A molecular marker related to the number of eggs in the late laying period of hens and application thereof

By detecting SNP molecular markers at specific sites in the chicken reference genome, the problems of high cost and low accuracy in traditional chicken egg production selection methods have been solved, enabling early selection of superior chickens and improving breeding efficiency and accuracy.

CN120026119BActive Publication Date: 2026-01-02INSTITUTE OF ANIMAL SCIENCES OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510336287.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-20
Publication Date
2026-01-02
Estimated Expiration
2045-03-20

AI Technical Summary

Technical Problem

Traditional methods for selecting chickens based on egg production are costly and inaccurate, making it impossible to make precise selections in the early stages and affecting breeding efficiency.

Method used

Using SNP molecular markers, the A/G bases at position 80454682 from the 5' end of chromosome 1 in the Gallus_gallus 7.0_W version of the chicken reference genome were detected. The genotype was determined by sequencing the amplification products of in vitro nucleic acid amplification primers to determine the level of egg production in the late laying period.

Benefits of technology

It enables early and precise selection of superior chickens, improves breeding efficiency, reduces costs, and enhances the accuracy of selection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120026119B_ABST
    Figure CN120026119B_ABST
Patent Text Reader

Abstract

The application provides a molecular marker related to egg production number in later egg production stage of chicken and application thereof, and belongs to the technical field of gene detection. The molecular marker is a SNP molecular marker, corresponding to the sequence information of chicken reference genome Gallus_gallus 7.0_W version on chromosome 1 from the 5' end to the 80454682th position, and the base at the position is A / G, and the application steps are as follows: (1) extracting genomic DNA of a chicken to be detected; (2) detecting the genotype of the SNP site on chromosome 1 of the chicken to be detected from the 5' end to the 80454682th position; (3) judging the egg production number level of the chicken to be detected in the later egg production stage according to the genotype detection result in the step (2). The application can effectively select the chicken in the early stage, accelerate the breeding process of the chicken with high egg production number in the middle and later egg production stage, improve the breeding efficiency, and has significant application value and potential economic benefits.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of gene detection, and particularly relates to a molecular marker related to egg number in the later egg-laying period of a chicken and application thereof. BACKGROUND

[0002] Egg number of a chicken is one of important economic traits for measuring production performance, and directly affects economic benefits and market supply of a laying hen breeding industry. Especially, with the extension of the breeding cycle of a laying hen, the egg-laying performance in the middle and later periods is paid close attention to by producers and breeders. Studies have shown that the regulation basis of egg-laying performance in different stages may have certain differences, and the selection of egg number in the early or peak period does not necessarily mean that high egg number can be obtained in the middle and later periods. Egg number is regulated by both genetics and environmental factors, and the egg-laying performance in the middle and later periods has significant variation in a population and has great genetic improvement potential.

[0003] Traditional breeding methods need to determine individuals in the whole population, and the defects include: a large amount of manpower and time are consumed for determination work, and the cost is high; the trait determination can only be completed in the middle and later periods of egg-laying, and early selection cannot be performed; the determination can only be performed on hens, and the selection of roosters needs to be performed according to the determination results of siblings or offspring, which reduces the selection accuracy. In comparison, the use of SNP molecular markers and other genetic variations for trait selection can realize early and accurate trait selection, thereby accelerating the breeding process of target traits at the genetic level.

[0004] Therefore, the mining and verification of molecular markers related to egg number of a chicken and the establishment of molecular breeding technology are of great significance for improving the breeding efficiency of the trait. SUMMARY

[0005] The present application aims to provide a molecular marker related to egg number in the later egg-laying period of a chicken and application thereof, and aims to solve the technical problem of high cost and low accuracy of traditional breeding methods for egg number of a chicken in the prior art.

[0006] In order to achieve the above application purpose, the present application provides the following technical scheme:

[0007] The present application provides a molecular marker related to egg number in the later egg-laying period of a chicken, which is a SNP molecular marker, corresponding to the 80454682th position from the 5' end on chromosome 1 of the chicken reference genome Gallus_gallus 7.0_W version sequence information, and the base at this position is A / G.

[0008] The present application also provides the application of the molecular marker related to egg number in the later egg-laying period of a chicken according to the above technical scheme, and the method steps of the application are as follows:

[0009] (1) extracting genomic DNA of the to-be-tested chicken;

[0010] (2) detecting the genotype of the SNP site at position 80454682 from the 5' end on chromosome 1 of the to-be-tested chicken;

[0011] (3) judging the egg production number level of the to-be-tested chicken in the post-egg production period according to the genotype detection result in step (2).

[0012] Further, the detection in step (2) is specifically detecting the amplification product of the in-vitro nucleic acid amplification primer pair through sequencing.

[0013] Further, the upstream primer of the in-vitro nucleic acid amplification primer pair is shown as SEQ ID NO: 2, and the downstream primer of the in-vitro nucleic acid amplification primer pair is shown as SEQ ID NO: 3.

[0014] Further, the genotype in step (3) is GG, AG or AA.

[0015] The application also provides the application of the molecular marker related to the egg production number of the chicken in the post-egg production period according to the technical solution described above, and the application is the application of detecting the genotype of the SNP site in identifying or assisting in identifying the egg production number of the chicken in the post-egg production period.

[0016] The application also provides the application of the molecular marker related to the egg production number of the chicken in the post-egg production period according to the technical solution described above, and the application is the application of detecting the genotype of the SNP site in preparing a product for identifying or assisting in identifying the egg production number of the chicken in the post-egg production period.

[0017] The application also provides the application of the molecular marker related to the egg production number of the chicken in the post-egg production period according to the technical solution described above, and the application is the application of detecting the genotype of the SNP site in chicken breeding or preparing a product for chicken breeding.

[0018] The application also provides a product, which is a product containing a substance for detecting the SNP molecular marker, specifically a product for detecting the genotype of the SNP site related to the egg production number of the chicken in the post-egg production period, a product for identifying or assisting in identifying the egg production number of the chicken in the post-egg production period, or a product for chicken breeding.

[0019] Compared with the prior art, the technical solution of the application has the following beneficial effects:

[0020] The single nucleotide polymorphism (SNP) molecular marker covered by the present application has significant correlation with the egg number in the middle and late egg production period of a chicken, and represents an innovative molecular marker technology. By accurately detecting the genotype of a chicken individual at the specific site, a chicken carrying a superior genotype can be identified; using this technology, effective selection can be carried out at an early stage of the chicken, thereby accelerating the breeding process of a chicken with high egg number in the middle and late egg production period. This early selection method not only improves the efficiency of breeding, but also has significant application value and potential economic benefits due to the rapid screening of individuals with excellent traits. BRIEF DESCRIPTION OF DRAWINGS

[0021] Figure 1 A schematic diagram of the results of whole genome association analysis in Example 1 of the present application. DETAILED DESCRIPTION

[0022] The present application provides a molecular marker related to the egg number in the middle and late egg production period of a chicken, which is an SNP molecular marker corresponding to the 80454682th position from the 5' end of chromosome 1 of the chicken reference genome Gallus_gallus 7.0_W version sequence information, and the base at this position is A / G.

[0023] The present application also provides the application of the above-mentioned molecular marker related to the egg number in the middle and late egg production period of a chicken, and the method steps of the application are as follows:

[0024] (1) Extracting the genomic DNA of the chicken to be tested;

[0025] (2) Detecting the genotype of the SNP site at the 80454682th position from the 5' end of chromosome 1 of the chicken to be tested;

[0026] (3) According to the genotype detection result in step (2), judging the egg number level in the middle and late egg production period of the chicken to be tested.

[0027] In the present application, the detection in step (2) is specifically detecting the amplification product of the primer pair for in vitro nucleic acid amplification by sequencing.

[0028] In the present application, the upstream primer of the primer pair for in vitro nucleic acid amplification is shown in SEQ ID NO: 2, and the downstream primer of the primer pair for in vitro nucleic acid amplification is shown in SEQ ID NO: 3.

[0029] The SEQ ID NO: 2 in the present application is specifically CTTCTATGCCATGCCATGCTAT, and the SEQ ID NO: 3 is specifically GACAAACATCCCATCCCACAG.

[0030] The in vitro nucleic acid amplification primer pair is designed and synthesized according to the upstream and downstream DNA sequence information of the site chr1:80454682 published in the Ensemble database, i.e., SEQ ID NO:1, for PCR amplification, and the SEQ ID NO:1 is:

[0031] GCTCTTTGCATCCAGGTAGCGTTGCTGTGGCAGGGACAGGACTTGTGCTGGGGCATGACTTGGCAGTATGGGAGGCTGTTCCCAGGTTTCCTCAATACCCACCCTTTGCTGAGCAGAGAGGGGAGGTTTCTAAGAAAGGGCATTGATCTGGGAAGGGCATTGATCTGGGGATTCTATGTTCTTCTATGCCATGCCATGCTATACTACGCAATGCTGTAGGAAGAAGGTTCCCACCCACTTACTCAGACAAG / ATGATGTAGGATTGGCTTACCCTGTGGGATGGGATGTTTGTCTGCTGATGTATTCAAGTCTCTCCTTCCCCCCCCCTGCACCCCGCCTCCCCTTTTATTTTTCTAGAGGAGTTAGAAATTGGCTGATTCACAATGTCTTTATTATCTTTAGATCATTAGAAGAAGGGCCTGGACCCTTAGGGAAAATGATCTCAACGATATCATCATGATTTAGGTAAATGCGCAGCCCAGGAGGCAGGATGGGCCAAAGC.

[0032] In the present application, the genotype in the step (3) is GG, AG or AA.

[0033] The genotype and the egg number in the late egg production period of the chicken are related, and the genotype GG corresponds to a larger number of eggs; the genotype AG corresponds to a middle number of eggs; and the genotype AA corresponds to a smaller number of eggs.

[0034] The present application also provides an application of the molecular marker related to the egg number in the late egg production period of the chicken according to the above technical solution, and the application is the application of detecting the genotype of the SNP site in identifying or assisting in identifying the egg number in the late egg production period of the chicken.

[0035] The present application also provides an application of the molecular marker related to the egg number in the late egg production period of the chicken according to the above technical solution, and the application is the application of detecting the genotype of the SNP site in preparing a product for identifying or assisting in identifying the egg number in the late egg production period of the chicken.

[0036] The application also provides application of the molecular marker related to the egg-laying number in the later egg-laying period of a chicken.

[0037] The application also provides a product, which is a substance containing the SNP molecular marker in claim 1, in particular, a product for detecting the genotype of the SNP site related to the egg-laying number in the later egg-laying period of a chicken, a product for identifying or assisting in identifying the egg-laying number in the later egg-laying period of a chicken, or a product for chicken breeding.

[0038] The technical solutions provided by the application are described in detail below in combination with examples, but they should not be understood as limitations to the protection scope of the application.

[0039] Example 1

[0040] Determination of the SNP molecular marker related to the egg-laying number in the middle and later egg-laying period of a chicken

[0041] (1) Experimental animals: 160 individual White Leghorn chickens were used as test objects, and free feeding and drinking water were implemented during feeding, and the feeding conditions strictly followed the relevant provisions of the industry standard (NY / T 33-2004).

[0042] (2) Phenotype determination: the egg-laying number of chicken individuals from 400 days to 500 days was counted.

[0043] (3) Extraction of genomic DNA: 0.5 mL of suborbital venous blood of all test chickens was collected by an anticoagulant vacuum blood collection tube, and whole genome DNA was extracted by phenol chloroform extraction method. The DNA samples that passed the detection were subjected to agarose gel electrophoresis to further evaluate the purity and integrity of the DNA samples; the sample concentration needs to be greater than 50 ng / μL, the purity OD260 / 280 is between 1.8-2.0, and the integrity is good. The qualified DNA samples were stored at-20 degrees for standby use.

[0044] (4) Genomic resequencing: the DNA samples of all test chickens were sent to Huada Gene, and individual whole genome resequencing was performed by using DNBSEQ sequencing platform according to the standard operation procedure, and the sequencing depth was about 15x. BWA and GATK software were used for sequence alignment and genotype extraction. After SNP call rate and MAF quality control, 7,498,204 SNPs were obtained and used for subsequent analysis.

[0045] (5) Whole genome association analysis: pedigree data, phenotype data and genomic SNP site data were sorted out, and GCTA software was used for whole genome association analysis, and the single variable mixed linear model was:

[0046] ;

[0047] wherein y represents the phenotype value; b represents the fixed effect (including population effect and cage effect); X represents the corresponding relationship matrix; J represents the additive genotype of the SNP site to be detected; a represents the additive SNP effect; u represents the random animal effect, subject to wherein G represents the genomic additive relationship matrix, represents the additive genetic variance; e represents the residual effect subject to wherein I represents the unit matrix, represents the residual variance. The R package qvalue is used to calculate the FDR value in the whole genome range, and the significance threshold is FDR < 0.01 (P = 3.78E-07).

[0048] The results of the GWAS analysis are shown in Figure 1 Based on Figure 1 , it can be known that the number of eggs in the middle and late stages of egg production of chickens is significantly associated with a region of 0.14 Mb on chromosome 1 (chr1:80402120-80541002). Further verification of all sites in the genomic association region determines the chr1:80454682 site as a candidate site. The genetic marker data affecting the number of eggs in the late stage of egg production of chickens are shown in Table 1:

[0049] Table 1 Genetic marker data affecting the number of eggs in the late stage of egg production of chickens

[0050]

[0051] Example 2

[0052] Correlation between different genotypes of the chr1:80454682 site and the number of eggs in the late stage of egg production of chickens

[0053] (1) Experimental animals: 160 individual White Leghorn chickens, which are fed in the same way as in Example 1.

[0054] (2) Phenotype determination: the same as in Example 1.

[0055] (3) Extraction of genomic DNA: the same as in Example 1.

[0056] (4) Genotyping of specific gene sites: the same as in Example 1.

[0057] (5) Identification of the phenotype advantage genotype: at the site of chr1:80454682, the average egg production of GG genotype individuals was 77.63, the average egg production of AG genotype individuals was 75.82, and the average egg production of AA genotype individuals was 35.15. The phenotypes of GG and GA genotypes were significantly higher than that of AA genotype, but AG genotype would separate to produce GG genotype individuals in the hybrid offspring, which could not be stably inherited. Therefore, it was known that GG genotype was the advantage genotype of the trait.

[0058] Table 2 is a data table of the correlation between different genotypes of chicken chr1:80454682 SNP site and the egg production of 400-500 day old chickens.

[0059] Table 2 is a data table of the correlation between different genotypes of chicken chr1:80454682 SNP site and the egg production of 400-500 day old chickens.

[0060]

[0061] ab: different letters represent significant differences in phenotypes between groups.

[0062] Example 3

[0063] Establishment of molecular marker detection method for chr1:80454682 site and its application in breeding

[0064] Establishment of molecular marker detection method: according to the upstream and downstream DNA sequence information of chr1:80454682 site published by Ensemble database, i.e. SEQ ID NO: 1, a pair of primers was designed and synthesized for PCR amplification. SEQ ID NO: 1 is specifically as follows:

[0065] GCTCTTTGCATCCAGGTAGCGTTGCTGTGGCAGGGACAGGACTTGTGCTGGGGCATGACTTGGCAGTATGGGAGGCTGTTCCCAGGTTTCCTCAATACCCACCCTTTGCTGAGCAGAGAGGGGAGGTTTCTAAGAAAGGGCATTGATCTGGGAAGGGCATTGATCTGGGGATTCTATGTTCTTCTATGCCATGCCATGCTATACTACGCAATGCTGTAGGAAGAAGGTTCCCACCCACTTACTCAGACAAG / ATGATGTAGGATTGGCTTACCCTGTGGGATGGGATGTTTGTCTGCTGATGTATTCAAGTCTCTCCTTCCCCCCCCCTGCACCCCGCCTCCCCTTTTATTTTTCTAGAGGAGTTAGAAATTGGCTGATTCACAATGTCTTTATTATCTTTAGATCATTAGAAGAAGGGCCTGGACCCTTAGGGAAAATGATCTCAACGATATCATCATGATTTAGGTAAATGCGCAGCCCAGGAGGCAGGATGGGCCAAAGC

[0066] The primer sequence information is shown in Table 3, the polymerase chain reaction (PCR) amplification system is shown in Table 4, and the PCR amplification conditions are shown in Table 5. The amplification product is analyzed by first-generation sequencing technology to determine the genotype at the 80454682 site of chromosome 1 (chr1). The genotype result covers GG, AG, and AA.

[0067] Table 3 Primer sequence information table

[0068]

[0069] Table 4 Polymerase chain reaction (PCR) amplification system table

[0070]

[0071] Table 5 PCR amplification condition table

[0072]

[0073] (2) Breeding strategy based on the molecular marker at the chr1:80454682 site to improve the number of eggs laid in the late laying period of chickens

[0074] The present application selects 190 Beijing oil chicken pure line individuals as breeding objects, aiming to improve the number of eggs in the later laying period. At the age of 3 weeks, blood samples of all individuals are collected, and genomic DNA is extracted according to the procedure of (3) in Example 1. The target site sequence is amplified using specific primers SEQ ID NO: 2 and SEQ ID NO: 3, and genotyping is performed by first-generation sequencing technology.

[0075] In the obtained genotypes, there are 94 individuals with GG genotype, 83 individuals with AG genotype, and 13 individuals with AA genotype. Based on the dominant genotype of the number of eggs in the later laying period, the present application selects individuals with GG genotype for subsequent breeding. After feeding to the laying period, the number of eggs from 400 to 500 days of age is counted at the age of 500 days. The correlation results of different genotypes of chicken chr1: 80454682 SNP site and the number of eggs are shown in Table 6.

[0076] Based on Table 6, the average number of eggs of individuals with GG genotype is 52.74, the average number of eggs of individuals with AG genotype is 55.81, and the average number of eggs of individuals with AA genotype is 38.85.

[0077] Table 6 Correlation results of different genotypes of chicken chr1: 80454682 SNP site and the number of eggs

[0078]

[0079] ab: Different letters indicate significant differences in phenotypes between groups.

[0080] Finally, it should be noted that: the above examples are only used to illustrate the technical solutions of the present application, but not to limit it. Although the present application has been described in detail with reference to the above examples, those skilled in the art should understand that the specific embodiments of the present application can be modified or replaced by equivalents without departing from the spirit and scope of the present application. Any modification or equivalent replacement without departing from the spirit and scope of the present application should be covered within the protection scope of the claims of the present application.

Claims

1. The use of a reagent for detecting a molecular marker associated with the number of eggs laid in the late laying period of a chicken in identifying or assisting in identifying the number of eggs laid in the late laying period of a White Laihang chicken or a Beijing You chicken, characterized in that, The molecular marker is an SNP molecular marker, and a SNP site of the SNP molecular marker corresponds to a position of 80454682 from a 5' end on a chromosome 1 of a chicken reference genome Gallus_gallus 7.0_W version 1, and a base polymorphism is A or G, wherein a GG genotype corresponds to a higher egg number, an AG genotype corresponds to a middle egg number, and an AA genotype corresponds to a lower egg number. The chicken is a Bailahang chicken or a Beijing oil chicken.

2. The use of a reagent for detecting a molecular marker associated with the number of eggs laid in the late laying period of a chicken in the preparation of a product for identifying or assisting in the identification of the number of eggs laid in the late laying period of a White Laihang chicken or a Beijing You chicken, characterized in that, The molecular marker is an SNP molecular marker, and a SNP site of the SNP molecular marker corresponds to a position of 80454682 from a 5' end on a chromosome 1 of a chicken reference genome Gallus_gallus 7.0_W version 1, and a base polymorphism is A or G, wherein a GG genotype corresponds to a higher egg number, an AG genotype corresponds to a middle egg number, and an AA genotype corresponds to a lower egg number. The chicken is a Bailahang chicken or a Beijing oil chicken.

3. Use according to claim 1 or 2, characterized in that, The method steps of the application are: (1) extracting genomic DNA of a chicken to be tested; (2) detecting a genotype of the SNP site of the chicken to be tested; (3) judging an egg number level of the chicken to be tested in a post-egg stage according to a result of the genotype detection in step (2).

4. Use according to claim 3, characterized in that, The detection in step (2) is specifically detecting, by sequencing, an amplification product of an in-vitro nucleic acid amplification primer pair.

5. Use according to claim 4, characterized in that, A sequence of an upstream primer of the in-vitro nucleic acid amplification primer pair is shown in SEQ ID NO: 2, and a sequence of a downstream primer of the in-vitro nucleic acid amplification primer pair is shown in SEQ ID NO: 3.