A kit for detecting Fusarium oxysporum causing cowpea wilt and its application
The RPA-CRISPR/Cas12a method provides a rapid, sensitive, and cost-effective solution for detecting Fusarium oxysporum by targeting its coding region, addressing the limitations of existing detection methods with improved specificity and sensitivity for field applications.
Patent Information
- Application Number
- CN202510512330.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-23
- Publication Date
- 2025-07-15
- Estimated Expiration
- 2045-04-23
AI Technical Summary
The prior art is difficult to detect Fusarium oxysporidium cowpea blight quickly, sensitively and at low cost. The traditional methods are cumbersome and are not suitable for field detection in the field, and the molecular detection methods are not specific.
The detection method of RPA-bound CRISPR/Cas12a was used, and specific primer pairs and crRNA were used to bind Cas12a protein and signal reporter probes to perform specific nucleic acid signal amplification and visual detection.
It realizes fast, sensitive and highly specific detection of Fusarium oxysporus cowpea blight, suitable for field applications, no large-scale instruments are required, simple operation, and the detection time is completed within 30 minutes at the fastest.
Smart Images

Figure CN120026130B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of modern agriculture, and particularly relates to a kit for detecting Fusarium oxysporum f. sp. vignae and its application. Background Art
[0002] Fusarium oxysporum F.oxysporum ) is a soil-borne pathogenic fungus distributed worldwide, with a wide host range, and can cause Fusarium wilt in more than 100 plants such as cucurbits, Solanaceae, bananas, cotton, legumes and flowers. Fusarium oxysporum is an important pathogen causing Fusarium wilt in cowpeas. It has a large activity range and strong survival ability. Cowpeas can be invaded by Fusarium oxysporum from seedlings to adult plants. When the disease loss is serious, it can reach up to 70%, causing great economic losses to the cowpea industry. So far, the detection and diagnosis of this disease are mainly symptom diagnosis and pathogen isolation and identification. The traditional pathogen detection methods are cumbersome, time-consuming, and require detailed taxonomic information of the pathogen, which cannot meet the requirements of rapid, sensitive and stable detection in disease control. Therefore, establishing a rapid and effective detection method to timely detect carrier plants is crucial for controlling the occurrence and prevalence of diseases and reducing crop yield losses.
[0003] At present, traditional morphological identification methods require isolation and purification. Due to the slow growth of the pathogen and the often concomitant co-infection of other pathogens, it is difficult to isolate and purify, and the identification time is long, which is not suitable for rapid detection and low-cost identification. Molecular detection methods such as conventional PCR, loop-mediated isothermal amplification (LAMP), and recombinase polymerase amplification (RPA) have been used for the detection and identification of fungal pathogens. However, PCR-based molecular detection methods usually require a thermal cycler and are not suitable for rapid on-site detection in the field. LAMP usually requires reaction at about 60°C, the primer design is complex, and the false positive rate is high.
[0004] In the prior art, there have been literature reports (Matthews MC, van der Linden J, Robène I, Rozsasi S, Coetzee B, Campa M, Burger J, Akwuruoha UN, Madufor NJ, Perold W, Opara UL, Viljoen A, Mostert D. A combined recombinase polymerase amplification CRISPR / Cas12a assay for detection of Fusarium oxysporum f. sp. cubense tropical race 4. Sci Rep. 2025 Jan 19;15(1):2436. doi: 10.1038 / s41598-025-85633-8. PMID: 39828694; PMCID: PMC11743600.) that for the soil-borne pathogen Fusarium oxysporum f. sp. cubense tropical race 4 (FocTR4) of banana wilt disease, the non-coding region sequence can be detected by RPA / CRISPR-Cas12a. However, since the non-coding region sequence contains a large number of repetitive sequences (such as transposable elements, microsatellite sequences) and low-complexity regions (such as AT-rich regions), these regions are prone to dynamic mutations (such as repeat amplification) or structural variations, and their detection specificity is not high.
[0005] Therefore, it is necessary to develop a method with high detection sensitivity, low cost, and applicable to rapid on-site detection in the field for the coding region sequence of Fusarium oxysporum. Summary of the Invention
[0006] The purpose of the first aspect of the present invention is to provide a reagent for detecting Fusarium oxysporum of cowpea wilt disease.
[0007] The purpose of the second aspect of the present invention is to provide a kit for detecting Fusarium oxysporum of cowpea wilt disease.
[0008] The purpose of the third aspect of the present invention is to provide an application.
[0009] The purpose of the fourth aspect of the present invention is to provide a detection method for Fusarium oxysporum of cowpea wilt disease based on RPA combined with CRISPR / Cas12a.
[0010] In order to achieve the above purposes of the present invention, the technical solutions adopted are as follows:
[0011] In the first aspect of the present invention, a reagent for detecting Fusarium oxysporum is provided, and the reagent includes crRNA for detecting Fusarium oxysporum and / or primer pairs of the genome of Fusarium oxysporum.
[0012] In some embodiments of the present invention, the primer pair is RPA-F / RPA-R, and the nucleotide sequences are as follows:
[0013] RPA-F: 5′- ATTATCGGGGTTCGCAACTGACTATGAGAC-3′ (SEQ ID NO: 2);
[0014] RPA-R: 5′-TGGTTGATAGTCGCCTATAAACTTGCGATC-3′ (SEQ ID NO: 3).
[0015] In some embodiments of the present invention, the nucleotide sequence of the crRNA is 5′-UAAUUUCUACUAAGUGUAGAUGAAUCGCUCACAGAUGGACA-3′ (SEQ ID NO: 4).
[0016] In some embodiments of the present invention, the primer pair and crRNA are the results of design based on >lcl|CP052043.1_cds_QKD56343.1_9601. This specific genomic sequence has never been reported in the technical field of Fusarium oxysporum detection.
[0017] In the second aspect of the present invention, a kit for detecting Fusarium oxysporum is provided, which contains the reagent described in the first aspect of the present invention.
[0018] In some embodiments of the present invention, the kit further contains Cas12a protein and / or signal reporter probe.
[0019] In some embodiments of the present invention, the Cas12a protein is selected from at least one of AsCas12a, Lb4Cas12a, Lb5Cas12a, FnCas12a, LbCas12a, and preferably LbCas12a protein.
[0020] In some embodiments of the present invention, the signal reporter probe is ssDNA, and a fluorophore and a quencher are respectively modified at both ends.
[0021] In some embodiments of the present invention, the nucleic acid sequence of the signal reporter probe ssDNA is 5′- CCACCC-3′.
[0022] In some embodiments of the present invention, the fluorescent group is at least one of FAM, ROX, CY5, HEX, HTX, VIC, TAMRA, and preferably FAM.
[0023] In some embodiments of the present invention, the quenching group is at least one of BHQ1, BHQ2, BHQ3, and preferably BHQ1.
[0024] In some embodiments of the present invention, the kit further comprises a negative control and a positive control.
[0025] In some embodiments of the present invention, the kit further comprises an RPA reaction solution and a CRISPR-Cas12a buffer solution.
[0026] In some embodiments of the present invention, the CRISPR-Cas12a buffer solution is 10×NEBuffer 2.1.
[0027] The third aspect of the present invention provides the application of the reagent of the first aspect of the present invention and / or the kit of the second aspect of the present invention in any one of 1) to 2):
[0028] 1) Detection of Fusarium oxysporum f. sp. vignae;
[0029] 2) Preparation of a product for detecting Fusarium oxysporum f. sp. vignae.
[0030] The fourth aspect of the present invention provides a method for detecting Fusarium oxysporum f. sp. vignae based on RPA combined with CRISPR / Cas12a, comprising the steps of using the reagent of the first aspect of the present invention and / or the kit of the second aspect of the present invention.
[0031] In some embodiments of the present invention, the detection method specifically comprises the following steps:
[0032] 1) Extract DNA from the sample to be tested;
[0033] 2) Use the primer pair described in the first aspect of the present invention to perform RPA amplification on the DNA extracted in step 1) to obtain an RPA product;
[0034] 3) Mix and react the RPA product in step 2) with the crRNA described in the first aspect of the present invention, the ssDNA fluorescent probe described in the second aspect of the present invention, and the Cas12a protein, and read the detection signal;
[0035] 4) Judge whether Fusarium oxysporum f. sp. vignae exists in the sample to be tested according to the detection signal.
[0036] In some embodiments of the present invention, the amplification temperature of the RPA is 37 - 42°C.
[0037] In some embodiments of the present invention, the amplification time of the RPA is 5 to 30 min.
[0038] In some embodiments of the present invention, the concentration of the crRNA is 100 to 800 nM.
[0039] In some embodiments of the present invention, the concentration of the Cas12a protein is 100 to 800 nM.
[0040] In some embodiments of the present invention, the final concentration of the ssDNA fluorescent probe is 20 to 200 μM.
[0041] Specifically, the method comprises the following steps:
[0042] (1) Mix the RPA reaction system and the genomic DNA to be tested evenly and add them to the bottom of the reaction tube. Add the CRISPR / Cas12a system to the lid of the same reaction tube. The two do not affect each other. Then place the bottom of the reaction tube into a constant temperature amplification device for RPA amplification of the target fragment; the target fragment includes the nucleotide sequence shown in SEQ ID NO: 1.
[0043] (2) After the RPA reaction system finishes amplification, add the CRISPR / Cas12a system on the lid to the bottom and mix it evenly with the RPA amplification system.
[0044] (3) Perform fluorescence intensity visualization detection on the reaction system solution in step (2).
[0045] If the reaction tube emits fluorescence, it indicates that Fusarium oxysporum f. sp. vignae exists in the sample to be tested; if the reaction tube does not emit fluorescence, it indicates that Fusarium oxysporum f. sp. vignae does not exist in the sample to be tested.
[0046] In some embodiments of the present invention, the specific operation for performing fluorescence intensity visualization detection on the reaction system solution in step (2) is as follows:
[0047] Place the RPA solution system at the bottom of the reaction tube in a constant temperature device at 38 °C for reaction for 15 minutes, then centrifuge the CRISPR / Cas12a reaction solution on the lid to the bottom and continue the reaction for 30 minutes, and collect FAM fluorescence once every 30 seconds; or after reacting in a constant temperature device at 38 °C for 30 minutes, visually observe whether fluorescence appears in the reaction tube under blue light irradiation.
[0048] The beneficial effects of the present invention are:
[0049] 1. The present invention runs Orthofinder to perform clustering analysis on the protein sequences of Fusarium oxysporum, Fusarium equiseti, Fusarium graminearum, Fusarium proliferatum, Phytophthora vignae, Phytophthora nicotianae, etc., screens out the specific protein sequences of Fusarium oxysporum, corresponds the protein sequences to their genomic sequences one by one, and then puts the specific genomic sequence >lcl|CP052043.1_cds_QKD56343.1_9601 into NCBI and Fungi DB for blast comparison and verification to obtain the specific genomic sequence. There has never been any relevant report on this specific genomic sequence in the field of detection technology. The discovery of this sequence realizes the specific detection of Fusarium oxysporum causing cowpea wilt disease.
[0050] 2. The reagent of the present invention contains an RPA primer pair and crRNA. This primer pair can complete the nucleic acid signal amplification of Fusarium oxysporum under the RPA amplification technology, which is fast and has strong specificity; this crRNA can specifically form complementary double strands with the Fusarium oxysporum gene and has no cross-reaction with other fungi and Phytophthora, improving the specificity for Fusarium oxysporum.
[0051] 3. The present invention designs crRNA based on the specific sequence >lcl|CP052043.1_cds_QKD56343.1_9601 of Fusarium oxysporum. The crRNA can form complementary double strands with the target genomic DNA and there should be a PAM sequence nearby, ensuring that the crRNA can specifically target the target region, reducing the probability of off-target. And the best RPA primer pair is screened and designed according to the binding site of the crRNA to achieve the amplification of the specific target gene, activate Cas12a for cis cleavage and then trans cleavage, establish a method for visual detection of Fusarium oxysporum, and optimize the RPA / CRISPR-Cas12a system and evaluate its specificity and sensitivity. The results show that: this method has good specificity for detecting Fusarium oxysporum, has no cross-contamination with the control strain, the sensitivity is 10 pg / μL, and the detection result can be obtained in as fast as 30 minutes.
[0052] 4. When the present invention is implemented, there is no need to open the lid. After mixing the RPA amplification solution and the Cas12a system, it is directly placed in a constant temperature device for reaction, reducing the aerosol contamination and false positive results caused by opening the lid.
[0053] 5. The present invention combines the specific amplification of RPA with the identification of the specific sequence of crRNA, making the enhanced Cas12a detection more specific; and the detection is carried out at 38°C, solving the problem of rapid on-site detection without a PCR instrument. At the same time, the result can be observed with the naked eye by blue light excitation. This method does not need to rely on expensive and large-scale instrument equipment, the operation process is simple and fast, and the sensitivity and specificity are strong, which is very suitable for the rapid detection of field samples.
[0054] In summary, the method for detecting Fusarium oxysporum based on RPA-CRIPSR / RPA fluorescence detection has better sensitivity compared with isolation and culture. The detection time is greatly shortened, and the detection can be completed within 30 minutes at the fastest. The method provided by the present invention has the advantages of simplicity, less time consumption, high sensitivity and strong specificity. The whole process is carried out in an environment of 38°C, with low requirements for equipment, and is easy to be widely carried out in on-site detection at customs ports, having good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS
[0055] The present invention will be further described below in conjunction with the drawings and embodiments, wherein:
[0056] Figure 1 It is the optimization result of the reaction concentrations of crRNA and cas12a (800 nM: 800 nM, 700 nM: 700 nM, 600 nM: 600 nM, 500 nM: 500 nM).
[0057] Figure 2 It is the optimization result of the reaction concentrations of crRNA and cas12a (400 nM: 400 nM, 300 nM: 300 nM, 200 nM: 200 nM, 100 nM: 100 nM).
[0058] Figure 3 It is the optimization result of the RPA reaction time.
[0059] Figure 4 It is the optimization result of the RPA reaction temperature.
[0060] Figure 5 It is the result of three repeated specific detections of RPA / CRISPR-Cas12a; among them, A is the amplified fluorescence value of the RPA-Cas12a system; B is the visualization result of RPA-Cas12a under two kinds of light (blue light, ultraviolet light). In the figure, 1 to 13 represent in turn: 1 Fusarium oxysporum, 2 Fusarium equiseti, 3 Fusarium proliferatum, 4 Fusarium sp., 5 Fusarium graminearum, 6 Fusarium solani, 7 Fusarium culmorum, 8 Fusarium polyphialidicum, 9 Magnaporthe oryzae, 10 Phytophthora vignae, 11 Phytophthora nicotianae, 12 cowpea plants, 13 negative control.
[0061] Figure 6 It is the sensitivity detection of RPA combined with CRISPR / Cas12a; among them, A is the amplified fluorescence curve of RPA / Cas12a; B is the visualization result of RPA / Cas12a under two kinds of light; the concentration gradients of each reaction are: 100 ng / μL, 10 ng / μL, 1 ng / μL, 100 pg / μL, 10 pg / μL, 1 pg / μL, NC: Negative control.
[0062] Figure 7Schematic diagram of the treatment of cowpea seedlings with Fusarium oxysporum spore suspension by the root-dipping method at different time points of Fusarium oxysporum infection of cowpea seedlings.
[0063] Figure 8 Results graph of detecting different parts of cowpea seedlings infected with Fusarium oxysporum on the 6th day. Among them, A is the graph of the detection sample. The parts for extracting cowpea samples are divided into leaves, stems, and roots; B is the fluorescence curve result of RPA combined with CRISPR / Cas12a amplification; C is the visual detection result of RPA combined with CRISPR / Cas12a under two irradiation lights. "Leaf" is the detection result of the leaf part of the diseased cowpea seedlings, "Stem" is the detection result of the middle part of the stem of the diseased cowpea seedlings, "Root" is the detection result of the root part of the diseased cowpea seedlings, "Fo" represents the positive control with the genomic DNA of Fusarium oxysporum f. sp. vignae as the template, and "NC" is the negative control. Detailed implementation mode
[0064] The following will clearly and completely describe the concept and technical effects generated by the present invention in combination with the embodiments to fully understand the purpose, features, and effects of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative efforts all belong to the scope protected by the present invention.
[0065] Example 1 Design of RPA specific amplification primer pairs and crRNA guide sequences
[0066] In the present invention, Orthofinder is used to perform cluster analysis on the protein sequences of Fusarium oxysporum, Fusarium equiseti, Fusarium graminearum, Fusarium proliferatum, Phytophthora vignae, Phytophthora nicotianae, etc., and the specific protein sequences of Fusarium oxysporum are screened out. The protein sequences are corresponded to their genomic sequences one by one, and then the specific genomic sequence >lcl|CP052043.1_cds_QKD56343.1_9601 is put into NCBI and Fungi DB for blast comparison and verification to obtain the specific genomic sequence, and there has never been a relevant report on this specific genomic sequence in the field of detection technology.
[0067] The nucleotide sequence of this specific genomic sequence is:
[0068] ATGCAGATATCTGAAGTTACCAGGATTGCGTCTTTGCTTTCTCTAACGGCTGCAAGAATTGTCACAACTATCGCGGAAAAATGGGATTACACGTGGGAGGAAGAAATGCCCGTCGAAGACTTGGCATGCTGGAGTGAAGATAAAGACAACGTTATCAAGTATATGGGCTGGGAGTCTCTGAAGAACCTACCCGTTGCGATCGCGGGCTATGAAGGCGGCCGCCGCCAGGCAATGCTCGTCCTGGACTACGCATTATCGGGGTTCGCAACTGACTATGAGACTTTTGAATCGCTCACAGATGGACAGGCTTGGAGGACTGGGAAGGCAAATGTTACTGCCTTTCACTCTTCTGATCTTCGTGATTCTGGCATTGGGTCTGAGCCGGCGGGGGTAGATCGCAAGTTTATAGGCGACTATCAACCATTTGAGGAACCCAGCTCTTAA (SEQ ID NO: 1).
[0069] Design specific guide crRNA and RPA primer pairs for this specific sequence.
[0070] The nucleotide sequences of the RPA primer pairs are as follows:
[0071] RPA-F: 5′- ATTATCGGGGTTCGCAACTGACTATGAGAC-3′ (SEQ ID NO: 2);
[0072] RPA-R: 5′-TGGTTGATAGTCGCCTATAAACTTGCGATC-3′ (SEQ ID NO: 3).
[0073] The nucleotide sequences of the RPA primer pairs are as follows:
[0074] 5′-UAAUUUCUACUAAGUGUAGAUGAAUCGCUCACAGAUGGACA-3′ (SEQ ID NO: 4).
[0075] Example 2 Establish a Visual Detection Method for Fusarium oxysporum f. sp. vignae Based on the RPA / CRISPR-Cas12a System
[0076] (1) The RAP reaction system (50 μL) was uniformly mixed in a dry powder tube: 2 μL RPA-F (10 μM), 2 μL RPA-R (10 μM), 29.4 μL Buffer A (Anpu Future Biotechnology Co., Ltd., product number #WLBB201KIT), 2.5 μL Buffer B (Anpu Future Biotechnology Co., Ltd., product number #WLBB201KIT), 5 μL genomic DNA of the sample to be tested, and the rest was made up to 50 μL with water; RPA amplification program: the amplification temperature was 38 °C and the amplification time was 15 minutes.
[0077] (2) Prepare the CRISPR-Cas12a reaction solution (10 μL): Mix 3 μL Cas12a (700 nM), 2 μL crRNA (700 nM), 3 μL ssDNA fluorescent probe (100 μM), 1.5 μL 10 × NEBuffer r2.1, and 0.5 μL nuclease-free water uniformly.
[0078] (3) The ssDNA fluorescent probe was 5'-FAM-CCACCCA-BHQ1-3'.
[0079] (4) Take 10 μL of the RPA reaction solution from step (1) and add it to the bottom of a nuclease-free tube. Specifically, place 10 μL of the CRISPR / Cas12a reaction solution from step (2) on the lid of the nuclease-free tube. Then, place the reaction tube in a constant temperature amplification at 38 °C for 15 minutes. After the RPA amplification is completed, centrifuge the CRISPR / Cas12a reaction solution in the tube lid to the bottom of the tube and mix it with the RPA system for enzymatic digestion reaction. The specific CRISPR program is as follows: Place the reaction tube in a fluorescence quantitative PCR instrument and react at a constant temperature of 38 °C for 30 minutes. During this period, collect FAM fluorescence every 30 seconds, or react at a constant temperature of 38 °C for 30 minutes, and observe the fluorescence result of the reaction solution in the tube under blue light excitation with the naked eye.
[0080] When the reaction system emits fluorescence, it indicates that the sample to be tested contains Fusarium oxysporum. When the reaction system does not emit fluorescence, it indicates that the sample to be tested does not contain Fusarium oxysporum.
[0081] Based on the above RPA and CRISPR / Cas12a amplification systems, the relevant reaction conditions were optimized as follows:
[0082] The diseased samples of cowpea plants collected from the field were isolated and purified. After molecular identification, the results showed that they were strains of Fusarium oxysporum. The genomic DNA was extracted using the CTAB method, and this DNA was used as a template for optimization.
[0083] The specific optimization plan for the reaction concentration of crRNA and cas12a is as follows: control the amplification time at 30 min and the ssDNA probe concentration (100 μM). Under the condition that the above parameters remain the same, dilute the crRNA concentration, and the diluted concentrations are 800 nM, 700 nM, 600 nM, 500 nM, 400 nM, 300 nM, 200 nM, and 100 nM. The diluted concentration of cas protein is the same as that of crRNA, and the reaction ratio of crRNA and cas12a is 1:1. The specific reaction conditions are 800 nM:800 nM, 700 nM:700 nM, 600 nM:600 nM, 500 nM:500 nM, 400 nM:400 nM, 300 nM:300 nM, 200 nM:200 nM, 100 nM:100 nM, and a negative control is set. The detection results are as Figure 1 , 2 shown. The reaction concentration of crRNA:cas12a reaches the plateau fastest at 700 nM:700 nM, that is, the most suitable reaction concentration of crRNA and cas12a is 700 nM:700 nM.
[0084] The specific optimization plan for the RPA reaction time is as follows: control the amplification time at 30 min and the ssDNA probe concentration (100 μM). The reaction concentration of crRNA and cas12a is 700 nM:700 nM. Under the condition that the above parameters remain the same, set the reaction time to 5, 10, 15, 20, 25, 30 min, and a negative control is set. The detection results are as Figure 3 shown. The most suitable RPA reaction time is 15 min.
[0085] The specific optimization plan for the RPA reaction temperature is as follows: control the amplification time at 15 min and the ssDNA probe concentration (100 μM). The reaction concentration of crRNA and cas12a is 700 nM:700 nM. Under the condition that the above parameters remain the same, set the reaction temperature to 37, 38, 39, 40, 41, 42 °C, and a negative control is set. The detection results are as Figure 4 shown. The most suitable RPA reaction temperature is 38 °C.
[0086] Example 3 Specific Detection
[0087] Control the amplification time at 15 min, the ssDNA probe concentration (100 μM), the reaction concentration of crRNA and cas12a at 700 nM:700 nM, and the reaction temperature at 38 °C. Evaluate the specific effect of detecting Fusarium oxysporum with this system.
[0088] The genomic DNA templates of Fusarium oxysporum, Fusarium equiseti, Fusarium proliferatum, Fusarium sp., Fusarium graminearum, Fusarium solani, Fusarium culmorum, Fusarium verticillioides, Magnaporthe oryzae, Phytophthora vignae, Phytophthora nicotianae, and Vigna unguiculata were extracted using the CTAB method, and sterile ddH2O was used as a negative control.
[0089] The results showed that the system with the addition of genomic DNA of Fusarium oxysporum was significantly amplified, and the fluorescence value was significantly higher than that of the system with the addition of non-Fusarium oxysporum DNA and the negative control. By observing the fluorescence in the reaction tubes with the naked eye, it was found that specific amplification occurred only in the detection system with the addition of Fusarium oxysporum DNA, emitting obvious fluorescence under the irradiation of blue light and ultraviolet light, while no fluorescence was emitted in the reaction tubes with the addition of genomic DNA of the other 11 non-Fusarium oxysporum species and the negative control ( Figure 5 ).
[0090] The above experimental results proved that the optimized RPA / CRISPR-Cas12a system had good specificity for the detection of Fusarium oxysporum causing cowpea wilt.
[0091] Example 4 Sensitivity Detection
[0092] The sensitivity of the optimized RPA / CRISPR-Cas12a system in Example (2) was evaluated for the detection of Fusarium oxysporum. The genomic DNA of Fusarium oxysporum was extracted using the CTAB method, and its concentration was measured using the existing Nanodrop microspectrophotometer in the laboratory. The refined genomic DNA was serially diluted with sterile water, and the diluted concentrations were 100 ng / μL, 10 ng / μL, 1 ng / μL, 100 pg / μL, 10 pg / μL, and 1 pg / μL, respectively. Sterile water was set as the negative control, and 5 μL of the diluted genomic DNA was added to each 50 μL reaction solution for reaction.
[0093] The results showed that obvious fluorescence could be observed in the reaction tubes with DNA concentrations ranging from 100 ng / μL to 10 pg / μL under blue light and ultraviolet light, and no fluorescence signal could be observed in the reaction tubes with DNA concentrations lower than 10 pg / μL. There was no significant difference in the fluorescence curve amplification compared with the negative control. The above results indicated that the sensitivity detection limit of the RPA / CRISPR-Cas12a system was 10 pg / μL ( Figure 6 )
[0094] Example 5 Detection of Actual Cowpea Wilt Disease Samples
[0095] The spore suspension of Fusarium oxysporum was collected after shaking culture and used to treat cowpea seedlings by the root-dipping method. Specifically, the concentration of the spore suspension of Fusarium oxysporum was 5×10 6CFU / mL, the root soaking time was 30 min. The roots of the treated cowpea seedlings turned color and withered on the 6th day, and the leaves were significantly yellowed ( Figure 7 ), and genomic DNA of the roots, stems, and leaves of the diseased cowpea plants on the 6th day was extracted. The optimized RPA combined with CRISPR / Cas12a technology in Example 2 was used to detect the genomic DNA of different parts of the mentioned diseased cowpea plants to determine whether they were infected by Fusarium oxysporum.
[0096] The results showed that the diseased samples of cowpea plants collected in the field were isolated and purified, and the results after molecular identification showed that they were strains of Fusarium oxysporum. Using the DNA extracted by the CTAB method as a template for the positive control, strong green fluorescence was emitted in the reaction tube; similar fluorescence to the positive control was emitted in the reaction tubes of the roots and the middle parts of the stems of the diseased samples of cowpea seedlings treated with Fusarium oxysporum, indicating that Fusarium oxysporum could infect the roots of cowpea plants and spread to the stems through the root vascular bundles, but Fusarium oxysporum was not detected in the leaves. The above experimental results showed that the optimized RPA / CRISPR-Cas12a technology in Example 2 could achieve rapid detection of cowpea wilt caused by Fusarium oxysporum on cowpea plants. ( Figure 8 ).
[0097] The above specific embodiments have described the implementation of the present invention in detail. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the claims and technical conceptions of the present invention, various simple improvements and modifications can be made to the technical solutions of the present invention, and these simple modifications all fall within the protection scope of the present invention.
Claims
1. A reagent for detecting Fusarium oxysporum f. sp. vignae based on the RPA / CRISPR-Cas12a system, characterized in that: The reagent includes a primer pair for detecting Fusarium oxysporum and crRNA; The primer pair is RPA-F / RPA-R, and the nucleotide sequences are as follows: RPA-F: 5′- ATTATCGGGGTTCGCAACTGACTATGAGAC-3′; RPA-R: 5′-TGGTTGATAGTCGCCTATAAACTTGCGATC-3′; The nucleotide sequence of the crRNA is: 5′-UAAUUUCUACUAAGUGUAGAUGAAUCGCUCACAGAUGGACA-3′.
2. A kit for detecting Fusarium oxysporum f. sp. vignae based on the RPA / CRISPR-Cas12a system, comprising the reagent described in claim 1 and a CRISPR-Cas12a detection reagent.
3. The kit according to claim 2, characterized in that: The CRISPR-Cas12a detection reagent includes a Cas12a protein and a signal reporting probe.
4. The kit according to claim 3, characterized in that: The Cas12a protein is selected from at least one of AsCas12a, Lb4Cas12a, Lb5Cas12a, FnCas12a, and LbCas12a.
5. The kit according to claim 3, characterized in that: The signal reporting probe contains ssDNA; Both ends of the ssDNA are modified with a fluorescent group and a quenching group respectively.
6. The kit according to claim 2, characterized in that: The kit further includes an RPA reaction solution and a CRISPR-Cas12a buffer solution.
7. The application of the reagent described in claim 1 and / or the kit described in any one of claims 2 to 6 in any one of 1) to 2): 1) Detection of Fusarium oxysporum f. sp. vignae; 2) Preparation of a product for detecting Fusarium oxysporum f. sp. vignae.
8. A method for detecting Fusarium oxysporum f. sp. vignae based on RPA combined with CRISPR / Cas12a, including the steps of using the kit described in any one of claims 2 to 6.
9. The detection method according to claim 8, wherein, The method includes the following steps: 1) Extract DNA from the sample to be tested; 2) Use the primer pair described in claim 1 to perform RPA amplification on the DNA extracted in step 1) to obtain an RPA product; 3) Mix and react the RPA product in step 2) with the crRNA, signal reporting probe, and Cas12a protein described in claim 1, and read the detection signal; 4) Judge whether Fusarium oxysporum exists in the sample to be tested according to the detection signal.
10. The method according to claim 9, characterized in that: The RPA amplification conditions are 37 - 42 °C for 5 - 30 minutes; The concentration of crRNA in the CRISPR reaction system in step 3) is 100 - 800 nM; The concentration of the Cas12a protein is 100 - 800 nM; The final concentration of the signal reporting probe is 20 to 200 μM.