Application of gene OsCYP72A1 for regulating nitrogen utilization in rice breeding

Abstract

The invention provides application of a gene OsCYP72A1 for regulating and controlling nitrogen utilization in rice breeding, and relates to the field of plant nutrition molecular biology. Through a CRISPR-Cas9 (clustered regularly interspaced short palindromic repeats-associated 9) gene editing technology, the OsCYP72A1 gene function deletion type rice strain is successfully constructed. A field experiment result shows that under the conditions of low nitrogen (50kg urea / hectare), medium nitrogen (150kg urea / hectare) and high nitrogen (300kg urea / hectare), compared with wild rice, the OsCYP72A1 gene editing strain remarkably improves the nitrogen fertilizer utilization efficiency by taking the single plant yield as an evaluation index, and improves agronomic traits such as tiller number, grain number per ear, thousand seed weight and biomass. The results show that the OsCYP72A1 gene plays a key role in the nitrogen absorption and utilization and yield formation process of rice, and the application value of the OsCYP72A1 gene in the aspect of cultivating new varieties of environment-friendly crops is shown.

Description

Technical Field

[0001] The invention belongs to the field of plant nutrition molecular biology, and specifically relates to the application of regulating nitrogen utilization gene OsCYP72A1 in rice breeding. Background Art

[0002] The application of fertilizers, especially nitrogen fertilizers, has played an indispensable role in increasing rice production and greatly alleviated the problem of food shortage caused by population growth. However, over time, the long-term excessive use of fertilizers has gradually revealed a series of negative effects: deterioration of soil structure and nutrient imbalance; increased air pollution, such as ammonia volatilization and nitrous oxide emissions; eutrophication of water bodies, leading to frequent algae outbreaks and other problems. At the same time, over-reliance on fertilizers has also led to an increase in the incidence of rice diseases and pests, forcing farmers to increase the use of pesticides, which not only increases agricultural production costs, but also further threatens the safety and quality of rice. These challenges have seriously affected the health and stability of agricultural ecosystems and hindered the sustainable development of agriculture. In response to these problems, scientists have begun to explore new solutions aimed at improving the nutrient utilization efficiency of crops themselves. One of the important strategies is to cultivate new varieties that can reduce dependence on external fertilizers - the so-called "nutrient-efficient crops". Such crops can maintain or even increase yields while reducing fertilizer inputs, which has far-reaching significance for ensuring food safety and improving environmental quality.

[0003] Nitrogen is the largest mineral element required for plant growth and plays a central role in the formation of crop yields. Under natural conditions, plants mainly absorb nitrate (NO 3- ) and ammonium salts (NH 4 + ) to obtain nitrogen nutrition. In paddy field ecosystems, due to its unique flooding management mode, the soil is in an anaerobic state, which promotes the accumulation of ammonium nitrogen, making it the main source of nitrogen for rice. Therefore, enhancing rice's ability to absorb ammonium nitrogen and its metabolic conversion efficiency is the key to developing new nitrogen-efficient rice varieties. In order to tap into rice ammonium-efficient gene resources, we used 171 rice mini-core germplasm materials and identified OsCYP72A1, a key gene that negatively regulates rice ammonium utilization, through genome-wide association analysis of biomass ammonium response phenotypes. Summary of the invention

[0004] The gene number of OsCYP72A1 is LOC_Os03g25500, and the gene OsCYP72A1 encodes a cytochrome P450 protein composed of 209 amino acids with a molecular weight of 23.9kDa. Studies on OsCYP72A1 functionally deficient rice lines constructed by CRISPR-Cas9 gene editing technology revealed that under different nitrogen supply levels (low nitrogen, medium nitrogen and high nitrogen), the edited lines showed higher tiller numbers, panicle grain numbers, thousand-grain weight and single plant yield compared with the wild type. These results indicate that modification of the OsCYP72A1 gene not only enhances the nitrogen fertilizer utilization efficiency of rice, but also improves the yield potential of the crop.

[0005] The present invention provides the following technical solutions:

[0006] The OsCYP72A1 gene was knocked out in rice using CRISPR-Cas9 gene editing technology, and two loss-of-function rice strains were obtained, one with one base pair added and the other with two base pairs deleted in the first exon, resulting in a frameshift mutation.

[0007] Furthermore, the nucleotide sequence of the OsCYP72A1 gene is shown in SEQ ID NO.1, which contains three exon sequences and several intron sequences, and the first exon sequence is: ATGGACTCCATCCTTCTCCTGCCTCTGGTTGCTCTCCTAGTTGTTGCCATCTCATGGCTATGGGATTACACCGTCGTGCGACTGATTTGGAGGCCTCACTGCATAGCCAAGGAATTCAGAGAGAAGCAGGGGATCCGTGGACCTGCCTACAAGTTCTTGGGAGGCAACAATGGCGAAATCAGCAGGTTGAAGGAGGCAGATGGCCAGGTGTTGGATAATCTTCGTGACCACAACTACCTCCCAAGGATAGCACCTCACTTCCTCAAATGGAGGGCTCAGTATG.

[0008] The second exon sequence is:

[0009] GAGAAGCGTTTCTGTTTTGGTATGGAGCAAAGCCACGCATCTGCATTTTC

[0010] GACTATGAGTTGGCTAGGCAGATTCTCTCGAGCAAGTCTGGACATTTTCT

[0011] GAAGAATGATGCGCCCCCAACTCTGGTGGCCCTAATGGGCAAGGGATTA

[0012] GTACTCTTGGAAGGCACTGATTGGGTGCGCCATCGCAGGGTAATCAACCCTGCTTTTAACATGGACAAGCTCAAG。

[0013] The sequence of the third exon is:

[0014] ATGATGATAAGCACAATGACGGGTTGTGCTCAAAGCTTGGCCAAGGAGT

[0015] TAGAGGATGTCGCAGCCAAGAACAAGGACAGAGTAACAGAGGTCGACCTCAACCAAAAATTCAGATAG。

[0016] There is a first intron sequence between the first exon sequence and the second exon sequence, a second intron sequence between the second exon sequence and the third exon sequence, and a third intron sequence after the third exon sequence.

[0017] Furthermore, the amino acid sequence of the OsCYP72A1 gene is shown in SEQ ID NO.2.

[0018] Furthermore, the editing target of the OsCYP72A1 gene is shown in SEQ ID NO.3.

[0019] The present invention provides the application of the nitrogen utilization regulation gene OsCYP72A1 in rice breeding. The rice lines with the loss of function of the gene OsCYP72A1 have significantly improved nitrogen fertilizer utilization efficiency under low nitrogen, medium nitrogen and high nitrogen supply conditions, indicating that the gene OsCYP72A1 plays an important role in regulating the nitrogen absorption and utilization of rice.

[0020] The present invention provides the application of the gene OsCYP72A1 in improving at least one agronomic trait of rice, and these traits include but are not limited to tiller number, spikelet number per panicle, 1000-grain weight and biomass. The rice lines with the loss of function of the gene OsCYP72A1 have significantly improved one or more agronomic traits under low nitrogen, medium nitrogen and high nitrogen supply conditions, indicating that the gene OsCYP72A1 plays an important role in regulating the rice yield.

[0021] Compared with the prior art, the beneficial effects of the present invention are reflected in the following aspects:

[0022] (1) The present invention provides a new biological function of the gene OsCYP72A1.

[0023] (2) The present invention uses the CRISPR-Cas9 gene editing technology to cultivate a rice line with a loss-of-function of the gene OsCYP72A1. The research results show that these edited lines not only significantly enhance the nitrogen use efficiency of rice, but also improve the yield potential of crops. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art.

[0025] In the drawings:

[0026] Figure 1 Schematic diagram of the CRISPR-Cas9 editing vector for the OsCYP72A1 gene;

[0027] Figure 2 Editing sites of two edited lines;

[0028] Figure 3 Plant morphology, grain traits, number of grains per panicle, 1000-grain weight, tiller number, above-ground biomass and yield per plant of the edited lines and wild-type materials in low-nitrogen fields;

[0029] Figure 4 Plant morphology, grain traits, number of grains per panicle, 1000-grain weight, tiller number, above-ground biomass and yield per plant of the edited lines and wild-type materials in medium-nitrogen fields;

[0030] Figure 5 Plant morphology, grain traits, number of grains per panicle, 1000-grain weight, tiller number, above-ground biomass and yield per plant of the edited lines and wild-type materials in high-nitrogen fields. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0031] The following embodiments are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Without departing from the spirit and essence of the present invention, any modification or replacement of the methods, steps or conditions of the present invention belongs to the protection scope of the present invention. If not specifically specified, the experimental materials, reagents, instruments, etc. used in the embodiments of the present invention can be obtained commercially; if not specifically specified, all the technical means in the embodiments of the present invention are conventional means well known to those skilled in the art.

[0032] The present invention provides a method for obtaining an OsCYP72A1 gene-edited line, comprising the following steps:

[0033] 1. Obtain a Crisper-cas9 vector with the OsCYP72A1 target site

[0034] 1) Target prediction: Use CRISPR-PGE: http: / / skl.scau.edu.cn:8000 / home / to predict targets. Design targets in the ORF5' region or functional domain so that mutations in the target can cause loss of function. Select targets with off-target scores lower than 0.2, and the GC content of the target should not be lower than 40%. The target selected is CCGTCGTGCGACTGATTTGG. Design primers according to the website, select OsU3 promoter and method2, and obtain the primer sequences as follows:

[0035] gRT1:CCGTCGTGCGACTGATTTGGgttttagagctagaaat

[0036] OsU3T1:CCAAATCAGTCGCACGACGGTgccacggatcatctgc

[0037] 2) Connection and amplification of sgRNA expression cassette: Use Overlapping-PCR to introduce the target sequence into the sgRNA expression cassette. Step 1: Use a 15ul system, take 2-5ngpYLgRNA-OsU# plasmid as a template, take UF: CTCCGTTTTACCTGTGGAATCG and gRNA-R: CGGAGGAAAATTCCATCCAC 0.2μM each, OsU3T1 and gRT1 0.1μM each. UF and OsU3T1 are used to amplify the promoter, gRT1 and gRNA-R are used to amplify the sgRNA, and the promoter and sgRNA are amplified in two tubes. The PCR program is as follows: 94℃ pre-denaturation for 2min, 98℃ denaturation for 10s, 60℃ annealing for 30s and 68℃ extension for 20s, 30 cycles from denaturation to extension, and finally 68℃ final extension for 7min. The obtained PCR product fragments are relatively small and are detected by electrophoresis using 1.2% agarose gel. After electrophoresis, the target bands are recovered under a UV gel exciter and the products are purified using a gel recovery kit. The gel recovered products are used for the next PCR step.

[0038] Step 2: Use 1 μL (10 ng) of each gel recovery product obtained in the first step as a template for PCR amplification, using KODPlus Neo enzyme, and select primers:

[0039] Pps-R:TTCAGAggtctcTaccgACTAGTATGGAATCGGCAGCAAAGG,

[0040] Pgs-2: AGCGTGggtctcGtcagggTCCATCCACTCCAAGCTC, the PCR procedure is the same as the first step. After the PCR reaction is completed, the PCR product is directly recovered using a DNA purification kit.

[0041] 3) Connect the sgRNA expression cassette to the pYLCRISPR / Cas9 vector: Connect the sgRNA expression cassette to the Crisper-cas9 empty vector, use T4 ligase, and the system is 15μL. Pre-denature at 37℃ for 15min, and perform enzyme digestion and ligation using a variable temperature cycle for about 13 cycles: 37℃, 5min; 10℃, 3min; 20℃, 5min; and finally 37℃, 10min. See the vector map for details. Figure 1 .

[0042] 4) Transformation of ligation product: The obtained ligation product was transformed, and the DH5α E. coli competent cells were placed on ice to thaw, and then the ligation product was added to the competent cells, placed on ice for 5 minutes, and heat-shocked in a 42°C water bath for 45 seconds. After adding 600 μL of antibiotic-free LB medium and resuscitating in a 37°C shaker for 30 minutes, it was spread on the resistance solid medium of Kanna and placed inverted in a 37°C incubator for 10 hours.

[0043] 5) Colony PCR: Select a single clone on the culture medium as a template, use SP-L1: GCGGTGTCATCTATGTTACTAG and SP-R: TGCAATAACTTCGTATAGGC as primers for PCR amplification, use 2×GS TaqPCR mix, and the PCR program is as follows: 94℃ pre-denaturation for 5min, 94℃ denaturation for 10s, 55℃ annealing for 30s and 72℃ extension for 80s, 35 cycles from denaturation to extension, and finally 72℃ final extension for 5min. The PCR product was tested for nucleic acid, and the one with bands was sent to a sequencing company for sequencing.

[0044] 6) Introduction of Agrobacterium: Obtain the plasmid using a small plasmid kit to obtain the correct colony sequence, and then use EHA105 competent cells for Agrobacterium transformation. After thawing EHA105 on ice, add 5 μL of plasmid, put it in liquid nitrogen for quick freezing for 1 minute, and then melt it in a 37°C water bath. After it is completely thawed, use liquid nitrogen to quick freeze again. Repeat this three times, add 500 μL of non-antibiotic LB, shake it at 28°C for 2-3 hours, and then spread it on the solid medium of Canarifampicin resistance. After placing it upside down in a 28°C incubator for 2 days, pick a single clone and shake it in Canarifampicin liquid medium for 10 hours.

[0045] 2. Obtaining transgenic plants

[0046] The specific preparation of transgenic plants is as follows:

[0047] 1) Agrobacterium-mediated rice transformation

[0048] Preparation of callus tissue: Peel the rice seeds and place them in a triangular bottle. Wash them with 70% alcohol for 0.5-1min, then pour off the alcohol. Then gently shake and wash them with 5% sodium hypochlorite for 30min. After washing, wash them with sterilized water for more than 5 times to remove excess water, sow them on NBO medium, and culture them in the dark at 25℃ for 10 days.

[0049] Callus subculture: After 10 days of dark culture, remove the buds and seeds. Inoculate the callus on NBO and culture for 20-30 days.

[0050] Preparation of Agrobacterium: Spread the Agrobacterium stock solution on LB solid plates with (Rif, Kana, Strep) and culture at 28°C for 2.5 days.

[0051] Co-culture: Pour 40mL of AAM solution into a 50mL centrifuge tube, add 40μL of acetosyringone (100mM), and then scrape 1 / 4 teaspoon of bacteria from the plate and suspend it in the AAM solution, making sure that the bacterial solution is completely suspended and evenly distributed. Immerse the cultured callus (light yellow hard round callus) in it for 15-30 minutes and shake it gently, then take out the callus, remove the excess bacterial solution, and place it on the NA medium, and culture it in the dark at 25℃ for 2-3 days.

[0052] Resistance screening: Wash the co-cultured callus with sterile water for several times, add cephalosporin and wash for another 30 minutes. Pour the water out and pour the callus onto filter paper, remove excess water and place on S medium, and culture at 25°C in the dark for 20-30 days.

[0053] Differentiation: Select resistant callus and place it on P medium, incubate in the dark at 25℃ for 20 days. After the callus turns white, subculture it on R medium and incubate in the light at 28℃ for about 7 days until seedlings emerge.

[0054] Seedling cultivation: The green buds obtained above were transferred to 1 / 2MS culture medium and cultured under light at 28°C. They can be transplanted after growing for two weeks.

[0055] Transplantation of transgenic seedlings: Pick out the test tube seedlings with relatively intact growth and well-developed root system, open the sealing film, add appropriate amount of sterile water, place them in the light culture room for about 7 days, then wash off the culture medium, and transplant them to the greenhouse for growth in the soil.

[0056] 2) T0 generation plant gene editing detection

[0057] After the transgenic seedlings in the field have grown for about two weeks, the leaves of about 3 to 5 cm are cut and DNA is extracted for transgenic plant detection. The method for extracting genomic DNA is as follows:

[0058] Place the leaves in a 2mL centrifuge tube and add 5mM steel beads. Use a cell disruptor to oscillate for 2 minutes to ensure that the leaves are broken. Add 600μL of 2% CTAB extract to the centrifuge tube, mix it upside down, and place it in a 65℃ oven for 15 minutes. During this period, you can invert it several times to ensure uniform heating. Add 300μL chloroform in the fume hood, vortex and mix with a vortex instrument, then let it stand for 5 minutes, and you can see obvious stratification. Then centrifuge at 12,000rpm for 10 minutes at room temperature, gently pipette 300μL supernatant into a new 1.5mL centrifuge tube, add 300μL isopropanol, gently invert and mix, then place at -20℃ for 30min, then centrifuge at 12,000rpm for 10min at room temperature, pour out the supernatant, and you can clearly see the white precipitate, then add 1mL 70% ethanol to wash the precipitate, centrifuge at 12,000rpm for 1min, pour out the supernatant, repeat the washing twice, blow dry the alcohol precipitate in the clean bench until it is translucent, and add 100μL sterile water to dissolve the precipitate. You can get genomic DNA with high purity for subsequent fragment amplification.

[0059] After extraction, PCR was performed using 2×Es Taq MasterMix. The primer sequences were:

[0060] F:CGGTATAGAGGCTGTGTCAG

[0061] R:GACGATTAAACGTTGGACGG

[0062] The PCR product was subsequently tested for nucleic acid. The target band was 949 bp. The PCR program was as follows: 94°C pre-denaturation for 2 min, 94°C denaturation for 30 s, 55°C annealing for 30 s, and 72°C extension for 30 s. 32 cycles were performed from denaturation to extension, and finally 72°C final extension for 5 min. The samples with the target band were sent to the sequencing company for testing, and the T0 generation plants with edited target sites were identified, and T1 generation seeds were harvested.

[0063] 3) Homozygous detection of T1 generation plants

[0064] The T1 generation seeds were soaked and germinated, then sown in the field. After the transgenic seedlings grew for about three weeks, leaves of about 3 to 5 cm were cut and DNA was extracted for transgenic plant detection. The detection method was as above, and the T1 generation obtained target site edited and homozygous Crisper-cas9 mutant materials. Gene editing sites refer to Figure 2 .

[0065] 4) Obtaining materials to remove the Cas9 transgenic element

[0066] The resistance gene HPT II was detected in the T2 generation homozygous Crisper-cas9 mutant material. After extracting plant DNA, PCR identification was performed, and the primer sequence was:

[0067] F:CAAAGATCGTTATGTTTATCGGCACT

[0068] R:TTGGCGACCTCGTATTGGGAA

[0069] The PCR program was 94°C pre-denaturation for 2 min, 94°C denaturation for 30 s, 60°C annealing for 30 s, 72°C extension for 30 s, 28 cycles, and the obtained PCR products were detected by agarose gel electrophoresis. If there was no band, it was identified as material without Cas9 transgenic elements. This material was used for field experiments.

[0070] 3. Agronomic traits and yield investigation of edited strains

[0071] The edited lines were named oscyp72a1-cr1 and oscyp72a1-cr2, and the wild-type rice Nipponbare was named Nip. The gene-edited lines and wild-type rice were planted in rice fields with low nitrogen (50 kg urea / hectare), medium nitrogen (150 kg urea / hectare), and high nitrogen (300 kg urea / hectare), respectively. At the maturity stage of rice, the plants were phenotypically observed and statistically analyzed, and the evaluation indicators included plant height, number of tillers, number of panicles, thousand-grain weight, aboveground biomass, and yield per plant. The evaluation method is as follows:

[0072] Plant height: Use a ruler to measure. Take the flag leaf of the plant as the highest point in the field. Use a ruler to measure the distance from the base of the plant to the top of the flag leaf, which is the plant height.

[0073] Number of tillers: Tillers with more than 5 ears are defined as effective tillers. The number of effective tillers is counted, avoiding counting plants on the side rows.

[0074] Number of grains per ear: Count the number of filled grains on the main ear of each plant. The main ear is the ear that is highest from the ground.

[0075] Thousand-grain weight: After the rice plants are harvested, they are threshed and then dried in an oven at 42°C for 1 to 2 weeks. The number of grains on each plant is then counted and the weight of all the grains is weighed. The thousand-grain weight is calculated by (total weight / total number of grains)*1000.

[0076] Aboveground biomass: The plants were harvested from the base with a sickle, bagged and dried in a 42°C oven for 1 to 2 weeks, and then weighed with a 100-day balance to obtain the aboveground biomass data.

[0077] Yield per plant: Consistent with the above, the plants were threshed after harvest, and the empty kernels were carefully blown away with a fan. The kernels were then bagged and placed in a 42°C oven to dry for 1 to 2 weeks. The kernels were weighed with a 100-day balance to obtain the yield data per plant.

[0078] like Figure 3 As shown in the data, under low nitrogen conditions, compared with the wild type, the number of grains per ear, 1000-grain weight and yield per plant of the edited lines increased significantly, while the number of tillers and aboveground biomass did not change significantly. Among them, the number of grains per ear, 1000-grain weight and yield per plant of oscyp72a1-cr2 were higher than those of oscyp72a1-cr1.

[0079] like Figure 4 As shown in the data, under medium nitrogen conditions, compared with the wild type, the number of grains per ear, aboveground biomass and yield per plant of the edited lines were significantly increased, while the thousand-grain weight and tiller number were not significantly different. Among them, the number of grains per ear and yield per plant of oscyp72a1-cr2 were higher than those of oscyp72a1-cr1.

[0080] like Figure 5 As shown in the data, under high nitrogen conditions, compared with the wild type, the number of tillers, number of grains per ear, 1000-grain weight, aboveground biomass and yield per plant of the edited lines were significantly increased, among which the number of tillers, number of grains per ear, 1000-grain weight and yield per plant of oscyp72a1-cr2 were higher than those of oscyp72a1-cr1.

[0081] Both oscyp72a1-cr1 and oscyp72a1-cr2 were obtained by frameshift mutation and terminated prematurely at the same gene sequence position. Before termination, oscyp72a1-cr1 had one more amino acid residue than oscyp72a1-cr2.

[0082] In summary, the present invention knocks out the OsCYP72A1 gene in rice, which can significantly improve the nitrogen fertilizer utilization efficiency with single plant yield as the evaluation index, and significantly improves at least one of the agronomic traits such as the number of tillers, the number of grains per panicle, the thousand-grain weight and the aboveground biomass, and the improvement effect is particularly obvious under high nitrogen conditions. The core of the present invention is that a gene OsCYP72A1 that negatively regulates nitrogen utilization is successfully applied to improve the nitrogen fertilizer utilization efficiency and yield of rice, providing a practical target gene for cultivating new environmentally friendly nitrogen-efficient rice varieties.

[0083] It can be understood that the above embodiments only express the preferred implementation modes of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the patent scope of the present invention. It should be pointed out that, for ordinary technicians in this field, the above technical features can be freely combined without departing from the concept of the present invention, and several deformations and improvements can be made, which all belong to the protection scope of the present invention. Therefore, all equivalent changes and modifications made to the scope of the claims of the present invention should belong to the coverage of the claims of the present invention.

Claims

1. Application of the nitrogen utilization gene OsCYP72A1 in rice breeding, characterized in that: The application is to improve the nitrogen utilization efficiency of rice, increase the number of tillers, increase the number of grains per panicle, increase the thousand-grain weight or increase the yield per plant; the nucleotide sequence of the OsCYP72A1 gene is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: The amino acid sequence of the protein encoded by the OsCYP72A1 gene is shown in SEQ ID NO.

2.

3. The use according to claim 1, characterized in that: The editing target site of the OsCYP72A1 gene is shown in SEQ ID NO.

3.

4. The use according to claim 1, characterized in that: The biological material related to the OsCYP72A1 gene is any one of the following AC: A. sgRNA expression cassette containing the target sequence; B. CRISPR-Cas9 vector connected to the sgRNA expression cassette described in A; C. A recombinant microorganism containing the sgRNA expression cassette described in A or the CRISPR-Cas9 vector described in B.

5. The use according to claim 1, characterized in that: The method of rice breeding is: The CRISPR-Cas9 gene editing technology was used to knock out the OsCYP72A1 gene in rice, adding one base pair and deleting two base pairs in the first exon, respectively, to obtain two loss-of-function rice lines caused by frameshift mutations.

6. A method for obtaining a vector carrying the target site of the OsCYP72A1 gene for use according to any one of claims 1 to 5, comprising: Predicting targets; Ligation and amplification of the sgRNA expression cassette; Connect the sgRNA expression cassette to the pYLCRISPR / Cas9 vector to obtain a connection product; Transforming the ligation product on a culture medium to obtain colonies; Performing PCR amplification on the bacterial colony to obtain a PCR product; The PCR product was introduced into Agrobacterium to obtain the target site of OsCYP72A1 gene.

7. The method according to claim 6, characterized in that The target site of the OsCYP72A1 gene is CCGTCGTGCGACTGATTTGG.

8. The method according to claim 7, characterized in that The primer sequence of the target site of the OsCYP72A1 gene is: gRT1:CCGTCGTGCGACTGATTTGGgttttagagctagaaat, OsU3T1:CCAAATCAGTCGCACGACGGTgccacggatcatctgc.

9. The method according to claim 7, characterized in that: The sgRNA expression cassette is connected to the pYLCRISPR / Cas9 vector to obtain a connection product, including: Thaw the competent DH5α E. coli on ice; Add the ligation product to the competent medium; The competent cells were heat-shocked and transformed, and 600 μL of LB medium without antibiotics was added to recover the cells in a shaking incubator at 37°C for 30 min. The competent cells were plated onto the solid culture medium of Cannabinoids to obtain the ligation product.

10. A method for preparing a transgenic plant knocking out the OsCYP72A1 gene for use according to any one of claims 1 to 5: Transformation of rice using Agrobacterium tumefaciens; Conduct gene editing tests on T0 generation plants; The T1 generation plants were tested for homozygosity; The T2 generation homozygous mutant materials were identified by PCR, and transgenic plants with OsCYP72A1 gene knocked out were obtained.

Images