 μL system, annealed at 95°C for 5 min, so that the upstream and downstream primers formed double strands; the PX459 vector plasmid was digested with restriction endonuclease Bbs I, and the digestion product was subjected to 1% agarose gel electrophoresis, and the linearized vector fragment was recovered by gel cutting, and it was connected with the double-stranded sgRNA by T4 ligase; the ligation product was transformed into Escherichia coli DH5α competent cells, and a single colony was picked for shaking culture, and the plasmid was extracted and sent to Xi'an Qingke Biotechnology Co., Ltd. for sequencing. The positive recombinant plasmids identified by sequencing were named: PX459-RAB20-sgRNA1 and PX459-RAB20-sgRNA2.

[0080] 3. Cell Transfection and Screening

[0081] By Polyplus Transfection reagent instructions: transfect PK-15 cells with sgRNA recombinant plasmids for 24 to 48 hours. After the cells have grown to a full monolayer, digest them with trypsin and add puromycin at a final concentration of 2 μg / mL. Select them for 3 consecutive days, then replace the complete medium. When the cells grow to about 70%, digest the cells with trypsin and count them. Dilute the cells with complete medium containing puromycin and inoculate them into 96-well cell plates so that there is one cell in each well. Incubate at 37°C and 5% CO 2The cells were cultured in the incubator for 7 days, and the monoclonal cell wells with good growth status were observed and marked, and then subcultured to 48-well plates and 24-well plates for expansion culture.

[0082] 4. Identification of Monoclonal Cell Lines

[0083] Different cell clones were collected and identified at the gene level and protein level.

[0084] 4.1 The DNA of the monoclonal cell line to be identified was extracted according to the instructions of the genomic DNA extraction kit, and the fragments containing the sgRNA targeting site were amplified using identification primers (RAB20-F1: 5'-TCTGGACACCTTGAGTGGGC-3' (SEQ ID NO.11); RAB20-R1: 5'-AGCAAAGGGAAGTAGGAGTAGAA-3' (SEQ ID NO.12); RAB20-F2: 5'-TGTGCAGAAATGCTGACCCT-3' (SEQ ID NO.13); RAB20-R2: 5'-TTTCGAACAGCAGATCCACGTT-3' (SEQ ID NO.14)). After 1% agarose gel electrophoresis, the amplified products were recovered from the gel and sent to Xi'an Qingke Biotechnology Co., Ltd. for sequencing, and the sequencing results were analyzed. The cell lines with frameshift mutations caused by deletion, insertion, etc. of the gene sequence were marked as PK-15-RAB20-KO (RAB20 gene knockout cell line), and named PK-15-RAB20-KO1 (marked as RAB20-KO-1, obtained by transfection with the recombinant plasmid PX459-RAB20-sgRNA1) and PK-15-RAB20-KO2 (marked as RAB20-KO-2, obtained by transfection with the recombinant plasmid PX459-RAB20-sgRNA2).

[0085] The results are as follows Figure 3 and Figure 4 As shown, PK-15-RAB20-KO1 has a 1-base insertion at the predetermined cleavage position of exon 1, and PK-15-RAB20-KO2 has a 1-base insertion at the predetermined cleavage position of exon 2, both of which lead to frameshift mutations in the RAB20 gene sequence.

[0086] 4.2 In order to further confirm the knockout effect of RAB20 in the cell lines identified by sequencing, identification was performed at the protein level, and the expression of RAB20 protein in the monoclonal cell lines to be identified was analyzed by Western blot. Among them, rabbit anti-RAB20 polyclonal antibody was purchased from ABclonal.

[0087] The results are as follows Figure 5As shown in the figure, the expression of RAB20 protein was not detected in PK-15-RAB20-KO1 and PK-15-RAB20-KO2 cells. The above results indicate that the RAB20 gene knockout PK-15 cell line was successfully constructed.

[0088] Example 3 Viability detection of RAB20 gene knockout PK-15 cell line

[0089] The RAB20 gene knockout PK-15 cells PK-15-RAB20-KO1 and PK-15-RAB20-KO2 used in this example were prepared in Example 2.

[0090] RAB20 gene knockout PK-15 cells PK-15-RAB20-KO1 and PK-15-RAB20-KO2 and wild-type control cells (PK-15-RAB20-WT) were digested with trypsin, and the cell suspension density was adjusted and inoculated into 96-well cell culture plates at 100 μL / well. The plates were placed at 37°C and 5% CO 2 The cells were cultured in a cell culture incubator for 8 h; then 10 μL of CCK-8 solution was added to each well and cultured for another 4 h. The OD value at 450 nm was measured using an ELISA reader and the data were analyzed.

[0091] The results are as follows Figure 6 As shown, there was no significant difference in cell viability between RAB20 gene knockout PK-15 cells PK-15-RAB20-KO1 and PK-15-RAB20-KO2 and wild-type control cells, indicating that knockout of the RAB20 gene did not affect the normal growth characteristics of cells.

[0092] Example 4 Effect of knocking out the RAB20 gene on FMDV replication

[0093] The RAB20 gene knockout PK-15 cells PK-15-RAB20-KO1 and PK-15-RAB20-KO2 used in this example were prepared in Example 2.

[0094] 1. RT-qPCR analysis

[0095] The RAB20 gene knockout PK-15 cell lines PK-15-RAB20-KO1 and PK-15-RAB20-KO2 and wild-type control cells (PK-15-RAB20-WT) were infected with FMDV, and the cell samples were collected after 12 h. Total RNA was extracted with Trizol and reverse transcribed. GAPDH was used as the internal reference gene, and the relative mRNA level of FMDV was quantitatively detected by qPCR.

[0096] The results are as follows Figure 7As shown: After infection with FMDV, the mRNA level of FMDV in knockout RAB20 cells was significantly increased compared with that in wild-type control cells.

[0097] 2. Western blot analysis

[0098] RAB20 gene knockout PK-15 cell lines PK-15-RAB20-KO1 and PK-15-RAB20-KO2 and wild-type control cells (PK-15-RAB20-WT) were infected with FMDV, and the cells were harvested at 12 h to prepare protein samples. Western blot analysis was performed using rabbit anti-RAB20 antibody, rabbit anti-O-type FMDV antibody and mouse anti-β-Actin antibody as primary antibodies, and HRP-labeled goat anti-rabbit IgG and HRP-labeled goat anti-mouse IgG antibodies as secondary antibodies.

[0099] The results are as follows Figure 8 As shown, the abundance of FMDV viral proteins in RAB20 knockout cells was significantly higher than that in wild-type control cells.

[0100] 3. Indirect Immunofluorescence Assay

[0101] FMDV was used to infect RAB20 knockout PK-15 cell lines PK-15-RAB20-KO1 and PK-15-RAB20-KO2 and wild-type control cells (PK-15-RAB20-WT), and the cell lesions were observed. The supernatant was discarded, and the cells were washed 3 times with PBS, fixed with 4% paraformaldehyde at room temperature for 30 minutes; washed 3 times with PBS, permeabilized with 0.3% TritonX-100 at room temperature for 30 minutes; washed 3 times with PBS, and blocked with 5% BSA at 4℃ for 4 hours. FMDV rabbit polyclonal antibody was used as the primary antibody, incubated at 4℃ overnight, washed 3 times with PBST, 10 minutes / time; FITC-labeled goat anti-rabbit IgG was used as the secondary antibody, incubated at 4℃ in the dark overnight, washed 3 times with PBST, 10 minutes / time; finally, DAPI was added, the nucleus was stained at room temperature for 15 minutes, and the fluorescence was observed and analyzed by laser confocal microscopy.

[0102] The results are as follows Fig. 9 As shown, the green fluorescence in the RAB20 gene knockout PK-15 cells PK-15-RAB20-KO1 and PK-15-RAB20-KO2 was significantly higher than that in the wild-type control cells, indicating that the replication of FMDV in the RAB20 gene knockout cells was significantly increased compared with the wild-type control cells.

[0103] 4.TCID 50 Determination

[0104] FMDV was used to infect RAB20 gene knockout PK-15 cells PK-15-RAB20-KO1 and PK-15-RAB20-KO2 and wild-type control cells (PK-15-RAB20-WT), respectively. Virus fluid was collected at 18 h, and repeated freezing and thawing for 3 times. The samples were diluted 10 times in DMEM medium and inoculated into 96-well culture plates with BHK-21 cells growing in monolayers. Each dilution had 8 wells and was placed at 37°C and 5% CO. 2 The cells were cultured in an incubator for 3 days, and the cytopathic effect was observed. The TCID of the virus was calculated according to the Reed-Muench method. 50 .

[0105] The results are as follows Fig.10 The results showed that the viral titer of FMDV in RAB20 gene knockout PK-15 cells PK-15-RAB20-KO1 and PK-15-RAB20-KO2 was significantly higher than that in wild-type control cells, indicating that the replication level of FMDV in cells with RAB20 gene knockout was significantly increased compared with wild-type cells.

[0106] The above results all indicate that knocking out the RAB20 gene can significantly promote the replication level of FMDV.

[0107] Example 5 Effect of knocking out the RAB20 gene on SVA replication

[0108] The RAB20 gene knockout PK-15 cells RAB20-KO-1 and RAB20-KO-2 used in this example were prepared in Example 2.

[0109] The recombinant Senecavirus Re-SVA-EGFP with EGFP fluorescence label was used to infect RAB20 gene knockout PK-15 cell lines RAB20-KO-1 and RAB20-KO-2 and wild-type control cells (WT) and observed under a fluorescence microscope.

[0110] The results are as follows Fig.11 As shown: After infection with Re-SVA-EGFP, the green fluorescence in RAB20-KO-1 and RAB20-KO-2 PK-15 cells with RAB20 gene knockout was significantly higher than that in wild-type control cells, indicating that the replication level of SVA in cells with RAB20 gene knockout was significantly increased compared with wild-type cells.

[0111] The above results show that the RAB20 gene knockout cell line can significantly promote the replication of Picornaviridae viruses FMDV and SVA, and can be used for the production of Picornaviridae virus vaccines.

[0112] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. The use of RAB20 protein or RAB20 gene as a target in the preparation of products regulating the replication of Picornaviridae viruses and / or in vaccine production.

2. The use according to claim 1, characterized in that: The Picornaviridae virus includes foot-and-mouth disease virus and / or Seneca virus.

3. The use according to claim 1 or 2, characterized in that: The regulatory effect is exerted by up-regulating or down-regulating the expression of the RAB20 gene; up-regulating the expression of the RAB20 gene can inhibit the replication of Picornaviridae viruses, while down-regulating the expression of the RAB20 gene can promote the replication of Picornaviridae viruses.

4. The use according to claim 3, characterized in that: The method of reducing the expression level of the RAB20 gene includes interfering with the expression of the RAB20 gene or knocking out the RAB20 gene; preferably, the sgRNA for knocking out the RAB20 gene includes RAB20-sgRNA1 and / or RAB20-sgRNA2; the targeting sequence of the RAB20-sgRNA1 is shown in SEQ ID NO.1; the targeting sequence of the RAB20-sgRNA2 is shown in SEQ ID NO.

2.

5. A sgRNA for knocking out the RAB20 gene, characterized in that: The sgRNA includes RAB20-sgRNA1 and / or RAB20-sgRNA2; The targeting sequence of the RAB20-sgRNA1 is shown in SEQ ID NO.1; The targeting sequence of the RAB20-sgRNA2 is shown in SEQ ID NO.

2.

6. The sgRNA according to claim 5, characterized in that The RAB20-sgRNA1 is a double-stranded fragment formed by annealing RAB20-sgRNA1-F and RAB20-sgRNA1-R; the RAB20-sgRNA2 is a double-stranded fragment formed by annealing RAB20-sgRNA2-F and RAB20-sgRNA2-R; The gene sequence of RAB20-sgRNA1-F is shown in SEQ ID NO.3; The gene sequence of RAB20-sgRNA1-R is shown in SEQ ID NO.4; The gene sequence of RAB20-sgRNA2-F is shown in SEQ ID NO.5; The gene sequence of the RAB20-sgRNA2-R is shown in SEQ ID NO.

6.

7. A reagent or kit for knocking out the RAB20 gene, characterized in that: The reagent or kit comprises the sgRNA according to claim 5 or 6; preferably, the reagent or kit further comprises a coding sequence of the Cas9 protein.

8. Use of the sgRNA according to claim 5 or 6 or the reagent or kit according to claim 7 in preparing a cell line in which the protein encoded by the RAB20 gene has lost its function.

9. A cell line in which the protein encoded by the RAB20 gene has lost its function, characterized in that: The cell line is obtained by knocking out the RAB20 gene in the host cell using the sgRNA according to claim 5 or 6 or the reagent or kit according to claim 7.

10. Use of the sgRNA according to claim 5 or 6, the reagent or kit according to claim 7, or the cell line according to claim 9 in the production of Picornaviridae viruses and / or Picornaviridae virus vaccines.

Images