Large-fragment DNA assembling method

Abstract

The invention discloses a large-fragment DNA (deoxyribonucleic acid) assembly method, and particularly relates to the technical field of synthetic biology, the large-fragment DNA assembly method comprises the following steps: S01, dividing a large-fragment DNA into a plurality of short fragments, the size of each fragment is 2000-5000 bp, and a homologous sequence of 50-60 bp exists between every two adjacent fragments; s02, determining the positions of the first segment and the last segment in the plurality of short segments according to a predetermined direction; s03, the first fragment is cloned to a JT-P1 plasmid in a cloning mode; s04, the last fragment is cloned into a JT-P2 plasmid, and the last fragment is cloned into the JT-P2 plasmid; s05, respectively cloning a plurality of residual fragments into a pUC57-kan plasmid; and S06, transforming the products prepared in the step S03, the step S04 and the step S05 and JT-P3 plasmids into saccharomycetes in an equal-quality and equal-quantity manner. The method does not relate to recovery of DNA fragments, directly uses plasmids for assembly, directly converts circular DNA, and is high in conversion efficiency, high in recombination efficiency and short in period.

Description

Technical Field

[0001] The present invention relates to the technical field of synthetic biology, and in particular to a large-fragment DNA assembly method. Background Art

[0002] Synthetic biology has developed rapidly and has been widely used in many fields such as biomedicine, materials and chemicals, agriculture and food, energy and environment. Among them, DNA synthesis technology is the underlying supporting technology of synthetic biology. Artificially synthesized DNA plays an important role in many synthetic biology supporting fields such as medicine, agriculture, and materials.

[0003] At present, the era of whole gene synthesis has arrived. Synthesizing and assembling a complete genome of an organism and making it alive is one of the main tasks of synthetic genomics. In this process, synthetic genomics will provide solutions for future medical treatment from a new perspective at the chromosome and genome levels and play a key role. In the era of whole genome synthesis, the synthesis and assembly of genes are at the level of hundreds of KB to Mb or even longer. Therefore, the commercial delivery of large DNA fragments (15Kb to 30Kb DNA fragments) has revolutionary value in promoting broader and deeper synthetic biology research and applications.

[0004] However, the existing commercial DNA synthesis technology still uses DNA polymerase chain reaction splicing technology (PCA) to splice the chemical column-synthesized oligonucleotide single strands (oligo primers) into double strands of about 1000bp, and then connect the vector. If the gene is long, the short DNA fragments that were correctly spliced ​​in the first step will be spliced ​​again to form a longer gene. Under normal circumstances, when the length of the synthesized DNA exceeds 6000bp, the DNA connection conversion efficiency will decrease, and when the DNA is too large, it will become unstable in Escherichia coli, which makes the synthesis of long DNA fragments more difficult, and the cost and cycle are too high. Summary of the invention

[0005] The purpose of the present invention is to provide a large-fragment DNA assembly method to solve the above-mentioned problems.

[0006] In order to achieve the above object, the present invention provides the following technical solution: a large fragment DNA assembly method, comprising the following steps:

[0007] S01, divide the large DNA fragment into several short fragments, each fragment is 2000-5000bp in size, and there is a 50-60bp homologous sequence between each adjacent fragment;

[0008] S02, determining the positions of the first segment and the last segment among the plurality of short segments according to a predetermined direction;

[0009] S03, cloning the first fragment into the JT-P1 plasmid;

[0010] S04, cloning the last fragment into the JT-P2 plasmid;

[0011] S05, clone the remaining fragments into pUC57-kan plasmid respectively;

[0012] S06, transforming the products prepared in step S03, step S04 and step S05 and the JT-P3 plasmid into yeast in equal amounts and qualities;

[0013] S07, placing the yeast in step S06 in YPD liquid culture medium, maintaining the temperature at 30° C., incubating for 1 to 2 hours, and then transferring to SC-Ura culture medium for overnight culture;

[0014] S08, waiting for the yeast liquid to grow to a saturated state, collecting the yeast cells, and extracting the yeast plasmid;

[0015] The extracted yeast plasmid was transformed into E. coli top10 competent cells and spread on LB+Amp plates, and white clones were selected to extract the plasmid.

[0016] Preferably, the JT-P1 plasmid in step S03 is based on the pUC57-Kan plasmid, and the VA1 sequence is inserted into the 5' end of the multiple cloning site of the pUC57-Kan plasmid, wherein:

[0017] In step S06, the VA1 sequence has an orthogonal sequence with the genome of the yeast.

[0018] Preferably, the sequence of the JT-P1 plasmid is Seq ID No.1.

[0019] Preferably, the JT-P2 plasmid in step S04 is based on the pUC57-Kan plasmid, and the JT2 sequence and the VA2 sequence are inserted into the 3' end of the multiple cloning site of the pUC57-Kan plasmid.

[0020] Preferably, the sequence of the JT-P2 plasmid is Seq ID No.2.

[0021] Preferably, the JT-P3 plasmid in step S06 is an amp-resistant shuttle plasmid vector, and the two wings of its gene insertion site are designed to insert a VA1 sequence and a JT3 sequence containing a VA2 sequence, respectively, wherein:

[0022] The VA1 sequence is used as the 5' end recombination homology arm, and the VA2 sequence in the JT3 sequence is used as the 3' end recombination homology arm. An RFP expression cassette is also inserted between VA1 and VA2.

[0023] Preferably, the sequence of the JT-P3 plasmid is Seq ID No.3.

[0024] Preferably, the large DNA fragment in step S01 is a DNA fragment of 10Kb to 30Kb.

[0025] In the above technical solution, the present invention provides a large fragment DNA assembly method, which has the following

[0026] Beneficial effects:

[0027] 1. The short fragment is constructed in the kan resistance plasmid, and the assembled complete long gene is constructed in the amp resistance plasmid. Through alternating screening of different resistances, after the yeast plasmid is transformed into Escherichia coli, the influence of the kan resistance short fragment plasmid can be eliminated and the positive rate can be increased.

[0028] 2. In the invention, JT-P3 only carries a defective Ura nutritional tag, and JT-P3 without assembled genes will not grow after transforming yeast. When the complete long gene is assembled into JT-P3, the Ura (defective) homology arm on JT-P2 and the Ura (defective) tag on JT-P3 are recombined to form a complete Ura tag. Therefore, after the assembled complete long gene plasmid is transformed into yeast, yeast can grow in SC-Ura.

[0029] 3. By designing homologous arms (VA1 and VA2) that are orthogonal to the yeast endogenous DNA, specific assembly can be achieved directly using the plasmid, so there is no need to consider the restriction sites too much when designing the experimental plan for DNA synthesis.

[0030] 4. The process is simple and efficient, and does not require tedious experiments such as plasmid extraction, enzyme cutting, and gel recovery of DNA fragments.

[0031] 5. Direct circular DNA transformation, high transformation efficiency, small DNA requirement, high recombination efficiency and short cycle.

[0032] 6. The present invention sets up three-fold screening, namely:

[0033] First screening: The vectors before and after assembly have different E. coli resistance tags. The small fragment cloning vector before assembly is kan-resistant (JT-P1, JT-P2, pUC57-Kan), and the long fragment cloning vector after assembly is Amp-resistant (JT-P3);

[0034] In the second screening, the correctly assembled vector has a complete Ura tag and can grow in SC-Ura medium, while incorrectly assembled bacteria cannot grow in SC-Ura. Therefore, after yeast transformation, culturing with SC-Ura medium can enrich correctly assembled yeast and increase the positive rate;

[0035] The third screening is that incorrectly assembled plasmids will cause E. coli to turn red after being transformed back into E. coli, while correctly assembled plasmids will not cause E. coli to turn red. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] In order to more clearly illustrate the embodiments of the present application or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments recorded in the present invention. For ordinary technicians in this field, other drawings can also be obtained based on these drawings.

[0037] Figure 1 This is a schematic diagram of the plasmid of JT-P1 provided by the present invention.

[0038] Figure 2 The schematic diagram of the plasmid of JT-P2 provided by the present invention.

[0039] Figure 3 This is a schematic diagram of the plasmid of JT-P3 provided by the present invention.

[0040] Figure 4 A flow chart of the large-fragment DNA assembly method provided by the present invention.

[0041] Figure 5 This is a schematic diagram of the segmentation of large DNA fragments in Example 2 provided by the present invention.

[0042] Figure 6 This is a schematic diagram of the enzyme cutting in Example 2 provided by the present invention.

[0043] Figure 7 This is a photo of the bacterial colony in Example 3 provided by the present invention.

[0044] Figure 8 This is a schematic diagram of the enzyme cutting in Example 3 provided by the present invention.

[0045] Fig. 9 This is a schematic diagram of the enzyme cutting in Example 3 provided by the present invention. DETAILED DESCRIPTION

[0046] In order to make the purpose, technical solution and advantages of the embodiments of the present disclosure clearer, the technical solution of the embodiments of the present disclosure will be clearly and completely described below in conjunction with the drawings of the embodiments of the present disclosure. Obviously, the described embodiments are part of the embodiments of the present disclosure, not all of the embodiments. Based on the described embodiments of the present disclosure, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present disclosure.

[0047] Embodiment 1

[0048] like Figure 1-3 As shown, a large fragment DNA assembly method comprises the following steps:

[0049] S01, divide the large DNA fragment into several short fragments, each fragment is 2000-5000bp in size, and there is a 50-60bp homologous sequence between each adjacent fragment;

[0050] S02, determining the positions of the first segment and the last segment among the plurality of short segments according to a predetermined direction;

[0051] S03, cloning the first fragment into the JT-P1 plasmid;

[0052] S04, clone the last fragment into the JT-P2 plasmid;

[0053] S05, clone the remaining fragments into pUC57-kan plasmid respectively;

[0054] S06, transforming the products prepared in step S03, step S04 and step S05 and the JT-P3 plasmid into yeast in equal amounts and qualities;

[0055] S07, placing the yeast in step S06 in YPD liquid culture medium, maintaining the temperature at 30° C., incubating for 1 to 2 hours, and then transferring to SC-Ura culture medium for overnight culture;

[0056] S08, when the yeast liquid grows to saturation, collect the yeast cells and extract the yeast plasmid;

[0057] S09. Transform the extracted yeast plasmid into E. coli top10 competent cells, spread them on LB+Amp plates, and select white clones to extract the plasmid.

[0058] Further, combined with Figure 1

[0059] Secondly, combined Figure 2

[0060] Furthermore, combined Figure 3

[0061] When synthesizing long - fragment DNA in the above - mentioned embodiments, the long - fragment DNA is first divided into multiple small - fragment DNAs for synthesis. The first small - fragment is synthesized into the multiple cloning sites of the JT - P1 plasmid to form the JT - P1 plasmid cloned with the VA1 + head - fragment. The last small - fragment is synthesized into the multiple cloning sites of the JT - P2 plasmid to form the JT - P2 plasmid cloned with the tail - fragment+VA2. The middle fragments are respectively cloned into the pUC57 - kan vector. As Figure 4 shown, during assembly, the JT - P1 plasmid cloned with the first fragment, the JT - P2 plasmid cloned with the last fragment, the pUC57 - kan plasmids cloned with each middle fragment, and the JT - P3 plasmid are co - transformed into yeast by equal - plasmid. Then, they are cultured in SC - Ura medium. Due to the natural homologous recombination ability of yeast, during the culturing process, the above - mentioned plasmids rely on the homologous recombination system inside yeast to carry out homologous recombination in yeast cells: (1) The VA1 sequence on the JT - P1 plasmid recombines with the VA1 sequence on the JT - P3 plasmid; (2) At the same time, the fragments carried on the JT - P1 plasmid, pUC57 - kan, and JT - P2 plasmid, because there are homologous sequences between adjacent fragments during splitting, will specifically carry out homologous recombination; (3) The VA2 sequence on the JT - P2 plasmid recombines with the VA2 sequence on the JT - P3 plasmid. After recombination, (1) the small - fragments will be assembled into the target large - fragment in sequence and cloned on the backbone plasmid of JT3, (2) JT2 and JT3 recombine to form a complete URA3 gene expression unit and express orotidine 5 - phosphate decarboxylase in yeast, which can enable auxotrophic yeast to grow in SC - Ura. Therefore, the transformed yeast is incubated in YPD liquid medium at 30 °C for 1 - 2 h and then transferred to SC - Ura medium for overnight culture; when the bacterial liquid grows to a saturated state, the cells are collected, yeast plasmids are extracted, and the extracted yeast plasmids are transformed into competent Escherichia coli top10 cells and spread on LB+Amp plates. For the correctly assembled clones, the target long - fragment gene will replace the RFP expression cassette. Therefore, after the correctly assembled plasmid is transferred back into Escherichia coli, it will no longer make Escherichia coli appear red. When colonies grow on the LB+Amp plates after the transformation of Escherichia coli, white colonies are selected to extract plasmids, and enzyme digestion verification and sequencing are carried out.

[0062] The short - fragments are constructed in the kan - resistant plasmid, and the complete long - gene after assembly is constructed in the amp - resistant plasmid. Through the alternating screening of different resistances, after the yeast plasmid is transferred back into Escherichia coli, the influence of the short - fragment plasmid with kan resistance can be eliminated, increasing the positive rate.

[0063] Secondly, the JT-P3 plasmid only carries a defective Ura nutritional tag, and the JT-P3 without assembled genes will not grow after transforming yeast. When the complete long gene is assembled into the JT-P3 plasmid, the Ura (defective) homology arm on the JT-P2 plasmid and the Ura (defective) tag on the JT-P3 plasmid are recombined to form a complete Ura tag. Therefore, after the assembled complete long gene plasmid is transformed into yeast, the yeast can grow in SC-Ura.

[0064] Furthermore, the RFP expression cassette will be lost after the JT-P3 plasmid is fully assembled, and after being transformed into E. coli, it can be screened by color.

[0065] Example 2

[0066] Figure 5 As shown, fragment A is 3492 bp long, fragment B is 3501 bp long, fragment C is 3519 bp long, fragment D is 3503 bp long, and fragment E is 3843 bp long. There is a 60 bp homology sequence between fragment A and fragment B, a 60 bp homology sequence between fragment B and fragment C, a 60 bp homology sequence between fragment C and fragment D, and a 58 bp homology sequence between fragment D and fragment E.

[0067] Fragment A was cloned into the JT-P1 vector at the cloning position of 5'-EcroI-HindIII3' (EcorI and HindIII were not retained after cloning), and the resulting A-JT-P1 plasmid and Escherichia coli (kan resistance) carrying the plasmid were obtained.

[0068] Fragment B was cloned into the commercial vector pUC57-kan at the cloning position of 5'-EcroI-HindIII3' (EcorI and HindIII were not retained after cloning), to obtain B-pUC57-kan plasmid and Escherichia coli (kan resistance) carrying the plasmid.

[0069] Fragment C was cloned into the commercial vector pUC57-kan at the cloning position of 5'-EcroI-HindIII3' (EcorI and HindIII were not retained after cloning), to obtain C-pUC57-kan plasmid and Escherichia coli (kan resistance) carrying the plasmid.

[0070] The fragment D was cloned into the commercial vector pUC57-kan at the cloning position of 5'-EcroI-HindIII3' (EcorI and HindIII were not retained after cloning), to obtain the D-pUC57-kan plasmid and the Escherichia coli (kan resistance) carrying the plasmid.

[0071] Fragment E was cloned into the JT-P2 commercial vector at the cloning position of 5'-EcroI-HindIII3' (EcorI and HindIII were not retained after cloning), to obtain the E-JT-P2 plasmid and the Escherichia coli (kan resistance) carrying the plasmid.

[0072] Escherichia coli strains transformed with A-JT-P1, B-pUC57-kan, C-pUC57-kan, D-pUC57-kan, E-JT-P2 plasmids, and JT-P3 plasmids were inoculated into 5 ml LB + kan liquid culture medium, respectively, and cultured at 37 ° C, 220 rpm for 8-10 hours. The plasmids were extracted using the Tiangen plasmid extraction kit, and the plasmid concentration was determined using the nanodrop instrument (the concentration was about 200 ng ~ 300 ng / μl).

[0073] Mix 2 μl of A-JT-P1 plasmid (concentration ~300 ng / μl), 2 μl of B-pUC57-kan plasmid (concentration ~300 ng / μl), 2 μl of C-pUC57-kan plasmid (concentration ~300 ng / μl), 2 μl of D-pUC57-kan plasmid (concentration ~300 ng / μl), 2 μl of E-pUC57-kan plasmid (concentration ~300 ng / μl), and 3 μl of JT-P3 plasmid (concentration ~200 ng / μl) for transformation.

[0074] Transformation process: Inoculate a single colony of Saccharomyces cerevisiae BY4742 into 5ml YPD liquid medium and culture overnight. Pipette an appropriate amount of overnight culture solution into a new 5ml YPD liquid medium. After culturing for 4 hours, collect the cells and resuspend them with lithium acetate solution and incubate at low temperature. Mix the mixed DNA plasmid with 900ul lithium acetate-DMSO-PEG transformation system (0.1M lithium acetate, 10% DMSO, 25% PEG, 0.5mg / mL SSDNA). Collect yeast cells and add them to the lithium acetate-DMSO-PEG transformation system, vortex to mix, let stand at 30℃ for 15min, then incubate at 42℃ for 30min, then collect the cells and discard the supernatant. Add 1ml YPD liquid medium, incubate at 30℃ for 2 hours, collect the cells, resuspend them with 1ml SC-Ura, inoculate them into 4ml SC-Ura liquid medium, and culture them at 30℃ overnight until the cells grow to saturation.

[0075] Collect the bacteria and use the Tiangen Yeast Plasmid Extraction Kit DP112-02 (glass bead method) to extract the yeast plasmid. Transform the yeast plasmid into E. coli. Specific method: Take 10μl of yeast plasmid, add it to top10 competent cells, ice bath for 30min, heat shock at 42℃ for 60s, add antibiotic-free LB medium, incubate at 37℃ for 1 hour, collect the bacteria, and spread on LB+amp plates.

[0076] Three white E. coli monoclonal colonies were picked and placed in 5 ml LB+amp liquid medium, cultured overnight at 37°C, and plasmids were extracted. SmaI+BamHI was used for restriction enzyme digestion verification.

[0077] The enzyme digestion system is shown in Table 1:

[0078] Components Volume or mass Plasmids 2μl (400~500ng) BamHI endonuclease 1μl SmaI endonuclease 1μl 10Xbuffer 1μl Sterile water Make up to a total volume of 10 μl

[0079] Table 1

[0080] Reaction conditions: 37°C, 15 min.

[0081] After enzyme digestion, agarose gel electrophoresis was performed. Lanes 1, 2, and 4 are plasmid enzyme digestion verification images, and lane 3 is a DM5000DNAmaker (sizes are 5000, 3000, 2000, 1000, 750, 500, 200, 100, respectively). The gel image shows that the enzyme digestion results are consistent with the simulated gel image (simulated in the "simulated gel image" function unit in the snapgene software), indicating that the long fragment gene has been correctly assembled. At the same time, the sequencing results also show that the long fragment has been correctly assembled. The above data show that the large fragment DNA synthesis and assembly method of this patent can achieve the synthesis and assembly of large fragment DNA of more than 10K.

[0082] Example 3

[0083] A 15497 bp long DNA fragment (referred to as Gene2) was synthesized and Gene2 (sequence see Seq ID No.11

[0084]

[0085] Fragment 1 was constructed and synthesized into the JT-P1 vector, and the cloning position was 5'-EcroI-HindIII-3' (EcorI and HindIII were not retained after cloning), to obtain 1-JT-P1 plasmid and Escherichia coli (kan resistance) carrying the plasmid.

[0086] Fragment 6 was synthesized into the JT-P2 vector, and the cloning position was 5'-EcroI-HindIII-3' (EcorI and HindIII were not retained after cloning), thereby obtaining the 6-JT-P6 plasmid and the Escherichia coli (kan resistance) carrying the plasmid.

[0087] Fragment 2, fragment 3, fragment 4, and fragment 5 were synthesized and cloned into the pUC57kan vector, respectively, to obtain 2-pUC57-kan, 3-pUC57-kan, 4-pUC57-kan, 5-pUC57-kan plasmids and Escherichia coli carrying the corresponding plasmids, respectively. According to the aforementioned method, the above-mentioned Escherichia coli was cultured and the plasmids were extracted. 500 ng of each short fragment plasmid (1-JT-P1, 2-pUC57-kan, 3-pUC57-kan, 4-pUC57-kan, 5-pUC57-kan, 6-JT-P2 plasmid) was mixed with JT-P3 plasmid (500 ng), transformed into yeast, and then enriched and cultured. The cultured yeast was extracted with a yeast plasmid extraction kit to extract the plasmid, and transformed into Escherichia coli top10 competent cells, coated with LB+Amp plates, and cultured at 37°C overnight. When colonies grow on the plates (such as Figure 7 As shown). Based on the large-fragment DNA assembly method provided in Example 1, four white clones were randomly selected, and the enzyme digestion results were all correct, indicating that the system was highly efficient. In this case, in order to statistically analyze the assembly efficiency, 18 white Escherichia coli colonies were randomly selected and colony PCR verification was performed.

[0088] Three pairs of primers were used for each bacterium for verification. The primer sequences are as follows:

[0089] First pair of primers:

[0090] The primer sequence of JJ1-F is CTTTGGAAGAAGTTCCAGAATTGTACGAC

[0091] The primer sequence of JJ1-R is GAAAATGAGATAGATACATGCGTGGGTC

[0092] The PCR product size is 628 bp

[0093] Second pair of primers:

[0094] The primer sequence of JJ2-F is TGAATACTCTGACTTGTTGGCTAAGG

[0095] The primer sequence of JJ2-R is GCTCAAGTTCAAGGTAGATTGTTGGACA

[0096] The PCR product size is 549 bp

[0097] The third pair of primers:

[0098] The primer sequence of JJ3-F is CCGTCAGCAGCCAAACCTCTTTGTC

[0099] The primer sequence of JJ3-R is GGTATCTCTGGTACTAACGCTCACG

[0100] The PCR product size is 736 bp

[0101] Bacteria test operation:

[0102] Pick a single colony and put it into 15μl sterile water to use as template bacterial solution. The PCR system is shown in Table 2:

[0103]

[0104] Table 2

[0105] The PCR reaction procedure is as follows:

[0106] Pre-denaturation at 95℃ for 5min; amplification at 95℃ for 30s, 55℃ for 30s, 72℃ for 30s, 30 cycles; final extension at 72℃ for 5min, storage at 16℃∞

[0107] Bacteria test results gel map ( Figure 8 ) showed that among the 18 randomly selected colonies, 11 bacteria were positive for bacterial detection (that is, the three pairs of bacterial detection primers all amplified the correct bands). In order to further verify the correctness of the assembly, three Escherichia coli (named E1, E2, and E3) were selected and inoculated into 5 ml LB+Amp culture medium for overnight culture, and then the E. coli plasmids were extracted respectively. The E1 plasmid was double-enzyme digested with BamhI+PacI, the E2 plasmid was double-enzyme digested with SmaI, and the E3 plasmid was double-enzyme digested with BamhI+NheI. The gel image of the enzyme digestion verification result (see Fig. 9 ) showed that the enzyme cutting results were all correct, proving that the DNA was correctly assembled and verifying the high efficiency of the system.

[0108] As can be seen from the above embodiments, the large-fragment DNA assembly system and method provided by the present invention can achieve efficient synthesis of DNA above 10K. This method does not require special preparation of fragments by PCR or enzymatic digestion and recovery, is simple to operate, low in cost, and stable in effect, and is suitable for commercial large-batch operations.

[0109] Only some exemplary embodiments of the present invention have been described by way of illustration above. Undoubtedly, for those of ordinary skill in the art, the described embodiments can be modified in various different ways without departing from the spirit and scope of the present invention. Therefore, the above drawings and description are illustrative in nature and should not be construed as limiting the scope of protection of the claims of the present invention.

Claims

1. A large-fragment DNA assembly method, characterized in that: The following steps are involved: S01, divide the large DNA fragment into several short fragments, each fragment is 2000-5000bp in size, and there is a 50-60bp homologous sequence between each adjacent fragment; S02, determining the positions of the first segment and the last segment among the plurality of short segments according to a predetermined direction; S03, cloning the first fragment into the JT-P1 plasmid; S04, cloning the last fragment into the JT-P2 plasmid; S05, clone the remaining fragments into pUC57-kan plasmid respectively; S06, transforming the products prepared in step S03, step S04 and step S05 and the JT-P3 plasmid into yeast in equal amounts and qualities; S07, placing the yeast in step S06 in YPD liquid culture medium, maintaining the temperature at 30° C., incubating for 1 to 2 hours, and then transferring to SC-Ura culture medium for overnight culture; S08, waiting for the yeast liquid to grow to a saturated state, collecting the yeast cells, and extracting the yeast plasmid; The extracted yeast plasmid was transformed into E. coli top10 competent cells and spread on LB+Amp plates, and white clones were selected to extract the plasmid.

2. A large fragment DNA assembly method according to claim 1, characterized in that: The JT-P1 plasmid in step S03 is based on the pUC57-Kan plasmid, and the VA1 sequence is inserted into the 5' end of the multiple cloning site of the pUC57-Kan plasmid, wherein: In step S06, the VA1 sequence has an orthogonal sequence with the genome of the yeast.

3. A large fragment DNA assembly method according to claim 2, characterized in that: The sequence of the JT-P1 plasmid is Seq ID No.

1.

4. A large-fragment DNA assembly method according to claim 1, characterized in that: The JT-P2 plasmid in step S04 is based on the pUC57-Kan plasmid, and the JT2 sequence and the VA2 sequence are inserted into the 3' end of the multiple cloning site of the pUC57-Kan plasmid.

5. A large-fragment DNA assembly method according to claim 4, characterized in that: The sequence of the JT-P2 plasmid is Seq ID No.

2.

6. A large-fragment DNA assembly method according to claim 1, characterized in that: The JT-P3 plasmid in step S06 is an amp-resistant shuttle plasmid vector, and the two wings of its gene insertion site are designed to insert a VA1 sequence and a JT3 sequence containing a VA2 sequence, respectively, wherein: The VA1 sequence was used as the 5' recombination homology arm, and the VA2 sequence in the JT3 sequence was used as the 3' recombination homology arm. An RFP expression cassette was also inserted between VA1 and VA2.

7. A large-fragment DNA assembly method according to claim 6, characterized in that: The sequence of the JT-P3 plasmid is Seq ID No.

3.

8. A large-fragment DNA assembly method according to claim 1, characterized in that: The large DNA fragment in step S01 is a DNA fragment of 10Kb to 30Kb.

Images