Reagent and kit for detecting drug resistance of helicobacter pylori and application of reagent and kit

Abstract

The invention relates to the technical field of drug resistance detection, in particular to a reagent and a kit for detecting drug resistance of helicobacter pylori and application of the reagent and the kit. A primer group for RPA amplification and a CrRNA group for CRISPR-Cas14a recognition are designed aiming at a plurality of mutation sites of a clarithromycin drug-resistant gene 23S rRNA and an amoxicillin drug-resistant gene PBP1, whether a sample to be detected contains the mutation sites or not can be specifically recognized, the primer group has the advantage of high sensitivity, and the sensitivity can be as low as 100 copies / mu L. By utilizing the reagent disclosed by the invention, whether the drug-resistant sites of the helicobacter pylori to clarithromycin and amoxicillin in a sample are mutated or not can be simply, conveniently, quickly and accurately identified, and the drug resistance condition of the sample can be accurately predicted.

Description

Technical Field

[0001] The present invention relates to the technical field of drug resistance detection, and in particular to a reagent and a kit for detecting drug resistance of Helicobacter pylori and applications thereof. Background Art

[0002] Helicobacter pylori (H.pylori, Hp) is a Gram-negative bacterium and the most common bacterial infection. Infection can lead to a variety of gastric abnormalities and is an important cause of peptic ulcer disease, atrophic gastritis, gastric adenocarcinoma and mucosa-associated lymphoid tissue lymphoma.

[0003] Currently, antibiotics are generally used to treat Helicobacter pylori in clinical practice, including metronidazole, macrolides, proton pump inhibitors and other antibiotics. However, due to the widespread use of antibiotics in recent years, the resistance rate of H. pylori has increased year by year, and its mutation sites are numerous and complex. The decline in the eradication rate of Hp in traditional treatment is an important problem faced in recent years. The lack of rapid detection of resistant antibiotics and individualized real-time monitoring has become a major bottleneck in the prevention and control of H. pylori.

[0004] At present, the gold standard for detecting antibiotic resistance of Helicobacter pylori is the agar dilution method proposed by the Clinical and Laboratory Standards Institute (CLSI). This method has high requirements on the professional level of experimental personnel, experimental equipment, and experimental consumables, and is difficult to be carried out in clinical applications. Therefore, it is of great application significance to seek a simple, rapid, high-throughput and high-accuracy HP resistance detection method. Summary of the invention

[0005] In order to solve the above problems, the present invention provides a reagent, a kit and its application for detecting drug resistance of Helicobacter pylori. The reagent provided by the present invention can specifically amplify and detect the mutation sites A2142G, A2143G, A2144G, C2147G, T2182C, T2245C or C2289T of the clarithromycin resistance gene 23S rRNA, and the mutation sites 320Ala / Val, 366Leu-Phe, 369Ala / Thr, 374Leu / Val, 414Arg / Ser, 423Leu / Phe, 556Ser / Thr, 562Asn / Tyr, 593Ala / Thr or 595Gly / Ser of the amoxicillin resistance gene PBP1. The reagent of the present invention can be used to easily and quickly accurately identify whether the drug resistance sites of Helicobacter pylori to clarithromycin and amoxicillin in the sample are mutated, and accurately predict the drug resistance of the sample.

[0006] In order to achieve the above object, the present invention provides the following technical solutions:

[0007] The present invention provides a reagent for detecting drug resistance of Helicobacter pylori, comprising an RPA primer set and a CrRNA set; the nucleotide sequence of the RPA primer set is shown in SEQ ID NO.1 to SEQ ID NO.12; the nucleotide sequence of the CrRNA set is shown in SEQ ID NO.13 to SEQ ID NO.29.

[0008] Preferably, the nucleotide sequences of the primers for detecting the clarithromycin resistance gene 23S rRNA mutation site A2143G are shown in SEQ ID NO.1 and SEQ ID NO.2, and the nucleotide sequence of CrRNA is shown in SEQ ID NO.22;

[0009] The nucleotide sequences of the primers for detecting the mutation site 374Leu / Val of the amoxicillin resistance gene PBP1 are shown in SEQ ID NO.5 and SEQ ID NO.6, and the nucleotide sequence of the crRNA is shown in SEQ ID NO.14;

[0010] The nucleotide sequences of the primers for detecting the clarithromycin resistance gene 23S rRNA mutation site A2142G are shown in SEQ ID NO.1 and SEQ ID NO.2, and the nucleotide sequence of CrRNA is shown in SEQ ID NO.23;

[0011] The nucleotide sequences of the primers for detecting the clarithromycin resistance gene 23S rRNA mutation site A2144G are shown in SEQ ID NO.1 and SEQ ID NO.2, and the nucleotide sequence of CrRNA is shown in SEQ ID NO.24;

[0012] The nucleotide sequences of the primers for detecting the clarithromycin resistance gene 23S rRNA mutation site C2147G are shown in SEQ ID NO.1 and SEQ ID NO.2, and the nucleotide sequence of CrRNA is shown in SEQ ID NO.21;

[0013] The nucleotide sequences of the primers for detecting the clarithromycin resistance gene 23S rRNA mutation site T2182C are shown in SEQ ID NO.1 and SEQ ID NO.2, and the nucleotide sequence of CrRNA is shown in SEQ ID NO.20;

[0014] The nucleotide sequences of the primers for detecting the clarithromycin resistance gene 23S rRNA mutation site T2245C are shown in SEQ ID NO.3 and SEQ ID NO.4, and the nucleotide sequence of CrRNA is shown in SEQ ID NO.19;

[0015] The nucleotide sequences of the primers for detecting the clarithromycin resistance gene 23S rRNA mutation site C2289T are shown in SEQ ID NO.3 and SEQ ID NO.4, and the nucleotide sequence of CrRNA is shown in SEQ ID NO.18;

[0016] The nucleotide sequences of the primers for detecting the mutation site 320Ala / Val of the amoxicillin resistance gene PBP1 are shown in SEQ ID NO.5 and SEQ ID NO.6, and the nucleotide sequence of the crRNA is shown in SEQ ID NO.13;

[0017] The nucleotide sequences of the primers for detecting the mutation site 366Leu-Phe of the amoxicillin resistance gene PBP1 are shown in SEQ ID NO.11 and SEQ ID NO.12, and the nucleotide sequence of the crRNA is shown in SEQ ID NO.15;

[0018] The nucleotide sequences of the primers for detecting the mutation site 369Ala / Thr of the amoxicillin resistance gene PBP1 are shown in SEQ ID NO.11 and SEQ ID NO.12, and the nucleotide sequence of the crRNA is shown in SEQ ID NO.16;

[0019] The nucleotide sequences of the primers for detecting the mutation site 414Arg / Ser of the amoxicillin resistance gene PBP1 are shown in SEQ ID NO.9 and SEQ ID NO.10, and the nucleotide sequence of the crRNA is shown in SEQ ID NO.17;

[0020] The nucleotide sequences of the primers for detecting the mutation site 423Leu / Phe of the amoxicillin resistance gene PBP1 are shown in SEQ ID NO.9 and SEQ ID NO.10, and the nucleotide sequence of the crRNA is shown in SEQ ID NO.25;

[0021] The nucleotide sequences of the primers for detecting the mutation site 556Ser / Thr of the amoxicillin resistance gene PBP1 are shown in SEQ ID NO.7 and SEQ ID NO.8, and the nucleotide sequence of the crRNA is shown in SEQ ID NO.26;

[0022] The nucleotide sequences of the primers for detecting the mutation site 562Asn / Tyr of the amoxicillin resistance gene PBP1 are shown in SEQ ID NO.7 and SEQ ID NO.8, and the nucleotide sequence of the crRNA is shown in SEQ ID NO.27;

[0023] The nucleotide sequences of the primers for detecting the mutation site 593Ala / Thr of the amoxicillin resistance gene PBP1 are shown in SEQ ID NO.7 and SEQ ID NO.8, and the nucleotide sequence of the crRNA is shown in SEQ ID NO.28;

[0024] The nucleotide sequences of the primers for detecting the mutation site 595Gly / Ser of the amoxicillin resistance gene PBP1 are shown in SEQ ID NO.7 and SEQ ID NO.8, and the nucleotide sequence of CrRNA is shown in SEQ ID NO.29.

[0025] The present invention provides the use of the reagent described in the above technical solution in preparing a kit for detecting the drug resistance of Helicobacter pylori.

[0026] The invention provides a kit for detecting drug resistance of Helicobacter pylori, the kit comprising the reagent described in the above technical solution and a ssDNA-reporter probe.

[0027] Preferably, the ssDNA-reporter probe includes a ssDNA-reporter fluorescent probe or a ssDNA-reporter test strip probe.

[0028] Preferably, the sequence of the ssDNA-reporter fluorescent probe is as shown in SEQ ID NO.30, and the 5' end is modified with a fluorescent group, and the 3' end is modified with a quenching group; the sequence of the ssDNA-reporter test strip probe is 5'-TTTTTTTT-3', and the 5' end is modified with a fluorescent group, and the 3' end is modified with a quenching group.

[0029] Preferably, the fluorescent group of the ssDNA-reporter fluorescent probe includes HEX, and the quenching group includes BHQ1; the fluorescent group of the ssDNA-reporter test strip probe includes FITC, and the quenching group includes Biotin.

[0030] Preferably, the kit includes reagents required for RPA amplification reaction and reagents required for CRISPR-Cas14a reaction.

[0031] The present invention provides a method for detecting drug resistance of Helicobacter pylori for non-diagnostic purposes, comprising the following steps:

[0032] Using the DNA of the sample to be tested as a template, RPA amplification is performed using RPA primers to obtain an amplified product; the RPA primers are the primers in the reagent described in the above technical solution or the primers in the kit described in the above technical solution;

[0033] The amplified product and CrRNA are subjected to CRISPR-Cas14a reaction to obtain a reaction product; the CrRNA is the CrRNA in the reagent described in the above technical solution or the CrRNA in the kit described in the above technical solution;

[0034] The reaction product is tested by fluorescence or test strips, and the drug resistance of Helicobacter pylori is determined based on the test results, including:

[0035] When the detection method is fluorescence detection, RPA amplification and CRISPR-Cas14a reaction of DNA without the sample to be tested are set to obtain a blank reaction product. If the fluorescence value of the reaction product / the fluorescence value of the blank reaction product>1.4, the sample to be tested is resistant to amoxicillin or clarithromycin; if the fluorescence value of the reaction product / the fluorescence value of the blank reaction product is ≤1.4, the sample to be tested is not resistant to amoxicillin or clarithromycin;

[0036] When the detection method is a test strip test, the conjugate pad of the test strip is inserted into the reaction product. If bands appear on both the test line and the quality control line, the sample to be tested is resistant to amoxicillin or clarithromycin; if only a band appears on the quality control line, the sample to be tested is not resistant to amoxicillin or clarithromycin; if both the quality control line and the test line are not colored, the test result is invalid.

[0037] Preferably, the temperature of the RPA amplification is 35-42° C., and the amplification time is 12-15 min.

[0038] Beneficial effects:

[0039] The present invention provides a reagent for detecting drug resistance of Helicobacter pylori, comprising an RPA primer set and a CrRNA set; the nucleotide sequence of the RPA primer set is shown in SEQ ID NO.1 to SEQ ID NO.12; the nucleotide sequence of the CrRNA set is shown in SEQ ID NO.13 to SEQ ID NO.29. The present invention designs a primer set for RPA amplification and a CrRNA set for CRISPR-Cas14a recognition for the mutation sites A2142G, A2143G, A2144G, C2147G, T2182C, T2245C or C2289T of the clarithromycin resistance gene 23S rRNA, and the mutation sites 320Ala / Val, 366Leu-Phe, 369Ala / Thr, 374Leu / Val, 414Arg / Ser, 423Leu / Phe, 556Ser / Thr, 562Asn / Tyr, 593Ala / Thr or 595Gly / Ser of the amoxicillin resistance gene PBP1. The primer set can be specifically identified as to whether the sample to be tested contains the above mutation sites, and has the advantage of high sensitivity, which can be as low as 100 copies / μL. The reagent of the present invention can be used to simply, quickly and accurately identify whether the resistance sites of Helicobacter pylori to clarithromycin and amoxicillin in the sample are mutated, and accurately predict the drug resistance of the sample. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0041] Figure 1 A flow chart of the method for visually detecting drug-resistant mutation sites of Helicobacter pylori provided by the invention;

[0042] Figure 2 It is the specific detection result of RPA amplification of the gene fragment at the A2143G mutation site of the clarithromycin resistance gene;

[0043] Figure 3 The fluorescence detection result of the A2143G mutation site of the clarithromycin resistance gene;

[0044] Figure 4 The test results of the A2143G mutation site of the clarithromycin resistance gene;

[0045] Figure 5 It is the sensitivity test result of RPA amplification of the gene fragment at the A2143G mutation site of the clarithromycin resistance gene;

[0046] Figure 6 It is the result of sensitive fluorescence detection of the A2143G mutation site of clarithromycin resistance gene;

[0047] Figure 7 This is the sensitivity test result of the test strip for the A2143G mutation site of the clarithromycin resistance gene;

[0048] Figure 8 and Fig. 9 The specificity and sensitivity test results of the 374th site of amoxicillin resistance gene;

[0049] Fig.10 and Fig.11 The results of site-specific and sensitivity detection of the A2142G mutation of the clarithromycin resistance gene;

[0050] Fig.12 and Fig.13 The results of site-specific and sensitivity detection of the A2144G mutation of the clarithromycin resistance gene;

[0051] Fig.14 and Fig.15 The results of site-specific and sensitivity detection of the clarithromycin resistance gene C2147G mutation;

[0052] Fig.16 and Fig.17 The results of site-specific and sensitivity detection of the T2182C mutation of the clarithromycin resistance gene;

[0053] Fig.18 and Fig.19 The results of site-specific and sensitivity detection of the T2245C mutation of the clarithromycin resistance gene;

[0054] Fig. 20 and Fig.21 The results of site-specific and sensitivity detection of the clarithromycin resistance gene C2289T mutation;

[0055] Fig. 22 and Fig.23 The specific detection results and sensitivity detection results of the amoxicillin resistance gene 320 mutation site;

[0056] Fig.24 and Fig.25 The results of site-specific and sensitivity testing of amoxicillin resistance gene 366 mutation;

[0057] Fig.26 and Fig. 27 The specificity and sensitivity test results of the amoxicillin resistance gene 369 mutation site;

[0058] Fig.28 and Fig.29The specificity and sensitivity test results of the amoxicillin resistance gene 414 mutation site;

[0059] Fig.30 and Fig.31 The specificity and sensitivity test results of the amoxicillin resistance gene 423 mutation site;

[0060] Fig.32 and Fig.33 The specificity and sensitivity test results of the amoxicillin resistance gene 556 mutation site;

[0061] Fig.34 and Fig.35 The results of site-specific and sensitivity testing of amoxicillin resistance gene 562 mutation;

[0062] Fig.36 and Fig.37 The specificity and sensitivity test results of the 593 mutation site of amoxicillin resistance gene;

[0063] Fig.38 and Fig.39 The specificity and sensitivity test results of the amoxicillin resistance gene 595 mutation site;

[0064] Among them, M: DL2000 Marker, 1#-12# are different Helicobacter pylori gastric tissue samples, POS: positive sample, NTC: no template was added to the system. DETAILED DESCRIPTION

[0065] The present invention provides a reagent for detecting drug resistance of Helicobacter pylori, comprising an RPA primer set and a CrRNA set; the nucleotide sequence of the RPA primer set is shown in SEQ ID NO.1 to SEQ ID NO.12; the nucleotide sequence of the CrRNA set is shown in SEQ ID NO.13 to SEQ ID NO.29, and the specific sequence information is as follows:

[0066] SEQ ID NO.1: 5'-AAGATGAAGCGTTGAATTGAAGCCCGAGTAAA-3';

[0067] SEQ ID NO.2: 5'-CACCAAGCATTGTCCTGCCTGTGGATAAC-3';

[0068] SEQ ID NO.3: 5'-GCGTCAGTCGCAAGATGAAGCGTTGAATT-3';

[0069] SEQ ID NO.4: 5'-ACTTGTATGTCTTACAGTCAGGCTGTTCGGT-3';

[0070] SEQ ID NO.5: 5'-GCTCACGATAGATTTGGATTACCAACGCTT-3';

[0071] SEQ ID NO.6: 5'-CTAGATTTAACGAATGGCTCAAGGCTCTTG-3';

[0072] SEQ ID NO.7: 5'-CTCACGATAGATTTGGATTACCAACGCTT-3';

[0073] SEQ ID NO.8: 5'-GTGGCTAGATTTAACGAATGGCTCAAGGCT-3';

[0074] SEQ ID NO.9: 5'-GGCTATACCATAAAGCTCACGATAGATTTG-3';

[0075] SEQ ID NO.10: 5'-GGGGTGCCATGCGTGGTTTTGTTCACTGTT-3';

[0076] SEQ ID NO.11: 5'-ACCAACGCTTAGCGTTAGAGTCCTTGCGTT-3';

[0077] SEQ ID NO.12: 5'-GTTTCGCGCGGTATCAGGGATTTTAGAAGTC-3';

[0078] The first four bases at the 5' end of SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7, SEQ ID NO.9 and SEQ ID NO.11 were modified with thiophosphate respectively; SEQ ID NO.1 to SEQ ID NO.4 were used to detect clarithromycin resistance genes, and SEQ ID NO.5 to SEQ ID NO.12 were used to detect amoxicillin resistance genes.

[0079] The CrRNA sequences used in the present invention are:

[0080] SEQ ID NO.13:5'-GGGCUUCACUGAUAAAGUGGAGAACCGCUUCACCAAAAGCUGUCCCUUAGGGGAUUAGAACUUGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAAACAAAUUCAUUUUUCCUCUCCAAUUCUGCACAAGAAAGUUGCAGAACCCGAAUAGACGAAUGAAGGAAUGCAACCUUACCGGUGCUUGUG-3';

[0081] SEQ ID NO.14:5'-GGGCUUCACUGAUAAAGUGGAGAACCGCUUCACCAAAAGCUGUCCCUUAGGGGAUUAGAACUUGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAAACAAAUUCAUUUUUCCUCUCCAAUUCUGCACAAGAAAGUUGCAGAACCCGAAUAGACGAAUGAAGGAAUGCAACCUUCAUUAGACACGUU-3';

[0082] SEQ ID NO.15:5'-GGGCUUCACUGAUAAAGUGGAGAACCGCUUCACCAAAAGCUGUCCCUUAGGGGAUUAGAACUUGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAAACAAAUUCAUUUUUCCUCUCCAAUUCUGCACAAGAAAGUUGCAGAACCCGAAUAGACGAAUGAAGGAAUGCAACAAAGGCUUUAUCGUGCU-3';

[0083] SEQ ID NO.16:5'-GGGCUUCACUGAUAAAGUGGAGAACCGCUUCACCAAAAGCUGUCCCUUAGGGGAUUAGAACUUGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAAACAAAUUCAUUUUUCCUCUCCAAUUCUGCACAAGAAAGUUGCAGAACCCGAAUAGACGAAUGAAGGAAUGCAACCGAUCUGAUACAGAAA-3';

[0084] SEQ ID NO.17:5'-GGGCUUCACUGAUAAAGUGGAGAACCGCUUCACCAAAAGCUGUCCCUUAGGGGAUUAGAACUUGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAAACAAAUUCAUUUUUCCUCUCCAAUUCUGCACAAGAAAGUUGCAGAACCCGAAUAGACGAAUGAAGGAAUGCAACGAGAAUAAUUGCGGGG-3';

[0085] SEQ ID NO.18:5'-GGGCUUCACUGAUAAAGUGGAGAACCGCUUCACCAAAAGCUGUCCCUUAGGGGAUUAGAACUUGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAAACAAAUUCAUUUUUCCUCUCCAAUUCUGCACAAGAAAGUUGCAGAACCCGAAUAGACGAAUGAAGGAAUGCAACGCAAGGUUACAAACCC-3';

[0086] SEQ ID NO.19:5'-GGGCUUCACUGAUAAAGUGGAGAACCGCUUCACCAAAAGCUGUCCCUUAGGGGAUUAGAACUUGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAAACAAAUUCAUUUUUCCUCUCCAAUUCUGCACAAGAAAGUUGCAGAACCCGAAUAGACGAAUGAAGGAAUGCAACUAGAAGUCCCGGAUUU-3';

[0087] SEQ ID NO.20:5'-GGGCUUCACUGAUAAAGUGGAGAACCGCUUCACCAAAAGCUGUCCCUUAGGGGAUUAGAACUUGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAAACAAAUUCAUUUUUCCUCUCCAAUUCUGCACAAGAAAGUUGCAGAACCCGAAUAGACGAAUGAAGGAAUGCAACUAGAAGUCCCGCUUUU-3';

[0088] SEQ ID NO.21:5'-GGGCUUCACUGAUAAAGUGGAGAACCGCUUCACCAAAAGCUGUCCCUUAGGGGAUUAGAACUUGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAAACAAAUUCAUUUUUCCUCUCCAAUUCUGCACAAGAAAGUUGCAGAACCCGAAUAGACGAAUGAAGGAAUGCAACAAGCGUCAAUAUAGUU-3';

[0089] SEQ ID NO.22:5'-GGGCUUCACUGAUAAAGUGGAGAACCGCUUCACCAAAAGCUGUCCCUUAGGGGAUUAGAACUUGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAAACAAAUUCAUUUUUCCUCUCCAAUUCUGCACAAGAAAGUUGCAGAACCCGAAUAGACGAAUGAAGGAAUGCAACUCCACGGGGUCUCUCC-3';

[0090] SEQ ID NO.23:5'-GGGCUUCACUGAUAAAGUGGAGAACCGCUUCACCAAAAGCUGUCCCUUAGGGGAUUAGAACUUGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAAACAAAUUCAUUUUUCCUCUCCAAUUCUGCACAAGAAAGUUGCAGAACCCGAAUAGACGAAUGAAGGAAUGCAACCAUGAUAUUCCCGUUA-3';

[0091] SEQ ID NO.24:5'-GGGCUUCACUGAUAAAGUGGAGAACCGCUUCACCAAAAGCUGUCCCUUAGGGGAUUAGAACUUGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAAACAAAUUCAUUUUUCCUCUCCAAUUCUGCACAAGAAAGUUGCAGAACCCGAAUAGACGAAUGAAGGAAUGCAACCAUGAUAUUCCCUUUA-3';

[0092] SEQ ID NO.25:5'-GGGCUUCACUGAUAAAGUGGAGAACCGCUUCACCAAAAGCUGUCCCUUAGGGGAUUAGAACUUGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAAACAAAUUCAUUUUUCCUCUCCAAUUCUGCACAAGAAAGUUGCAGAACCCGAAUAGACGAAUGAAGGAAUGCAACCUCACUGGUGCUUGUG-3';

[0093] SEQ ID NO.26:5'-GGGCUUCACUGAUAAAGUGGAGAACCGCUUCACCAAAAGCUGUCCCUUAGGGGAUUAGAACUUGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAAACAAAUUCAUUUUUCCUCUCCAAUUCUGCACAAGAAAGUUGCAGAACCCGAAUAGACGAAUGAAGGAAUGCAACAGUCUUGAUGUCGAUC-3';

[0094] SEQ ID NO.27:5'-GGGCUUCACUGAUAAAGUGGAGAACCGCUUCACCAAAAGCUGUCCCUUAGGGGAUUAGAACUUGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAAACAAAUUCAUUUUUCCUCUCCAAUUCUGCACAAGAAAGUUGCAGAACCCGAAUAGACGAAUGAAGGAAUGCAACCUCAUGGCAUCGACUG-3';

[0095] SEQ ID NO.28: 5'-GGGCUUCACUGAUAAAGUGGAGAACCGCUUCACCAAAAGCUGUCCCUUAGGGGAUUAGAACUUGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCU UUCUUCGGAAAGUAACCCUCGAAACAAAUUCAUUUUUCCUCCAAUUCUGCACAAGAAAGUUGCAGAACCCGAAUAGACGAAUGAAGGAAUGCAACCUACUCAACUUCGCAG-3';

[0096] SEQ ID NO.29: 5'-GGGCUUCACUGAUAAAGUGGAGAACCGCUUCACCAAAAGCUGUCCCUUAGGGGAUUAGAACUUGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCU UUCUUCGGAAAGUAACCCUCGAAACAAAUUCAUUUUUCCUCCAAUUCUGCACAAGAAAGUUGCAGAACCCGAAUAGACGAAUGAAGGAAUGCAACCCAAUCGAUCUGAUGA-3';

[0097] Among them, SEQ ID NOs. 18 to 24 detect clarithromycin resistance genes, and SEQ ID NOs. 13 to 17 and SEQ ID NOs. 25 to 29 detect amoxicillin resistance genes.

[0098] In the present invention, the nucleotide sequence of the primer for detecting the clarithromycin resistance gene 23S rRNA mutation site A2143G is preferably as shown in SEQ ID NO.1 and SEQ ID NO.2, and the nucleotide sequence of CrRNA is preferably as shown in SEQ ID NO.22;

[0099] The nucleotide sequence of the primer for detecting the mutation site 374Leu / Val of the amoxicillin resistance gene PBP1 is preferably as shown in SEQ ID NO.5 and SEQ ID NO.6, and the nucleotide sequence of the crRNA is preferably as shown in SEQ ID NO.14;

[0100] The nucleotide sequence of the primer for detecting the clarithromycin resistance gene 23S rRNA mutation site A2142G is preferably as shown in SEQ ID NO.1 and SEQ ID NO.2, and the nucleotide sequence of CrRNA is preferably as shown in SEQ ID NO.23;

[0101] The nucleotide sequence of the primer for detecting the clarithromycin resistance gene 23S rRNA mutation site A2144G is preferably as shown in SEQ ID NO.1 and SEQ ID NO.2, and the nucleotide sequence of CrRNA is preferably as shown in SEQ ID NO.24;

[0102] The nucleotide sequence of the primer for detecting the clarithromycin resistance gene 23S rRNA mutation site C2147G is preferably as shown in SEQ ID NO.1 and SEQ ID NO.2, and the nucleotide sequence of CrRNA is preferably as shown in SEQ ID NO.21;

[0103] The nucleotide sequence of the primer for detecting the clarithromycin resistance gene 23S rRNA mutation site T2182C is preferably as shown in SEQ ID NO.1 and SEQ ID NO.2, and the nucleotide sequence of CrRNA is preferably as shown in SEQ ID NO.20;

[0104] The nucleotide sequence of the primer for detecting the clarithromycin resistance gene 23S rRNA mutation site T2245C is preferably as shown in SEQ ID NO.3 and SEQ ID NO.4, and the nucleotide sequence of CrRNA is preferably as shown in SEQ ID NO.19;

[0105] The nucleotide sequence of the primer for detecting the clarithromycin resistance gene 23S rRNA mutation site C2289T is preferably as shown in SEQ ID NO.3 and SEQ ID NO.4, and the nucleotide sequence of CrRNA is preferably as shown in SEQ ID NO.18;

[0106] The nucleotide sequence of the primer for detecting the mutation site 320Ala / Val of the amoxicillin resistance gene PBP1 is preferably as shown in SEQ ID NO.5 and SEQ ID NO.6, and the nucleotide sequence of the crRNA is preferably as shown in SEQ ID NO.13;

[0107] The nucleotide sequence of the primer for detecting the mutation site 366Leu-Phe of the amoxicillin resistance gene PBP1 is preferably as shown in SEQ ID NO.11 and SEQ ID NO.12, and the nucleotide sequence of the crRNA is preferably as shown in SEQ ID NO.15;

[0108] The nucleotide sequence of the primer for detecting the mutation site 369Ala / Thr of the amoxicillin resistance gene PBP1 is preferably as shown in SEQ ID NO.11 and SEQ ID NO.12, and the nucleotide sequence of the crRNA is preferably as shown in SEQ ID NO.16;

[0109] The nucleotide sequence of the primer for detecting the mutation site 414Arg / Ser of the amoxicillin resistance gene PBP1 is preferably as shown in SEQ ID NO.9 and SEQ ID NO.10, and the nucleotide sequence of the crRNA is preferably as shown in SEQ ID NO.17;

[0110] The nucleotide sequence of the primer for detecting the mutation site 423Leu / Phe of the amoxicillin resistance gene PBP1 is preferably as shown in SEQ ID NO.9 and SEQ ID NO.10, and the nucleotide sequence of the crRNA is preferably as shown in SEQ ID NO.25;

[0111] The nucleotide sequence of the primer for detecting the mutation site 556Ser / Thr of the amoxicillin resistance gene PBP1 is preferably as shown in SEQ ID NO.7 and SEQ ID NO.8, and the nucleotide sequence of the crRNA is preferably as shown in SEQ ID NO.26;

[0112] The nucleotide sequence of the primer for detecting the mutation site 562Asn / Tyr of the amoxicillin resistance gene PBP1 is preferably as shown in SEQ ID NO.7 and SEQ ID NO.8, and the nucleotide sequence of the crRNA is preferably as shown in SEQ ID NO.27;

[0113] The nucleotide sequence of the primer for detecting the mutation site 593Ala / Thr of the amoxicillin resistance gene PBP1 is preferably as shown in SEQ ID NO.7 and SEQ ID NO.8, and the nucleotide sequence of the crRNA is preferably as shown in SEQ ID NO.28;

[0114] The nucleotide sequence of the primer for detecting the mutation site 595Gly / Ser of the amoxicillin resistance gene PBP1 is preferably as shown in SEQ ID NO.7 and SEQ ID NO.8, and the nucleotide sequence of CrRNA is preferably as shown in SEQ ID NO.29.

[0115] The primers in the primer set provided by the present invention can specifically amplify gene fragments containing multiple mutation sites of clarithromycin resistance gene 23S rRNA or amoxicillin resistance gene PBP1, and the CrRNA in the CrRNA group can specifically identify the obtained amplification product, thereby detecting whether the sample to be tested has a mutation site of the resistance gene. The reagent of the present invention can be used to easily and quickly accurately identify whether the resistance sites of Helicobacter pylori to clarithromycin and amoxicillin in the sample are mutated, accurately predict the drug resistance of the sample, provide precision medical services for clinicians, and guide the individualized diagnosis and treatment of Helicobacter pylori patients.

[0116] The present invention also provides the use of the reagent described in the above technical solution in preparing a kit for detecting the drug resistance of Helicobacter pylori.

[0117] The present invention also provides a kit for detecting the drug resistance of Helicobacter pylori, the kit comprising the reagent described in the above technical solution and a ssDNA-reporter probe.

[0118] In the present invention, the ssDNA-reporter probe preferably includes a ssDNA-reporter fluorescent probe or a ssDNA-reporter test strip probe; the sequence of the ssDNA-reporter fluorescent probe is preferably as shown in SEQ ID NO.30, specifically as follows: 5'-TTTTTTTTTTTT-3', and the 5' end is modified with a fluorescent group, and the 3' end is modified with a quenching group; the sequence of the ssDNA-reporter test strip probe is preferably 5'-TTTTTTTT-3', and the 5' end is modified with a fluorescent group, and the 3' end is modified with a quenching group; the fluorescent group of the ssDNA-reporter fluorescent probe preferably includes HEX, and the quenching group preferably includes BHQ1; the fluorescent group of the ssDNA-reporter test strip probe preferably includes FITC, and the quenching group preferably includes Biotin; the kit preferably includes reagents required for RPA amplification reaction and reagents required for CRISPR-Cas14a reaction; the reagents required for RPA amplification reaction preferably include TwistAmp Basic Kit and plasmid standards containing drug-resistant gene fragments; the reagents required for the CRISPR-Cas14a reaction preferably include: DEPC water, buffer, Cas14a enzyme, CrRNA, RNase inhibitor and T7 exonuclease. The reagents used in the present invention and the embodiments are conventional reagents in the field of the technology, and the materials are all commercially available. The synthesized primers, CrRNA, plasmids, etc. are all synthesized at Sangon Biotech (Shanghai) Co., Ltd. The construction process of the plasmid standards containing drug-resistant gene fragments is: using the genomic DNA of the drug-resistant strain as a template and using the RPA primers corresponding to the mutation site for RPA amplification, the sequencing results are indeed drug-resistant, and the amplified product is cloned into the puc57 plasmid vector.

[0119] The present invention also provides a method for detecting drug resistance of Helicobacter pylori for non-diagnostic purposes, comprising the following steps:

[0120] Using the DNA of the sample to be tested as a template, RPA amplification is performed using RPA primers to obtain an amplified product; the RPA primers are the primers in the reagent described in the above technical solution or the primers in the kit described in the above technical solution;

[0121] The amplified product and CrRNA are subjected to CRISPR-Cas14a reaction to obtain a reaction product; the CrRNA is the CrRNA in the reagent described in the above technical solution or the CrRNA in the kit described in the above technical solution;

[0122] The reaction product is tested by fluorescence or test strips, and the drug resistance of Helicobacter pylori is determined based on the test results, including:

[0123] When the detection method is fluorescence detection, RPA amplification and CRISPR-Cas14a reaction of DNA without the sample to be tested are set to obtain a blank reaction product. If the fluorescence value of the reaction product / the fluorescence value of the blank reaction product>1.4, the sample to be tested is resistant to amoxicillin or clarithromycin; if the fluorescence value of the reaction product / the fluorescence value of the blank reaction product is ≤1.4, the sample to be tested is not resistant to amoxicillin or clarithromycin;

[0124] When the detection method is a test strip test, the conjugate pad of the test strip is inserted into the reaction product. If bands appear on both the test line and the quality control line, the sample to be tested is resistant to amoxicillin or clarithromycin; if only a band appears on the quality control line, the sample to be tested is not resistant to amoxicillin or clarithromycin; if both the quality control line and the test line are not colored, the test result is invalid.

[0125] The present invention uses the DNA of the sample to be tested as a template, and uses RPA primers to perform RPA amplification to obtain an amplified product. In the present invention, the sample to be tested preferably includes one or more of an oral content sample, a fecal sample, and a tissue sample; the oral content sample preferably includes saliva and / or dental plaque; the temperature of the RPA amplification is preferably 35-42°C, more preferably 37°C; the amplification time is preferably 12-15min, more preferably 15min; the reaction system of the RPA amplification preferably includes 29.5μL RPA buffer, 2.4μL of upstream and downstream primers, 11.2μL of ddH 2 0 and 2 μL target DNA; the final concentration of the upstream and downstream primers in the system is preferably 0.48 μM. The primers provided by the present invention have the advantages of strong specificity and high sensitivity, and can be amplified quickly and with high throughput.

[0126] After obtaining the amplified product, the present invention performs a CRISPR-Cas14a reaction on the amplified product and CrRNA to obtain a reaction product. In the present invention, the temperature of the CRISPR-Cas14a reaction is preferably 35-42°C, more preferably 35°C; the reaction time is preferably 15-45min, more preferably 30min; the reaction system is preferably: 1-3μL RPA amplification product, 11-13μL DEPC water, 1-3μL buffer, 0.5-1.5pmol Cas14a enzyme, 0.1-0.5μM CrRNA, 15U-40U RNase inhibitor, 2U-10U T7 exonuclease and 0.1-0.5μM ssDNA-reporter, more preferably 2μL RPA amplification product is added with 11.5μL DEPC water, 2μL buffer, 1μL Cas14a enzyme, 1μL CrRNA, 20U RNase inhibitor, 5UT7 exonuclease and 1μL ssDNA-reporter.

[0127] After obtaining the reaction product, the present invention performs fluorescence detection or test strip detection on the reaction product, and determines the drug resistance of Helicobacter pylori according to the detection result, including:

[0128] When the detection method is fluorescence detection, RPA amplification and CRISPR-Cas14a reaction of DNA without the sample to be tested are set to obtain a blank reaction product. If the fluorescence value of the reaction product / the fluorescence value of the blank reaction product>1.4, the sample to be tested is resistant to amoxicillin or clarithromycin; if the fluorescence value of the reaction product / the fluorescence value of the blank reaction product is ≤1.4, the sample to be tested is not resistant to amoxicillin or clarithromycin;

[0129] When the detection method is a test strip test, the conjugate pad of the test strip is inserted into the reaction product. If bands appear on both the test line and the quality control line, the sample to be tested is resistant to amoxicillin or clarithromycin; if only a band appears on the quality control line, the sample to be tested is not resistant to amoxicillin or clarithromycin; if both the quality control line and the test line are not colored, the test result is invalid.

[0130] The amplified product ssDNA obtained by RPA amplification and the crRNA corresponding to the primer are ultra-sensitively, specifically and accurately identified under the action of the Cas14a enzyme, and then the auxiliary cutting function is activated to cut the ssDNA, and finally the results are displayed by fluorescence or test strips.

[0131] The method provided by the present invention can take microbial DNA from gastric disease tissues, saliva, dental plaque and other parts of patients as research objects, and conduct on-site rapid detection of the mutation site A2143G of clarithromycin-resistant gene 23S rRNA of Helicobacter pylori under constant temperature conditions, use RPA technology to achieve exponential amplification of Helicobacter pylori target gene sequences, and design a guide crRNA and ssDNA-ssDNA-reporter labeled with fluorescence or recognition elements for specific and accurate identification of Helicobacter pylori based on the CRISPR-Cas14a system. High-throughput detection can be achieved through fluorescence display or the results can be visualized by combining lateral flow test strip detection technology. The entire reaction can complete the detection process within the range of 35-39°C and is completed within 45 minutes, thereby achieving rapid, sensitive, visual and high-throughput detection of Helicobacter pylori resistance genes, and providing technical services for large-scale rapid screening and diagnosis.

[0132] The present invention designs specific RPA amplification primers and corresponding crRNA recognition sequences for the sequence conserved regions of drug-resistant genes in Helicobacter pylori. After combining with Cas14a, the sensitivity is improved by at least one order of magnitude. First, RPA amplification is performed on the samples to be tested in gastric disease tissues, saliva, dental plaque and other parts of the patients, and then, under the guidance of crRNA, the RPA amplification product is accurately identified. If the target DNA contains drug-resistant gene mutation sites (single-base mutations can be identified), CRISPR-Cas14a and the ssDNA of the amplified fragment are combined to form a ternary complex, thereby starting the accessory cutting function, arbitrarily cutting the ssDNA in the system, emitting a fluorescent signal, and performing fluorescent display results or test strip detection to detect whether the target sequence exists in the detection system.

[0133] The present invention realizes double signal amplification of the target in the presence of target DNA, and can detect a fluorescent signal significantly higher than that of the negative control, so the presence of the target drug resistance gene in the system can be detected. In addition, the immunochromatographic strip detection method is based on nucleic acid detection, and the 5' end of the single-stranded DNA is labeled with FITC fluorescein and the 3' end is labeled with biotin, and the fluorescence intensity is determined by immunochromatography, making the detection result more intuitive and simpler.

[0134] In the present invention, the ssDNA fluorescent probe is a single-stranded nucleotide sequence labeled with HEX at the 5' end and BHQ1 at the 3' end, and the probe of the test strip ssDNA is a single-stranded nucleotide sequence labeled with FITC at the 5' end and Biotin at the 3' end; the ssDNA fluorescent probe modified with HEX and BHQ1 can be used for a handheld fluorescence detector to detect whether there is a mutation site of a drug-resistant gene in a target system, and the ssDNA fluorescent probe modified with FITC and Biotin can also be used for a colloidal gold test strip to detect whether there is a mutation site of a drug-resistant gene in a target system.

[0135] Compared with the prior art, the present invention has the following beneficial effects:

[0136] The present invention proposes a simple, rapid, sensitive and portable technical method and kit (i.e., RPA-CRISPR-Cas14a) for detecting Helicobacter pylori resistance gene mutation sites by combining recombinase polymerase amplification with CRISPR-Cas14a fluorescence or lateral flow test strips. The RPA amplification reaction and CRISPR-Cas14a detection system established according to the present invention have good stability, strong practicality and high amplification efficiency. The detection technology can accurately identify the base changes at the mutation sites, and single-base mutations can still be quickly identified without cross-reaction. The detection coincidence rate of fluorescence detection and test strip detection is 100%.

[0137] In the fluorescence detection method of the RPA-CRISPR-Cas14a system of the present invention, the relative fluorescence intensity of the target DNA is detected or directly measured with a test strip, and then the result is determined, which is suitable for pre-diagnosis detection and data analysis in hospital outpatient clinics.

[0138] The RPA-CRISPR-Cas14a fluorescence method and the test strip method in the present invention are both sensitive, specific, rapid and intuitive methods for detecting Helicobacter pylori resistance genes, and do not require auxiliary equipment. This method provides a technical means for rapid on-site screening and provides services for guiding clinical antibiotic use.

[0139] In summary, the method and kit for quickly detecting Helicobacter pylori resistance gene mutation sites based on the RPA-CRISPR-Cas14a system provided by the present invention can quickly and ultra-sensitively identify the resistance mutation gene sites of Helicobacter pylori. The detection method has strong specificity and the sensitivity can be as low as 100 copies / μL, and high-throughput detection can be quickly completed within 1 hour.

[0140] To further illustrate the present invention, a reagent, a kit and applications for detecting drug resistance of Helicobacter pylori provided by the present invention are described in detail below in conjunction with the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0141] Example 1

[0142] Design and selection of RPA primers for mutation sites of 23S rRNA of clarithromycin resistance gene

[0143] Targeting the mutation site A2143G of the clarithromycin resistance gene 23S rRNA, 5 sets of RPA primer pairs were set up. After synthesis, the band specificity and sensitivity of the primers were screened and tested, and finally the following most suitable primer pairs were obtained. The primer sequences are shown in SEQID.NO.1 and SEQID.NO.2.

[0144] Example 2

[0145] CrRNA was designed on the fragment at the mutation site A2143G of the clarithromycin resistance gene 23S rRNA. The CrRNA guide sequence with the highest recognition efficiency was shown in SEQ ID NO.22, with a recognition length of 16 bp and a mutation site at position 4.

[0146] Example 3

[0147] A method for detecting drug resistance of Helicobacter pylori based on the RPA-CRISPR-Cas14a system, the steps are as follows:

[0148] 1) The RPA amplification system premix was evenly distributed into a reaction tube and mixed thoroughly. The reaction tube contained freeze-dried particles of the kit for RPA amplification enzyme. The RPA amplification system was: 29.5 μL RPA buffer, 2.4 μL upstream and downstream primers (final concentration of 0.48 μM each), ddH 2 O 11.2 μL and 2 μL target DNA (10 0 -10 6 copy); the upstream and downstream primer sequences are shown in SEQ ID.NO.1 and SEQ ID.NO.2; a positive control group is set up at the same time, and the target DNA is replaced with a plasmid standard;

[0149] 2) Evenly distribute 47.5 μL of premix into each reaction tube containing the lyophilized particles of the TwistAmp Basic kit, mix thoroughly, then transfer 2.5 μL (700 mM) of magnesium acetate to the test tube cap, and the final volume of each reaction tube is 50 μL;

[0150] 3) The reaction mixing tube was inverted 10 times to mix evenly, and then placed in a constant temperature reactor at 35°C for reaction. After 15 minutes, the RPA amplification product was obtained;

[0151] 4) Perform CRISPR-Cas14a accessory cleavage on the RPA amplification product and perform fluorescence detection or test strip detection; the CRISPR-Cas14a accessory cleavage reaction system and process are as follows: 2 μL of RPA amplification product is added to a Cas14a enzyme digestion reaction system consisting of 11.5 μL DEPC water, 2 μL buffer, 1 μL Cas14a enzyme, 1 μL CrRNA (SEQ ID NO.22), 20U RNase inhibitor, 5U T7 exonuclease and 1 μL ssDNA-reporter, and placed in a constant temperature amplification instrument at 35°C for digestion for 30 minutes. At the end of the reaction, fluorescence detection and test strip detection are respectively used, and finally the results are judged; during fluorescence detection, the sequence of the ssDNA-reporter is: 5'-HEX-TTTTTTTTTTTT-BHQ1-3'; during test strip detection, the sequence of the ssDNA-reporter is: 5'-FITC-TTTTTTTT-Biotin-3'.

[0152] The fluorescence detection method and the test strip detection method are described as follows:

[0153] a) Fluorescence detection method: The fluorescence value is measured. If the value is greater than 1.4 times the value of the NTC without target DNA (NTC), it is positive, otherwise it is negative.

[0154] b) Test strip detection method: After the enzyme digestion is completed, add 5μL of the digestion product and 95μL of buffer to a 1.5mL centrifuge tube, and insert the test strip (HybriDetect-Universal Lateral Flow Assay Kit, catalog number MGHD 1) into the centrifuge tube; the liquid level should not exceed the high-end binding pad. After incubation for 2 to 5 minutes, observe the bands of the test line (T) and the control line (C). The method for determining the test result is as follows: if both the T line and the C line have bands, it is positive; if only the C line has bands, it is negative; if both the C line and the T line are not colored, the test result is invalid.

[0155] Taking gastric tissue as an example, microbial DNA was extracted from 12 gastric tissue samples containing the mutation site A2143G of the clarithromycin resistance gene 23S rRNA and tested using the above method. The results are as follows: Figure 2 to Figure 4 shown.

[0156] Depend on Figures 2 to 4 It can be seen that the samples containing Helicobacter pylori all showed a target band of 368 bp ( Figure 2 Lanes 1 to 13 in the figure), samples without Helicobacter pylori (NTC, Figure 2 The corresponding band does not appear in lane 14 of Figure 2 ). The samples containing Helicobacter pylori all produced significant fluorescence signals, while the samples without Helicobacter pylori (NTC) only produced weak fluorescence signals (see Figure 3 The test result of the CrRNA designed for the mutation site A2143G of 23S rRNA was positive, that is, both the test line and the quality control line appeared, and the test line band was obvious, the quality control line band of the negative control (NTC) was obvious, and the test line band was extremely weak (see Figure 4 ). Experiments have shown that the test strip test results are the same as the fluorescence test results.

[0157] Example 4

[0158] Sensitivity test

[0159] The method of Example 3 was used to select different copy numbers (10 8 , 10 7 , 10 6 , 10 5 , 10 4 , 10 3 , 500, 250, 100, NTC) of Helicobacter pylori clarithromycin resistance gene 23S rRNA mutation site A2143G after RPA amplification was used as the target DNA, and the sensitivity of the RPA-CRISPR-Cas14a system was tested; at the same time, a non-mutated sample was set as a control, and the experimental process of the control was similar to that of the sample containing the mutation site, except that the template amplified by RPA was replaced by a negative standard plasmid; the construction process of the negative standard plasmid was as follows: entrusting Sangon Biotech (Shanghai) Co., Ltd. to use the genomic DNA of strain ATCC26695 as a template and use the corresponding RPA primer pair at the mutation site for RPA amplification, and then clone the amplified product into the puc57 plasmid vector to obtain the negative standard plasmid.

[0160] in, Figure 5 This is the sensitivity test result after RPA amplification of the mutation site A2143G of the clarithromycin resistance gene 23S rRNA of Helicobacter pylori; Figure 6 The results of sensitive fluorescence detection of the ssDNA-reporter cut after Cas14a accurately recognized the mutation site A2143G of the 23S rRNA of the clarithromycin resistance gene of Helicobacter pylori; Figure 7 This is the sensitivity test result of the test strip where Cas14a accurately recognizes and cuts the ssDNA-reporter at the mutation site A2143G of the clarithromycin resistance gene 23S rRNA of Helicobacter pylori.

[0161] Depend on Figure 5 to Figure 7It can be seen that the 10 8 -10 3 The difference in fluorescence values ​​of the copies is very large, and the fluorescence intensity still has a significant difference at 100 copies. Therefore, the fluorescence detection sensitivity of the detection method provided by the present invention is 100 copies. The test strip test results show that at the limit of 100 copies, the signal of the T line of the test strip containing the mutation site A2143G is still obvious. When the template concentration is lower than 100 copies, only an obvious C line signal is observed, that is, the detection limit of the test strip detection of the detection method provided by the present invention is 100 copies.

[0162] Example 5

[0163] The 374Leu / Val site of the amoxicillin resistance gene PBP1 was detected using the methods of Examples 3 and 4, except that the RPA primers were replaced with primers shown in SEQ ID NO.5 and SEQ ID NO.6, the nucleotide sequence of the crRNA was SEQ ID NO.14, and the gastric tissue sample was replaced with a gastric tissue sample containing the corresponding mutation site. The test results were as follows: Figure 8 and Fig. 9 shown.

[0164] Example 6

[0165] The A2142G site of the clarithromycin resistance gene 23S rRNA was detected using the methods of Examples 3 and 4, except that the RPA primers were replaced with primers shown in SEQ ID NO.1 and SEQ ID NO.2, the nucleotide sequence of CrRNA was SEQID NO.23, and the gastric tissue sample was replaced with a gastric tissue sample containing the corresponding mutation site. The test results were as follows: Fig.10 and Fig.11 shown.

[0166] Example 7

[0167] The A2144G site of the clarithromycin resistance gene 23S rRNA was detected using the methods of Examples 3 and 4, except that the RPA primers were replaced with primers shown in SEQ ID NO.1 and SEQ ID NO.2, the nucleotide sequence of CrRNA was SEQID NO.24, and the gastric tissue sample was replaced with a gastric tissue sample containing the corresponding mutation site. The test results were as follows: Fig.12 and Fig.13 shown.

[0168] Example 8

[0169] The C2147G site of the clarithromycin resistance gene 23S rRNA was detected using the methods of Examples 3 and 4, except that the RPA primers were replaced with primers shown in SEQ ID NO.1 and SEQ ID NO.2, the nucleotide sequence of CrRNA was SEQID NO.21, and the gastric tissue sample was replaced with a gastric tissue sample containing the corresponding mutation site. The test results were as follows: Fig.14 and Fig.15 shown.

[0170] Example 9

[0171] The T2182C site of the clarithromycin resistance gene 23S rRNA was detected using the methods of Examples 3 and 4, except that the RPA primers were replaced with primers shown in SEQ ID NO.1 and SEQ ID NO.2, the nucleotide sequence of CrRNA was SEQID NO.20, and the gastric tissue sample was replaced with a gastric tissue sample containing the corresponding mutation site. The test results were as follows: Fig.16 and Fig.17 shown.

[0172] Example 10

[0173] The T2245C site of the clarithromycin resistance gene 23S rRNA was detected using the methods of Examples 3 and 4, except that the RPA primers were replaced with primers shown in SEQ ID NO.3 and SEQ ID NO.4, the nucleotide sequence of CrRNA was SEQ ID NO.19, and the gastric tissue sample was replaced with a gastric tissue sample containing the corresponding mutation site. The test results were as follows: Fig.18 and Fig.19 shown.

[0174] Embodiment 11

[0175] The C2289T site of the clarithromycin resistance gene 23S rRNA was detected using the methods of Examples 3 and 4, except that the RPA primers were replaced with primers shown in SEQ ID NO.3 and SEQ ID NO.4, the nucleotide sequence of CrRNA was SEQ ID NO.18, and the gastric tissue sample was replaced with a gastric tissue sample containing the corresponding mutation site. The test results were as follows: Fig. 20 and Fig.21 shown.

[0176] Example 12

[0177] The 320Ala / Val site of the amoxicillin resistance gene PBP1 was detected using the methods of Examples 3 and 4, except that the RPA primers were replaced with primers shown in SEQ ID NO.5 and SEQ ID NO.6, the nucleotide sequence of the CrRNA was SEQ ID NO.13, and the gastric tissue sample was replaced with a gastric tissue sample containing the corresponding mutation site. The test results were as follows: Fig. 22 and Fig.23 shown.

[0178] Example 13

[0179] The 366Leu-Phe site of the amoxicillin resistance gene PBP1 was detected using the methods of Examples 3 and 4, except that the RPA primers were replaced with primers shown in SEQ ID NO.11 and SEQ ID NO.12, the nucleotide sequence of the crRNA was SEQ ID NO.15, and the gastric tissue sample was replaced with a gastric tissue sample containing the corresponding mutation site. The test results were as follows: Fig.24 and Fig.25 shown.

[0180] Embodiment 14

[0181] The 369Ala / Thr site of the amoxicillin resistance gene PBP1 was detected using the methods of Examples 3 and 4, except that the RPA primers were replaced with primers shown in SEQ ID NO.11 and SEQ ID NO.12, the nucleotide sequence of the crRNA was SEQ ID NO.16, and the gastric tissue sample was replaced with a gastric tissue sample containing the corresponding mutation site. The test results were as follows: Fig.26 and Fig. 27 shown.

[0182] Embodiment 15

[0183] The 414Arg / Ser site of the amoxicillin resistance gene PBP1 was detected using the methods of Examples 3 and 4, except that the RPA primers were replaced with primers shown in SEQ ID NO.9 and SEQ ID NO.10, the nucleotide sequence of the crRNA was SEQID NO.17, and the gastric tissue sample was replaced with a gastric tissue sample containing the corresponding mutation site. The test results were as follows: Fig.28 and Fig.29 shown.

[0184] Example 16

[0185] The 423Leu / Phe site of the amoxicillin resistance gene PBP1 was detected using the methods of Examples 3 and 4, except that the RPA primers were replaced with primers shown in SEQ ID NO.9 and SEQ ID NO.10, the nucleotide sequence of the crRNA was SEQID NO.25, and the gastric tissue sample was replaced with a gastric tissue sample containing the corresponding mutation site. The test results were as follows: Fig.30 and Fig.31 shown.

[0186] Embodiment 17

[0187] The 556Ser / Thr site of the amoxicillin resistance gene PBP1 was detected using the methods of Examples 3 and 4, except that the RPA primers were replaced with primers shown in SEQ ID NO.7 and SEQ ID NO.8, the nucleotide sequence of the crRNA was SEQ ID NO.26, and the gastric tissue sample was replaced with a gastric tissue sample containing the corresponding mutation site. The test results were as follows: Fig.32 and Fig.33 shown.

[0188] Embodiment 18

[0189] The 562Asn / Tyr site of the amoxicillin resistance gene PBP1 was detected using the methods of Examples 3 and 4, except that the RPA primers were replaced with primers shown in SEQ ID NO.7 and SEQ ID NO.8, the nucleotide sequence of the crRNA was SEQ ID NO.27, and the gastric tissue sample was replaced with a gastric tissue sample containing the corresponding mutation site. The test results were as follows: Fig.34 and Fig.35 shown.

[0190] Embodiment 19

[0191] The 593Ala / Thr site of the amoxicillin resistance gene PBP1 was detected using the methods of Examples 3 and 4, except that the RPA primers were replaced with primers shown in SEQ ID NO.7 and SEQ ID NO.8, the nucleotide sequence of the crRNA was SEQ ID NO.28, and the gastric tissue sample was replaced with a gastric tissue sample containing the corresponding mutation site. The test results were as follows: Fig.36 and Fig.37 shown.

[0192] Embodiment 20

[0193] The 595Gly / Ser site of the amoxicillin resistance gene PBP1 was detected using the methods of Examples 3 and 4, except that the RPA primers were replaced with primers shown in SEQ ID NO.7 and SEQ ID NO.8, the nucleotide sequence of the CrRNA was SEQID NO.29, and the gastric tissue sample was replaced with a gastric tissue sample containing the corresponding mutation site. The test results were as follows: Fig.38 and Fig.39 shown.

[0194] Depend on Figures 8 to 39 It can be seen that the samples containing Helicobacter pylori all produced significant fluorescence signals, while the samples without Helicobacter pylori (NTC) only produced weak fluorescence signals. 8 -10 3 The fluorescence values ​​of the copies vary greatly, and there is still a significant difference in fluorescence intensity at 100 copies.

[0195] In summary, according to the primer pairs and CrRNA provided by the present invention, the detection process can be completed within the range of 35-39°C, and completed within 45min, with good specificity, and the minimum detection sensitivity reaches 100 copies; the reaction system volume is reduced to 20 μL and 100 copies of target molecules can still be stably detected; it can be detected by invasive and non-invasive methods in gastric tissue, saliva, dental plaque and other parts where Helicobacter pylori is easily present, and the specificity and sensitivity are good. The RPA-CRISPR-Cas14a detection method established by the present invention is efficient and specific, and does not require complex equipment, and only requires a handheld fluorescence analyzer at room temperature to complete the entire detection process.

[0196] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A reagent for detecting drug resistance of Helicobacter pylori, It is characterized in that It includes an RPA primer set and a CrRNA set; the nucleotide sequence of the RPA primer set is shown in SEQ ID NO.1 to SEQ ID NO.12; the nucleotide sequence of the CrRNA set is shown in SEQ ID NO.13 to SEQ ID NO.

29.

2. The reagent according to claim 1, It is characterized in that The nucleotide sequences of the primers for detecting the clarithromycin resistance gene 23S rRNA mutation site A2143G are shown in SEQ ID NO.1 and SEQ ID NO.2, and the nucleotide sequence of CrRNA is shown in SEQ ID NO.22; The nucleotide sequences of the primers for detecting the mutation site 374Leu / Val of the amoxicillin resistance gene PBP1 are shown in SEQ ID NO.5 and SEQ ID NO.6, and the nucleotide sequence of the crRNA is shown in SEQ ID NO.14; The nucleotide sequences of the primers for detecting the clarithromycin resistance gene 23S rRNA mutation site A2142G are shown in SEQ ID NO.1 and SEQ ID NO.2, and the nucleotide sequence of CrRNA is shown in SEQ ID NO.23; The nucleotide sequences of the primers for detecting the clarithromycin resistance gene 23S rRNA mutation site A2144G are shown in SEQ ID NO.1 and SEQ ID NO.2, and the nucleotide sequence of CrRNA is shown in SEQ ID NO.24; The nucleotide sequences of the primers for detecting the clarithromycin resistance gene 23S rRNA mutation site C2147G are shown in SEQ ID NO.1 and SEQ ID NO.2, and the nucleotide sequence of CrRNA is shown in SEQ ID NO.21; The nucleotide sequences of the primers for detecting the clarithromycin resistance gene 23S rRNA mutation site T2182C are shown in SEQ ID NO.1 and SEQ ID NO.2, and the nucleotide sequence of CrRNA is shown in SEQ ID NO.20; The nucleotide sequences of the primers for detecting the clarithromycin resistance gene 23S rRNA mutation site T2245C are shown in SEQ ID NO.3 and SEQ ID NO.4, and the nucleotide sequence of CrRNA is shown in SEQ ID NO.19; The nucleotide sequences of the primers for detecting the clarithromycin resistance gene 23S rRNA mutation site C2289T are shown in SEQ ID NO.3 and SEQ ID NO.4, and the nucleotide sequence of CrRNA is shown in SEQ ID NO.18; The nucleotide sequences of the primers for detecting the mutation site 320Ala / Val of the amoxicillin resistance gene PBP1 are shown in SEQ ID NO.5 and SEQ ID NO.6, and the nucleotide sequence of the crRNA is shown in SEQ ID NO.13; The nucleotide sequences of the primers for detecting the mutation site 366Leu-Phe of the amoxicillin resistance gene PBP1 are shown in SEQ ID NO.11 and SEQ ID NO.12, and the nucleotide sequence of the crRNA is shown in SEQ ID NO.15; The nucleotide sequences of the primers for detecting the mutation site 369Ala / Thr of the amoxicillin resistance gene PBP1 are shown in SEQ ID NO.11 and SEQ ID NO.12, and the nucleotide sequence of the crRNA is shown in SEQ ID NO.16; The nucleotide sequences of the primers for detecting the mutation site 414Arg / Ser of the amoxicillin resistance gene PBP1 are shown in SEQ ID NO.9 and SEQ ID NO.10, and the nucleotide sequence of the crRNA is shown in SEQ ID NO.17; The nucleotide sequences of the primers for detecting the mutation site 423Leu / Phe of the amoxicillin resistance gene PBP1 are shown in SEQ ID NO.9 and SEQ ID NO.10, and the nucleotide sequence of the crRNA is shown in SEQ ID NO.25; The nucleotide sequences of the primers for detecting the mutation site 556Ser / Thr of the amoxicillin resistance gene PBP1 are shown in SEQ ID NO.7 and SEQ ID NO.8, and the nucleotide sequence of the crRNA is shown in SEQ ID NO.26; The nucleotide sequences of the primers for detecting the mutation site 562Asn / Tyr of the amoxicillin resistance gene PBP1 are shown in SEQ ID NO.7 and SEQ ID NO.8, and the nucleotide sequence of the crRNA is shown in SEQ ID NO.27; The nucleotide sequences of the primers for detecting the mutation site 593Ala / Thr of the amoxicillin resistance gene PBP1 are shown in SEQ ID NO.7 and SEQ ID NO.8, and the nucleotide sequence of the crRNA is shown in SEQ ID NO.28; The nucleotide sequences of the primers for detecting the mutation site 595Gly / Ser of the amoxicillin resistance gene PBP1 are shown in SEQ ID NO.7 and SEQ ID NO.8, and the nucleotide sequence of CrRNA is shown in SEQ ID NO.

29.

3. Use of the reagent according to claim 1 or 2 in preparing a kit for detecting drug resistance of Helicobacter pylori.

4. A kit for detecting drug resistance of Helicobacter pylori, It is characterized in that The kit comprises the reagent according to claim 1 or 2 and a ssDNA-reporter probe.

5. The kit according to claim 4, It is characterized in that The ssDNA-reporter probe includes a ssDNA-reporter fluorescent probe or a ssDNA-reporter test strip probe.

6. The kit according to claim 5, It is characterized in that The sequence of the ssDNA-reporter fluorescent probe is shown in SEQ ID NO.30, and the 5' end is modified with a fluorescent group, and the 3' end is modified with a quenching group; the sequence of the ssDNA-reporter test strip probe is 5'-TTTTTTTT-3', and the 5' end is modified with a fluorescent group, and the 3' end is modified with a quenching group.

7. The kit according to claim 6, It is characterized in that The fluorescent group of the ssDNA-reporter fluorescent probe includes HEX, and the quenching group includes BHQ1; the fluorescent group of the ssDNA-reporter test strip probe includes FITC, and the quenching group includes Biotin.

8. The kit according to any one of claims 4 to 7, It is characterized in that The kit includes reagents required for RPA amplification reaction and reagents required for CRISPR-Cas14a reaction.

9. A method for detecting drug resistance of Helicobacter pylori for non-diagnostic purposes, It is characterized in that The following steps are involved: Using the DNA of the sample to be tested as a template, performing RPA amplification using RPA primers to obtain an amplified product; the RPA primers are the primers in the reagent according to claim 1 or 2 or the primers in the kit according to claims 4 to 8; The amplified product and CrRNA are subjected to a CRISPR-Cas14a reaction to obtain a reaction product; the CrRNA is the CrRNA in the reagent according to claim 1 or 2 or the CrRNA in the kit according to claims 4 to 8; The reaction product is tested by fluorescence or test strips, and the drug resistance of Helicobacter pylori is determined based on the test results, including: When the detection method is fluorescence detection, RPA amplification and CRISPR-Cas14a reaction of DNA without the sample to be tested are set to obtain a blank reaction product. If the fluorescence value of the reaction product / the fluorescence value of the blank reaction product>1.4, the sample to be tested is resistant to amoxicillin or clarithromycin; if the fluorescence value of the reaction product / the fluorescence value of the blank reaction product is ≤1.4, the sample to be tested is not resistant to amoxicillin or clarithromycin; When the detection method is a test strip test, the conjugate pad of the test strip is inserted into the reaction product. If bands appear on both the test line and the quality control line, the sample to be tested is resistant to amoxicillin or clarithromycin; if only a band appears on the quality control line, the sample to be tested is not resistant to amoxicillin or clarithromycin; if both the quality control line and the test line are not colored, the test result is invalid.

10. The method according to claim 9, It is characterized in that The temperature of the RPA amplification is 35-42° C., and the amplification time is 12-15 min.

Images