Non-human animal with humanized modification of IL5 and / or IL5RA gene

Abstract

The present invention provides a non-human animal expressing human or chimeric (e.g., humanized) IL5 and / or IL5RA proteins and methods of use thereof.

Description

A non-human animal with humanized IL5 and / or IL5RA genes

[0001] Priority claim

[0002] [Corrected on 31.10.2023 according to Rule 91] This patent application claims priority to Chinese patent application No. 202211192120.7 filed on September 28, 2022 and priority to Chinese patent application No. 202310649861.1 filed on June 2, 2023, the entire contents of which are incorporated herein by reference. Technical Field

[0003] The present invention provides a non-human animal expressing human or chimeric (eg, humanized) IL5 and / or IL5RA protein and methods of use thereof.

[0004] background

[0005] Traditional drug development typically uses in vitro screening methods. However, these screening methods cannot provide the body's environment (such as the tumor microenvironment, stromal cells, extracellular matrix components, and immune cell interactions), resulting in a high rate of drug development failure. In addition, given the differences between humans and animals, the results of in vivo pharmacology trials using conventional experimental animals may not reflect the actual disease state and the interaction of target sites, resulting in significant differences between the results of many clinical trials and those of animal experiments.

[0006] Therefore, developing humanized animal models suitable for screening and evaluation of human antibodies will significantly improve the efficiency of new drug development and reduce drug development costs.

[0007] Overview

[0008] The present application provides an animal model with human or chimeric IL5 and / or IL5RA protein. The animal model can express human or chimeric IL5 (e.g., humanized IL5) protein and / or human or chimeric IL5RA (e.g., humanized IL5RA) protein. It can be used for the study of IL5 and IL5RA gene functions, and can also be used for the screening and evaluation of IL5 / IL5RA signaling pathway regulators (e.g., anti-human IL5 and / or IL5RA antibodies, polypeptides, and oligonucleotide drugs). In addition, the animal model prepared by the method described herein can be used for drug screening, pharmacodynamic studies, treatment of immune-related diseases, and cancer treatment of human IL5 / IL5RA target sites; the model can also be used to promote new drug development and design, saving time and cost. In summary, the present invention provides a powerful tool for studying the function of IL5 / IL5RA protein and provides a platform for screening anti-cancer drugs.

[0009] In one aspect, the present invention provides a genetically modified non-human animal, the genome of which comprises at least one chromosome comprising a nucleotide sequence encoding a human or chimeric interleukin 5 (IL5) protein. In some embodiments, the nucleotide sequence encoding the human or chimeric IL5 protein is operably linked to endogenous regulatory elements (e.g., 5'UTR and / or 3'UTR) of an endogenous IL5 locus on at least one chromosome. In some embodiments, the human or chimeric IL5 protein is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 2. In some embodiments, the nucleotide sequence encoding the human or chimeric IL5 protein is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the nucleotide sequence of SEQ ID NO: 5 or 8. In some embodiments, the animal is a mammal, such as a monkey, rodent, mouse, or rat. In some embodiments, the animal is a mouse. In some embodiments, the animal does not express endogenous IL5 protein or expresses it at a reduced level compared to IL5 in wild-type animals. In some embodiments, one or more cells of the animal express a human or chimeric IL5 protein. In some embodiments, the human or chimeric IL5 protein can bind to an endogenous IL5RA receptor, inducing activation of a downstream signaling pathway. In some embodiments, the human or chimeric IL5 protein can bind to a human IL5RA receptor, inducing activation of a downstream signaling pathway.

[0010] In one aspect, the present invention provides a genetically modified non-human animal, the genome of which comprises a nucleotide sequence encoding an endogenous IL5 region at an endogenous IL5 locus replaced with a nucleotide sequence encoding a corresponding region of human IL5. In some embodiments, the nucleotide sequence encoding the corresponding region of human IL5 is operably linked to an endogenous regulatory element (e.g., 5'UTR and / or 3'UTR) of the endogenous IL5 locus, and one or more cells of the animal express a human or chimeric IL5 protein. In some embodiments, the endogenous IL5 protein of the animal is not expressed or is expressed at a reduced level compared to IL5 in wild-type animals. In some embodiments, the nucleotide sequence encoding the corresponding region of human IL5 comprises a portion of exon 1, all of exons 2-3, and / or a portion of exon 4 of the human IL5 genome. In some embodiments, the nucleotide sequence encoding the corresponding region of human IL5 comprises the entire nucleotide sequence of the coding region. In some embodiments, the nucleotide sequence encoding the corresponding region of human IL5 is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the nucleotide sequence set forth in SEQ ID NO: 5. In some embodiments, the nucleotide sequence encoding the endogenous IL5 region comprises a portion of exon 1, all of exons 2-3, and / or a portion of exon 4 of the mouse IL5 gene. In some embodiments, the modified IL5 gene in the animal genome is homozygous or heterozygous for the endogenous replaced locus.

[0011] In one aspect, the present invention provides a non-human animal comprising at least one cell comprising a nucleotide sequence encoding a human or chimeric IL5 protein, wherein the human or chimeric IL5 protein comprises at least 50, 60, 70, 80, 90, 100, 110, 120, 130, 131, 132, 133, or 134 consecutive amino acids identical to the corresponding region of a human. In some embodiments, the human or chimeric IL5 protein is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 2. In some embodiments, the nucleotide sequence encoding the human or chimeric IL5 protein is operably linked to an endogenous regulatory element (e.g., 5'UTR and / or 3'UTR) of an endogenous IL5 locus on at least one chromosome. In some embodiments, the nucleotide sequence encoding the human or chimeric IL5 protein is integrated into the endogenous IL5 locus of the animal. In some embodiments, the humanized IL5 protein has at least one activity of mouse IL5 and / or human IL5.

[0012] In one aspect, the present invention provides a method for constructing a genetically modified non-human animal, wherein in at least one cell of the animal, a nucleotide sequence encoding an endogenous IL5 region at the animal's endogenous IL5 locus is replaced with a nucleotide sequence encoding a corresponding region of human IL5. In some embodiments, the animal's endogenous IL5 protein is not expressed or is expressed at a reduced level compared to IL5 in wild-type animals. In some embodiments, the nucleotide sequence encoding the corresponding region of human IL5 comprises the entire sequence encoding the human IL5 protein. In some embodiments, the nucleotide sequence encoding the corresponding region of human IL5 comprises a portion of exon 1, all of exons 2-3, and / or a portion of exon 4 of the human IL5 gene. In some embodiments, the nucleotide sequence encoding the corresponding region of human IL5 encodes an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequence set forth in SEQ ID NO: 2. In some embodiments, the nucleotide sequence encoding the corresponding region of human IL5 is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the nucleotide sequence set forth in SEQ ID NO: 5. In some embodiments, the nucleotide sequence encoding the endogenous IL5 region comprises a portion of exon 1, all of exons 2-3, and / or a portion of exon 4 of the mouse IL5 gene. In some embodiments, the nucleotide sequence encoding the corresponding region of human IL5 is operably linked to an endogenous regulatory element or a human IL5 regulatory element, such as a promoter. In some embodiments, the animal is a mammal, such as a monkey, rodent, mouse, or rat. In some embodiments, the animal is a mouse.

[0013] In one aspect, the present invention provides a method for constructing genetically modified non-human animal cells that express human or chimeric IL5 protein. The method comprises replacing a nucleotide sequence encoding an endogenous IL5 region at the endogenous mouse IL5 locus with a nucleotide sequence encoding a corresponding region of human IL5, thereby generating genetically modified non-human animal cells, wherein the animal cells express human or chimeric IL5 protein. In some embodiments, the human or chimeric IL5 protein comprises the entirety of a human IL5 protein. In some embodiments, the nucleotide sequence encoding the corresponding region of human IL5 encodes an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequence set forth in SEQ ID NO: 2. In some embodiments, the nucleotide sequence encoding the corresponding region of human IL5 comprises a portion of exon 1, all of exons 2-3, and / or a portion of exon 4 of the human IL5 gene. In some embodiments, the nucleotide sequence encoding the corresponding region of human IL5 is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the nucleotide sequence set forth in SEQ ID NO: 5. In some embodiments, the nucleotide sequence encoding the corresponding region of endogenous IL5 comprises a portion of exon 1, all of exons 2-3, and / or a portion of exon 4 of the mouse IL5 gene. In some embodiments, the nucleotide sequence encoding the human or chimeric IL5 protein is operably linked to an endogenous regulatory element, such as a promoter. In some embodiments, the animal is a mammal, such as a monkey, a rodent, a mouse, or a rat. In some embodiments, the animal is a mouse. In some embodiments, the non-human animal includes nucleotide sequences of human or chimeric proteins encoded by other genes, and the human or chimeric protein is selected from at least one of PD-1, PD-L1, GLP1R, OX40, NKP46, IL36R, HER2, TROP2, CD28, CTLA4, IL4, IL4R, or IL5RA. In some embodiments, the human or chimeric protein is IL5RA, IL4, and IL4R protein. In some embodiments, the non-human animal comprises a nucleotide sequence of a human or chimeric protein encoded by another gene, wherein the human or chimeric protein is selected from at least one of PD-1, PD-L1, GLP1R, OX40, NKP46, IL36R, HER2, TROP2, CD28, CTLA4, IL4, IL4R, or IL5RA. In some embodiments, the human or chimeric protein is IL5RA, IL4, and IL4R protein.

[0014] In one aspect, the present invention provides a genetically modified non-human animal, the genome of which comprises at least one chromosome comprising a nucleotide sequence encoding a human or chimeric interleukin-5 receptor subunit alpha (IL5RA) protein. In some embodiments, the nucleotide sequence encoding the human or chimeric IL5RA protein is operably linked to an endogenous regulatory element (e.g., 5'UTR and / or 3'UTR) of an endogenous IL5RA locus on at least one chromosome. In some embodiments, the human or chimeric IL5RA protein comprises all or part of the signal peptide, extracellular region, transmembrane, and / or cytoplasmic region of the human IL5RA protein. In some embodiments, the human or chimeric IL5RA protein is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 21. In some embodiments, the human or chimeric IL5RA protein comprises all or part of the extracellular region of the human IL5RA protein. In some embodiments, the amino acid sequence of the extracellular region of the human or chimeric IL5RA protein is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 21, positions 21-340 or positions 24-323. In some embodiments, the human or chimeric IL5RA protein comprises all or part of the signal peptide of the human IL5RA protein. In some embodiments, the amino acid sequence of the signal peptide of the human or chimeric IL5RA protein is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 21, positions 1-20. In some embodiments, the amino acid sequence of the human or chimeric IL5RA protein is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 21, positions 1-340. In some embodiments, the amino acid sequence of the human or chimeric IL5RA protein is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 28 or 48. In some embodiments, the animal is a mammal, such as a monkey, rodent, mouse, or rat. In some embodiments, the animal is a mouse. In some embodiments, the animal does not express endogenous IL5RA protein or expresses it at a reduced level compared to IL5RA in wild-type animals. In some embodiments, one or more cells of the animal express the human or chimeric IL5RA protein. In some embodiments, the human or chimeric IL5RA protein can bind to an endogenous IL5 ligand, inducing activation of a downstream signaling pathway. In some embodiments, the human or chimeric IL5RA protein can bind to a human IL5 ligand, inducing activation of a downstream signaling pathway.

[0015] In one aspect, the present invention provides a genetically modified non-human animal, the genome of which comprises a nucleotide sequence encoding an endogenous IL5RA region at an endogenous IL5RA locus replaced with a nucleotide sequence encoding a corresponding region of human or chimeric IL5RA. In some embodiments, the nucleotide sequence encoding the corresponding region of human or chimeric IL5RA is operably linked to an endogenous regulatory element (e.g., 5'UTR and / or 3'UTR) of the endogenous IL5RA locus, and one or more cells of the animal express human or chimeric IL5RA protein. In some embodiments, the endogenous IL5RA protein of the animal is not expressed or is expressed at a reduced level compared to IL5RA in wild-type animals. In some embodiments, the nucleotide sequence encoding the corresponding region of human or chimeric IL5RA comprises a portion of exon 3, all of exons 4-8, and / or a portion of exon 9 of the human IL5RA genome. In some embodiments, the nucleotide sequence encoding the corresponding region of human or chimeric IL5RA comprises, from 5' to 3', the following: 1) a first sequence encoding all or part of the human IL5RA signal peptide and extracellular region; 2) a second sequence encoding all or part of the extracellular, transmembrane, and cytoplasmic regions of the murine IL5RA protein. In some embodiments, the amino acid sequence encoded by the first sequence is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequence set forth in SEQ ID NO: 21, positions 1-340; and the amino acid sequence encoded by the second sequence is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequence set forth in SEQ ID NO: 20, positions 337-415. In some embodiments, the nucleotide sequence encoding the corresponding region of human or chimeric IL5RA comprises one or more auxiliary sequences. In some embodiments, the one or more auxiliary sequences comprise at least one of P2A, an endogenous 3'UTR, and / or STOP. In some embodiments, the animal's genomic sequence is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the nucleotide sequences set forth in SEQ ID NOs: 24, 27, 44, and 47. In some embodiments, the nucleotide sequence encoding the endogenous IL5RA region comprises a portion of exon 4, all of exons 5-9, and / or a portion of exon 10 of the mouse IL5RA gene. In some embodiments, the nucleotide sequence encoding the endogenous IL5RA region comprises a portion of exon 5 and / or a portion of exon 6 of the mouse IL5RA gene. In some embodiments, the modified IL5RA gene in the animal's genome is homozygous or heterozygous for the endogenous replaced locus.

[0016] In one aspect, the present invention provides a non-human animal comprising at least one cell encoding a nucleotide sequence of a human or chimeric IL5RA protein, wherein the human or chimeric IL5RA protein comprises at least 50, 60, 70, 80, 90, 100, 200, 300, 310, 320, 330, 340, 400, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, or 420 consecutive amino acids identical to a corresponding region of a human. In some embodiments, the human or chimeric IL5RA protein comprises all or part of a signal peptide, extracellular region, transmembrane, and / or cytoplasmic region of a human IL5RA protein. In some embodiments, the human or chimeric IL5RA protein comprises all or part of an extracellular region of a human IL5RA protein. In some embodiments, the amino acid sequence of the extracellular region of the human or chimeric IL5RA protein is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 21, positions 21-340 or positions 24-323. In some embodiments, the human or chimeric IL5RA protein comprises all or part of the signal peptide of the human IL5RA protein. In some embodiments, the amino acid sequence of the signal peptide of the human or chimeric IL5RA protein is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 21, positions 1-20. In some embodiments, the amino acid sequence of the human or chimeric IL5RA protein is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 21, positions 1-340. In some embodiments, the nucleotide sequence encoding the human or chimeric IL5RA protein is operably linked to an endogenous regulatory element (e.g., 5'UTR and / or 3'UTR) of an endogenous IL5RA locus on at least one chromosome. In some embodiments, the nucleotide sequence encoding the human or chimeric IL5RA protein is integrated into the endogenous IL5RA locus of the animal. In some embodiments, the humanized IL5RA protein has at least one activity of mouse IL5RA and / or human IL5RA.

[0017] In one aspect, the present invention provides a method for constructing a genetically modified non-human animal, wherein in at least one cell of the animal, at the animal's endogenous IL5RA locus, a nucleotide sequence encoding an endogenous IL5RA region is replaced with a nucleotide sequence encoding a corresponding region of human or chimeric IL5RA. In some embodiments, the animal's endogenous IL5RA protein is not expressed or is expressed at a reduced level compared to IL5RA in wild-type animals. In some embodiments, the nucleotide sequence encoding the corresponding region of human or chimeric IL5RA comprises all or part of a sequence encoding the extracellular region of human IL5RA. In some embodiments, the nucleotide sequence encoding the corresponding region of human or chimeric IL5RA comprises, from 5' to 3', the following: 1) a first sequence encoding all or part of the human IL5RA signal peptide and extracellular region; 2) a second sequence encoding all or part of the extracellular, transmembrane, and cytoplasmic regions of the murine IL5RA protein. In some embodiments, the amino acids encoded by the first sequence are at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequence set forth in positions 24-323 and / or positions 1-340 of SEQ ID NO: 21. In some embodiments, the amino acids encoded by the second sequence are at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequence set forth in positions 337-415 of SEQ ID NO: 20. In some embodiments, the nucleotide sequence encoding the corresponding region of human or chimeric IL5RA comprises a portion of exon 3, all of exons 4-8, and / or a portion of exon 9 of the human IL5RA gene. In some embodiments, the nucleotide sequence encoding the corresponding region of endogenous IL5RA comprises a portion of exon 4, all of exons 5-9, and / or a portion of exon 10 of the murine IL5RA gene. In some embodiments, the nucleotide sequence encoding the corresponding region of endogenous IL5RA comprises a portion of exon 5 and / or a portion of exon 6 of the mouse IL5RA gene. In some embodiments, the nucleotide sequence encoding the corresponding region of human or chimeric IL5RA is operably linked to an endogenous regulatory element, such as a promoter. In some embodiments, the animal is a mammal, such as a monkey, rodent, mouse, or rat. In some embodiments, the animal is a mouse.

[0018] In one aspect, the present invention provides a method for constructing a genetically modified non-human animal cell expressing a human or chimeric IL5RA protein. The method comprises replacing a nucleotide sequence encoding an endogenous IL5RA region at the endogenous mouse IL5RA locus with a nucleotide sequence encoding a corresponding region of human or chimeric IL5RA, thereby generating a genetically modified non-human animal cell, wherein the animal cell expresses the human or chimeric IL5RA protein. In some embodiments, the nucleotide sequence encoding the corresponding region of human or chimeric IL5RA comprises all or part of a sequence encoding a human extracellular region. In some embodiments, the nucleotide sequence encoding the corresponding region of human or chimeric IL5RA comprises: 1) all or part of a sequence encoding a signal peptide and extracellular region of a human IL5RA protein; and 2) all or part of a sequence encoding an extracellular region, a transmembrane region, and a cytoplasmic region of a mouse IL5RA protein. In some embodiments, the amino acid sequence of the corresponding region of human or chimeric IL5RA is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequence set forth in positions 24-323 and / or positions 1-340 of SEQ ID NO: 21. In some embodiments, the amino acid sequence of the human or chimeric IL5RA corresponding region is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequence set forth in positions 337-415 of SEQ ID NO: 20. In some embodiments, the nucleotide sequence encoding the human or chimeric IL5RA corresponding region comprises a portion of exon 3, all of exons 4-8, and / or a portion of exon 9 of the human IL5RA gene. In some embodiments, the nucleotide sequence encoding the endogenous IL5RA corresponding region comprises a portion of exon 4, all of exons 5-9, and / or a portion of exon 10 of the murine IL5RA gene. In some embodiments, the nucleotide sequence encoding the endogenous IL5RA corresponding region comprises a portion of exon 5 and / or a portion of exon 6 of the murine IL5RA gene. In some embodiments, the nucleotide sequence encoding the human or chimeric IL5RA corresponding region is operably linked to an endogenous regulatory element, such as a promoter. In some embodiments, the animal is a mammal, such as a monkey, rodent, mouse, or rat. In some embodiments, the animal is a mouse. In some embodiments, the non-human animal comprises a nucleotide sequence of a human or chimeric protein encoded by another gene, wherein the human or chimeric protein is selected from at least one of PD-1, PD-L1, GLP1R, OX40, NKP46, IL36R, HER2, TROP2, CD28, CTLA4, IL4, IL4R, or IL5. In some embodiments, the human or chimeric protein is IL5, IL4, and IL4R protein.In some embodiments, the non-human animal comprises a nucleotide sequence of a human or chimeric protein encoded by another gene, wherein the human or chimeric protein is selected from at least one of PD-1, PD-L1, GLP1R, OX40, NKP46, IL36R, HER2, TROP2, CD28, CTLA4, IL4, IL4R, or IL5. In some embodiments, the human or chimeric protein is IL5, IL4, and IL4R protein.

[0019] In one aspect, the present invention provides a method for determining the effectiveness of an anti-IL5 and / or IL5RA therapeutic agent in treating cancer, the method comprising: 1) administering an anti-IL5 and / or IL5RA therapeutic agent to an animal as described above, wherein the animal has a tumor; and 2) determining the inhibitory effect of the anti-IL5 and / or IL5RA therapeutic agent on the tumor. In some embodiments, the tumor comprises one or more tumor cells, wherein the tumor cells are injected into the animal. In some embodiments, determining the inhibitory effect of the anti-IL5 and / or IL5RA therapeutic agent on the tumor comprises measuring the volume of the tumor in the animal. In some embodiments, the tumor is a cancer, a malignant tumor, acute myeloid leukemia, bladder cancer, colorectal cancer, or a genitourinary cancer.

[0020] In one aspect, the present invention provides a method for determining the effectiveness of an anti-IL5 and / or IL5RA therapeutic agent and other therapeutic agents in treating cancer, the method comprising: 1) administering an anti-IL5 and / or IL5RA therapeutic agent and other therapeutic agents to an animal as described above, wherein the animal has a tumor; 2) determining the inhibitory effect of the anti-IL5 and / or IL5RA therapeutic agent and other treatments and combinations on the tumor. In some embodiments, the other therapeutic agent is an anti-PD-1 antibody, an anti-PD-L1 antibody, and / or an anti-CTLA4 antibody. In some embodiments, the tumor comprises one or more tumor cells, wherein the tumor cells are injected into the animal. In some embodiments, determining the inhibitory effect of the anti-IL5 and / or IL5RA therapeutic agent on the tumor comprises measuring the tumor volume in the animal. In some embodiments, the tumor is cancer, malignant tumor, acute myeloid leukemia, bladder cancer, colorectal cancer, or genitourinary cancer.

[0021] In one aspect, the present invention provides a method for determining the effectiveness of an anti-IL5 and / or IL5RA therapeutic in treating an autoimmune disease, the method comprising: 1) administering the anti-IL5 and / or IL5RA therapeutic to a non-human animal described above, wherein the non-human animal suffers from an autoimmune disease; and 2) determining the effect of the anti-IL5 and / or IL5RA therapeutic in treating the autoimmune disease. In some embodiments, the autoimmune disease is systemic lupus erythematosus, systemic sclerosis, systemic vasculitis, sinusitis, or urticaria.

[0022] In one aspect, the present invention provides a method for determining the efficacy of anti-IL5 and / or IL5RA therapeutics for treating inflammatory diseases, the method comprising: 1) administering an anti-IL5 and / or IL5RA therapeutic to an animal as described above; and 2) determining the efficacy of the anti-IL5 and / or IL5RA therapeutic on the inflammatory disease. In some embodiments, the inflammatory disease is dermatitis, atopic dermatitis, or chronic obstructive pulmonary disease (COPD).

[0023] In one aspect, the present invention provides a method for determining the toxicity of an anti-IL5 and / or IL5RA therapeutic agent, the method comprising: 1) administering the anti-IL5 and / or IL5RA therapeutic agent to an animal as described above; 2) determining the effect of the anti-IL5 and / or IL5RA therapeutic agent on the animal. In some embodiments, determining the effect of the anti-IL5 and / or IL5RA therapeutic agent on the animal involves measuring the animal's body weight, red blood cell count, hematocrit, and / or hemoglobin.

[0024] In one aspect, the present invention provides a humanized IL5 gene, comprising a portion of exon 1, all of exons 2-3, and a portion of exon 4 of a human IL5 gene. In some embodiments, the humanized gene comprises the entire nucleotide sequence of the coding region. In some embodiments, the humanized gene is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the nucleotide sequences of SEQ ID NOs: 3, 4, 5, and 8.

[0025] In one aspect, the present invention provides a humanized IL5RA protein, comprising all or part of the signal peptide, extracellular region, transmembrane and / or cytoplasmic region of a human IL5RA protein. In some embodiments, the amino acid sequence of the humanized protein is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 21 at positions 24-323 and / or positions 1-340. In some embodiments, the amino acid sequence of the humanized protein is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 28 and 48.

[0026] In one aspect, the present invention provides a humanized IL5RA gene, wherein the humanized IL5RA gene encodes the humanized protein described above. In some embodiments, the humanized gene comprises a portion of exon 3, all of exons 4-8, and / or a portion of exon 9 of the human IL5RA gene. In some embodiments, the humanized gene comprises a portion of exon 3, all of exons 4-9, and / or a portion of exon 10 of the human IL5RA gene. In some embodiments, the humanized gene comprises at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identity to the nucleotide sequence of SEQ ID NOs: 22, 23, 24, 27, 42, 43, 44, 47, 49, 50, and 54.

[0027] In one aspect, the present invention provides a cell comprising the humanized gene and the humanized IL5RA protein described above.

[0028] In one aspect, the present invention provides an animal model comprising the humanized gene and humanized IL5RA protein described above. Unless otherwise defined, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials for use in the present invention are described herein; other suitable methods and materials known in the art may be used. The materials, methods, and examples are illustrative only and not limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In the event of conflict, the present specification, including definitions, will control.

[0029] Those skilled in the art can easily discern other conveniences and advantages of the present application from the following detailed description. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Hereinafter, embodiments of the present invention will be described in detail with reference to the accompanying drawings, in which:

[0031] Figure 1: Schematic comparison of the mouse IL5 locus and the human IL5 locus (not to scale);

[0032] Figure 2: Schematic diagram of the humanized mouse IL5 locus (not to scale);

[0033] Figure 3: Schematic diagram of IL5 gene targeting strategy and targeting vector V1 design (not to scale);

[0034] Figure 4: Southern blot results, WT is the wild-type control;

[0035] Figure 5: Genotype identification results of F1 generation mice, M is a marker, WT is a wild-type control, PC is a positive control, and H2O is a water control;

[0036] Figure 6: ELISA test results, where + / + represents wild-type C57BL / 6 mice and H / + represents IL5 gene humanized heterozygous mice;

[0037] Figure 7: Schematic comparison of the mouse IL5RA locus and the human IL5RA locus (not to scale);

[0038] Figure 8: Schematic diagram of the humanized transformation of the mouse IL5RA locus (not to scale);

[0039] Figure 9: Schematic diagram of IL5RA gene targeting strategy and targeting vector V2 design (not to scale);

[0040] Figure 10: Southern blot results, WT is the wild-type control;

[0041] Figure 11: Genotype identification results of F1 generation mice, M is a marker, WT is a wild-type control, PC is a positive control, and H2O is a water control;

[0042] Figure 12: Schematic diagram of the second humanized modification of the mouse IL5RA locus (not to scale);

[0043] Figure 13: Schematic diagram of IL5RA gene targeting strategy and targeting vector V3 design (not to scale);

[0044] Figure 14: Schematic diagram of IL5RA gene targeting strategy and targeting vector V4 design (not to scale);

[0045] Figure 15: Genotype identification results of F1 generation mice, M is a marker, WT is a wild-type control, and H2O is a water control;

[0046] Figure 16: Southern blot analysis results of F1 mice, WT is the wild-type control;

[0047] Figure 17: ELISA test results, where + / + represents wild-type C57BL / 6 mice, and H / H represents IL5 / IL5RA gene double humanized homozygous mice;

[0048] Figure 18: Experimental scheme of the asthma model induced by ovalbumin combined with aluminum hydroxide in IL5 / IL5RA dual-gene humanized homozygous mice;

[0049] Figure 19 shows the proportion of inflammatory cells in the bronchoalveolar lavage fluid (BALF) of an asthma model induced by ovalbumin combined with aluminum hydroxide in IL5 / IL5RA dual-gene humanized homozygous mice. Figure 19A shows the number of white blood cells (mCD45), Figure 19B shows the number of eosinophils, and Figure 19C shows the ratio of eosinophils to white blood cells (mCD45).

[0050] Figure 20: Airway tissue section staining results of an asthma model induced by ovalbumin combined with aluminum hydroxide in IL5 / IL5RA dual-gene humanized homozygous mice;

[0051] Figure 21: Scoring of inflammatory cell infiltration in blood vessels and around bronchi in an asthma model induced by ovalbumin combined with aluminum hydroxide in IL5 / IL5RA dual-gene humanized homozygous mice. Figure 21A shows the inflammatory cell infiltration score, Figure 21B shows the bronchial mucus formation score, and Figure 21C shows the eosinophil infiltration score.

[0052] Figure 22: Human IL5 amino acid sequence (NP_057646.1; SEQ ID NO: 2) and mouse IL5 amino acid sequence (NP_034688.1; SEQ ID NO: 1);

[0053] Figure 23: Human IL5 amino acid sequence (NP_057646.1; SEQ ID NO: 2) and rat IL5 amino acid sequence (NP_068606.1; SEQ ID NO: 59);

[0054] Figure 24: Human IL5RA amino acid sequence (NP_783853.1; SEQ ID NO: 21) and mouse IL5RA amino acid sequence (NP_032396.1; SEQ ID NO: 20);

[0055] Figure 25: Human IL5RA amino acid sequence (NP_783853.1; SEQ ID NO: 21) and rat IL5RA amino acid sequence (NP_446097.1; SEQ ID NO: 60).

[0056] Detailed description

[0057] Interleukin-5, also known as IL5, EDF, and TRF, is a glycosylated protein cytokine that forms homodimers and is produced by a variety of cells, including helper T cells, killer T cells, eosinophils, basophils, mast cells, and type 2 innate immune cells. IL5 acts through the receptor IL5R, participating in the recruitment and maturation of human and mouse eosinophils from the bone marrow, increasing their number in the blood and tissues and prolonging their survival.

[0058] IL5R is a heterodimer composed of α and β chains, encoded by the IL5RA and IL5RB genes, respectively. The α subunit is a specific receptor for IL5, while the β subunit is a co-receptor for cytokines such as IL5, GM-CSF, and IL3. IL5RA is primarily expressed in eosinophils. Due to alternative splicing, it is expressed in both membrane-bound and soluble forms. The soluble α chain receptor has low binding affinity for IL5 and acts as an antagonist in the IL5 signaling pathway. The membrane form of IL5RA consists of an extracellular domain of 322 amino acids, a 20-amino acid transmembrane region, and an intracellular sequence of 58 amino acids. IL5 knockout mice are viable and fertile, but exhibit developmental and functional impairments in B cells and eosinophils.

[0059] IL5 is associated with various allergic diseases, including allergic rhinitis and asthma. IL5 is abundantly expressed in the circulatory system, airway tissue, and induced eosinophils. Currently, three monoclonal antibodies targeting IL5 or IL5RA are marketed globally: mepolizumab, reslizumab, and benralizumab. All of these drugs are indicated for the treatment of asthma and have significantly improved the quality of life for asthma patients. Numerous other drugs targeting IL5 and IL5RA are currently under development.

[0060] IL5

[0061] In the human genome, the IL5 gene (Gene ID: 3567) contains four exons: exon 1, exon 2, exon 3, and exon 4 (Figure 1). The nucleotide sequence of human IL5 mRNA is NM_000879.3, and the amino acid sequence of human IL5 is NP_000870.1 (SEQ ID NO: 2). Based on the nucleotide and amino acid sequences of transcript NM_000879.3 and its encoded protein NP_000870.1, the corresponding positions of each exon are as follows:

[0062] Table 1

[0063] The human IL5 gene (NCBI Gene ID: 3567) is located on chromosome 5 at positions 132541445 to 132556815 of NC_000005.10 (GRCh38.p14 (GCF_000001405.40)). The specific positions of each exon based on transcript NM_000879.3 are as follows: 5′UTR is located at positions 132,543,522 to 132543479 of NC_000005.10, exon 1 is located at positions 132,543,522 to 132,543,335 of NC_000005.10, intron 1 is located at positions 132,543,334 to 132,543,127 of NC_000005.10, exon 2 is located at positions 132,543,126 to 132,543,094 of NC_000005.10, and intron 3 is located at positions 132,543,130 to 132,543,131 of NC_000005.10. C_000005.10 132,543,093 to 132,542,144, exon 3 is located at NC_000005.10 132,542,143 to 132,542,015, intron 3 is located at NC_000005.10 132,542,014 to 132,541,910, exon 4 is located at NC_000005.10 132,541,909 to 132,541,445, and 3'UTR is located at NC_000005.10 132541810 to 132541445. All relevant information about the human IL5 locus can be retrieved on the NCBI website (Gene ID: 3567). The entire content of which is incorporated herein by reference.

[0064] In the mouse genome, the IL5 gene (Gene ID: 16191) contains four exons: exon 1, exon 2, exon 3, and exon 4 (Figure 1). The nucleotide sequence of mouse IL5 mRNA is NM_010558.1, and the amino acid sequence of mouse IL5 is NP_034688.1 (SEQ ID NO: 1). Based on the nucleotide and amino acid sequences of the transcript NM_010558.1 and its encoded protein NP_034688.1, the corresponding positions of each exon are as follows:

[0065] Table 2

[0066] The mouse IL5 gene (NCBI Gene ID: 16191) is located on chromosome 11 at positions 53611621 to 53615930 of NC_000077.7 (GRCm39 (GCF_000001635.27)). The specific positions of each exon based on transcript NM_010558.1 are as follows: 5'UTR is located at positions 53,611,621 to 53,611,663 of NC_000077.7, exon 1 is located at positions 53,611,621 to 53,611,804 of NC_000077.7, intron 1 is located at positions 53,611,805 to 53,612,632 of NC_000077.7, exon 2 is located at positions 53,612,633 to 53,612,665 of NC_000077.7, and intron 3 is located at positions 53,611,621 to 53,611,804 of NC_000077.7. The mouse IL5 locus is located at positions 53,612,666 to 53,614,534 of NC_000077.7, exon 3 is located at positions 53,614,535 to 53,614,663 of NC_000077.7, intron 3 is located at positions 53,614,664 to 53,614,742 of NC_000077.7, exon 4 is located at positions 53,614,743 to 53,615,933 of NC_000077.7, and the 3' UTR is located at positions 53,614,842 to 53,615,933 of NC_000077.7. All relevant information about the mouse IL5 locus can be retrieved on the NCBI website (Gene ID: 16191), the entire contents of which are incorporated herein by reference.

[0067] Figure 22 shows an alignment of the human IL5 amino acid sequence (NP_057646.1; SEQ ID NO: 2) and the mouse IL5 amino acid sequence (NP_034688.1; SEQ ID NO: 1). Therefore, corresponding amino acid residues or regions between human and mouse IL5 can be found in Figure 22.

[0068] IL5 genes, proteins, and gene loci for other species are also known in the art. For example, Rattus norvegicus (rat) IL5 has Gene ID: 24497, Macaca mulatta (rhesus monkey) IL5 has Gene ID: 710622, Canis lupus familiaris (dog) IL5 has Gene ID: 403790, and Sus scrofa (pig) IL5 has Gene ID: 397409. Relevant information (e.g., intron sequences, exon sequences, and amino acid sequences) for these genes can be found in NCBI, the entire contents of which are incorporated herein by reference.

[0069] Figure 23 shows the amino acid sequence of human IL5 (NP_000870.1; SEQ ID NO: 2) and rat IL5 (NP_068606.1; SEQ ID NO: 59). Therefore, the corresponding amino acid residues or regions between human and rat IL5 can be retrieved in Figure 23.

[0070] The present invention provides a human or chimeric (e.g., humanized) IL5 nucleotide sequence or amino acid sequence. In some embodiments, all or part of the nucleotide sequence of mouse IL5 gene exon 1, exon 2, exon 3 and / or exon 4 is replaced by the corresponding nucleotide sequence of human IL5 gene. In some embodiments, "part" of mouse IL5 gene exon 1, exon 2, exon 3 and / or exon 4 is replaced by the corresponding nucleotide sequence or amino acid sequence of human IL5 gene. The "part" refers to at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 200, 250, 300, 350, 400, 401, 402, 450, 500, 800, 1000, 1200, 14 In some embodiments, the “portion” comprises at least 1500, 1500, 1520, 1530, 1531, 1532, 1533 or 1534 bp of continuous nucleotide sequence, or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 131, 132 or 133 continuous amino acid sequence. In some embodiments, the “portion” is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or at least 100% identical to the amino acid sequence encoded by exon 1, exon 2, exon 3 and / or exon 4. In some embodiments, "partial" or "complete" sequence of mouse IL5 gene exon 1, exon 2, exon 3 and / or exon 4 (e.g., part of exon 1, all of exons 2-3 and part of exon 4) is replaced by "partial" or "complete" sequence of human IL5 gene exon 1, exon 2, exon 3, and / or exon 4 (e.g., part of exon 1, all of exons 2-3 and part of exon 4).

[0071] In some embodiments, a "portion" of endogenous exon 1, intron 1, exon 2, intron 2, exon 3, intron 3, and / or exon 4 is deleted.

[0072] In some embodiments, the present invention provides a genetically modified non-human animal, wherein the genome of the non-human animal comprises a human or humanized IL5 nucleotide sequence. In some embodiments, the protein encoded by the human or humanized IL5 nucleotide sequence is at least 70%, 80%, 85%, 90%, 95%, or 100% identical to the amino acid sequence of SEQ ID NO: 2. In some embodiments, the genome of the non-human animal comprises a nucleotide sequence that is at least 70%, 80%, 85%, 90%, 95%, or 100% identical to the nucleotide sequence of SEQ ID NO: 3, 4, 5, 6, 7, or 8.

[0073] In some embodiments, the non-human animal described herein comprises a human or humanized IL5 gene. In some embodiments, the humanized IL5 gene comprises 4 exons. In some embodiments, the humanized IL5 gene comprises human exon 1, human exon 2, human exon 3, and / or human exon 4. In some implementations, the humanized IL5 gene comprises human intron 1, human intron 2, and / or human intron 3. In some embodiments, the humanized IL5 gene comprises humanized exon 1, human exon 2, human exon 3, and / or humanized exon 4. In some embodiments, the humanized IL5 gene comprises a human or humanized 5'UTR. In some implementations, the humanized IL5 gene comprises a human or humanized 3'UTR. In some embodiments, the humanized IL5 gene comprises an endogenous 5'UTR. In some embodiments, the humanized IL5 gene comprises an endogenous 3'UTR.

[0074] In some embodiments, the genetically modified non-human animal can express human IL5 and / or humanized IL5 protein, wherein the endogenous IL5 gene sequence is replaced with a human IL5 gene and / or nucleotide sequence. Furthermore, the amino acid sequence of the human IL5 protein encoded by the human IL5 gene and / or nucleotide sequence is at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 100% identical to the amino acid sequence of the human IL5 protein set forth in SEQ ID NO: 2. In some embodiments, the endogenous IL5 gene is replaced in whole or in part with a nucleotide sequence encoding a mature human IL5 protein. In some embodiments, the human IL5 gene and / or nucleotide sequence encodes all or part of the human IL5 protein. In some embodiments, the human IL5 gene and / or nucleotide sequence encodes the entire human IL5 protein.

[0075] In some embodiments, the genetically modified non-human animal expresses human IL5 and / or humanized IL5 protein under a mouse endogenous promoter and / or regulatory elements. Replacement of the mouse endogenous locus provides a non-human animal that expresses human or humanized IL5 protein in the same cell type. The genetically modified mice do not develop potential diseases observed in certain other transgenic mice known in the art. The human IL5 or humanized IL5 protein expressed in the non-human animal can maintain one or more functions of wild-type or human IL5 proteins, for example, the expressed IL5 protein can bind to human or non-human IL5RA protein. Further, in some embodiments, the genetically modified non-human animal does not express endogenous IL5 protein. In some embodiments, the expression of endogenous IL5 protein in the genetically modified non-human animal is reduced compared to IL5 in wild-type animals. The "endogenous IL5 protein" described herein refers to the IL5 protein encoded by the nucleotide sequence of the endogenous IL5 gene of the non-human animal (e.g., mouse) before genetic modification.

[0076] The genome of the non-human animal comprises a nucleotide sequence encoding an amino acid that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequence of human IL5 protein (NP_000870.1; SEQ ID NO: 2). In some embodiments, the genome comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or at least 100% identical to the nucleotide sequences of SEQ ID NO: 5 and SEQ ID NO: 8.

[0077] The nucleotide sequence encoding the endogenous IL5 region in the non-human animal genome is replaced by the nucleotide sequence encoding the corresponding region of human IL5. In some embodiments, the nucleotide sequence encoding the endogenous IL5 region is any sequence of the endogenous IL5 locus, such as exon 1, exon 2, exon 3, exon 4, 5'UTR, 3'UTR, intron 1, intron 2, intron 3 or any combination thereof. In some embodiments, the nucleotide sequence encoding the endogenous IL5 region is located within the endogenous IL5 regulatory region. In some embodiments, the nucleotide sequence encoding the endogenous IL5 region is located in endogenous IL5 gene exon 1, exon 2, exon 3 and / or exon 4, or a portion thereof.

[0078] One or more cells of the genetically modified non-human animal express a human or humanized IL5 protein. In some embodiments, the human or humanized IL5 protein comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 131, 132, 133, or 134 consecutive amino acids of the amino acid sequence of SEQ ID NO: 2.

[0079] In some embodiments, the genome of the genetically modified non-human animal comprises all or part of exon 1, exon 2, exon 3, and / or exon 4 of the human IL5 gene. In some embodiments, the genome of the genetically modified non-human animal comprises part of exon 1, all of exons 2-3, and part of exon 4 of the human IL5 gene. In some embodiments, the portion of exon 1 of the human IL5 gene comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 140, 141, 142, 143, 144, 150, 160, 170, 180, 182, 184, 185, 186, 187, or 188 bp of continuous nucleotide sequence. In some embodiments, the portion of exon 1 comprises 144 bp of continuous nucleotide sequence. In some embodiments, the portion of exon 4 comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 92, 94, 95, 96, 97, 98, 99, 100, 120, 140, or 465 bp of continuous nucleotide sequence. In some embodiments, the portion of exon 1 comprises 99 bp of continuous nucleotide sequence. In some embodiments, the nucleotide sequence encoding the corresponding region of human IL5 is located at nucleotides 45-449 of human IL5 gene transcript NM_000879.3.

[0080] In some embodiments, the non-human animal genome comprises a nucleotide sequence encoding all or part of the amino acid sequence of human IL5; in some embodiments, the non-human animal genome comprises all or part of the nucleotide sequence shown in SEQ ID NO:5.

[0081] In some embodiments, the genetically modified non-human animal genome comprises a portion of exon 1 and a portion of exon 4 of an endogenous IL5 gene (e.g., mouse). In some embodiments, the portion of exon 1 comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 41, 42, 43, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 181, 182, 183, or 184 bp of continuous nucleotide sequence. In some embodiments, the portion of exon 1 comprises 43 bp of continuous nucleotide sequence. In some embodiments, the portion of exon 4 comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 400, 600, 700, 800, 900, 1000, 1020, 1040, 1060, 1070, 1080, 1082, 1084, 1085, 1086, 1087, 1088, 1089, 1090, 1100, 1120, 1140, 1160, 1180, 1182, 1184, 1186, 1187, or 1188 bp of contiguous nucleotide sequence. In some embodiments, the portion of exon 4 comprises 1089 bp of contiguous nucleotide sequence.

[0082] In some embodiments, the modified gene in the modified animal genome is homozygous or heterozygous for the endogenous replaced locus. In a specific embodiment, the modified IL5 gene in the genome is heterozygous or homozygous for the endogenous replaced locus.

[0083] In some embodiments, the humanized IL5 genome comprises the 5'UTR of the human IL5 gene. In some embodiments, the humanized IL5 genome comprises an endogenous (e.g., mouse) 5'UTR. In some embodiments, the humanized IL5 genome comprises an endogenous (e.g., mouse) 3'UTR. Where appropriate, based on the similarity of the 5' flanking sequences, it can be reasonably inferred that the mouse and human IL5 genes are subject to similar regulation. As described herein, the humanized IL5 mouse comprises a replacement of the endogenous mouse locus, which retains the mouse endogenous regulatory elements but comprises the human IL5 coding sequence. The expression of IL5 in the genetically modified heterozygous or homozygous mice is completely normal.

[0084] In another aspect, the present invention provides a genetically modified non-human animal, wherein the genome of the non-human animal comprises a deletion of an endogenous IL5 gene, wherein the deletion of the endogenous IL5 gene comprises exon 1, exon 2, exon 3, and / or exon 4, or a partial deletion thereof. In some embodiments, the portion comprises a portion of exon 1, all of exons 2-3, and a portion of exon 4.

[0085] In some embodiments, the portion of exon 1 comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 21, 22, 25, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 141, 150, 160, 170, 180, 181, 182, 183 or 184 bp of continuous nucleotide sequence or more. In some embodiments, the portion of exon 4 comprises 141 bp of continuous nucleotide sequence. In some embodiments, the portion of exon 4 comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 21, 22, 25, 30, 40, 50, 60, 70, 80, 90, 92, 94, 96, 98, 99, 110, 150, 200, 300, 500, 800, 1000, 1100, 1120, 1140, 1160, 1180, 1182, 1184, 1186, 1187, or 1188 bp of contiguous nucleotide sequence or more. In some embodiments, the portion of exon 4 comprises 99 bp of contiguous nucleotide sequence.

[0086] In some embodiments, the deletion of the endogenous IL5 gene further includes one or more introns among intron 1, intron 2, and intron 3.

[0087] In some embodiments, the deletion comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 200, 250, 300, 350, 400, 401, 402, 450, 500, 800, 1000, 1200, 1400, 1500, 1520, 1530, 1531, 1532, 1533, 1534, 1534, 2000, 3000, or 3178 bp of contiguous nucleotide sequence, or more.

[0088] The present invention provides a humanized mouse IL5 genomic DNA sequence; a construct expressing the amino acid sequence of humanized IL5 protein; a cell containing the construct; and a tissue containing the cell. Thus, in some embodiments, the present invention provides a humanized IL5 nucleotide sequence and / or amino acid sequence, wherein in some embodiments, the humanized nucleotide sequence has at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to mouse endogenous IL5 mRNA (e.g., NM_010558.1), mouse IL5 amino acid sequence (e.g., NP_034688.1, SEQ ID NO: 1), or a portion thereof (e.g., a portion of exon 1 and a portion of exon 4). In some embodiments, the humanized nucleotide sequence has at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a human IL5 mRNA sequence (e.g., NM_000879.3), an IL5 amino acid sequence (e.g., NP_000870.1, SEQ ID NO: 2), or a portion thereof (e.g., a portion of exon 1, all of exons 2-3, and a portion of exon 4).

[0089] In some embodiments, the humanized nucleic acid sequence is operably linked to an endogenous promoter or regulatory element, such as a mouse IL5 promoter, an inducible promoter, an enhancer, and / or a mouse regulatory element.

[0090] In some embodiments, at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., a contiguous or non-contiguous nucleotide sequence) of a humanized nucleic acid sequence described herein differs from all or a portion of a mouse IL5 nucleotide sequence (e.g., a portion of exon 1, all of exons 2-3, and a portion of exon 4 of the mouse IL5 gene transcript NM_010558.1).

[0091] In some embodiments, at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., a contiguous or non-contiguous nucleotide sequence) of the chimeric nucleic acid sequence is identical to all or a portion of a mouse IL5 nucleotide sequence (e.g., a portion of exon 1 and a portion of exon 4 of the mouse IL5 gene transcript NM_010558.1).

[0092] In some embodiments, at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., a contiguous or non-contiguous nucleotide sequence) of the humanized nucleic acid sequence is different from all or part of the human IL5 nucleotide sequence (e.g., a portion of exon 1 and a portion of exon 4 of the human IL5 gene transcript NM_000879.3).

[0093] In some embodiments, at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., a continuous or non-contiguous nucleotide sequence) of the humanized nucleic acid sequence is identical to all or part of a human IL5 nucleotide sequence (e.g., part of exon 1, all of exons 2-3, and part of exon 4 of the human IL5 gene transcript NM_000879.3).

[0094] In some embodiments, at least a portion of the amino acids encoded by the humanized nucleic acid sequence (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, such as contiguous or non-contiguous amino acid residues) differs from all or a portion of the amino acid sequence of the mouse IL5 protein (e.g., amino acids 1-133 of the mouse IL5 protein sequence NP_034688.1 (SEQ ID NO: 1)).

[0095] In some embodiments, at least a portion of the amino acid sequence (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., consecutive or non-consecutive amino acid residues) is identical to all or part of the amino acid sequence of a human IL5 protein (e.g., amino acids 1-134 of human IL5 protein sequence NP_000870.1 (SEQ ID NO: 2)).

[0096] The present invention also provides a humanized IL5 mouse amino acid sequence, wherein the amino acid sequence comprises any one of the following groups:

[0097] A) amino acid sequence shown in SEQ ID NO: 2;

[0098] B) is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99% identical to the amino acid sequence of SEQ ID NO: 2;

[0099] C) differs from the amino acid sequence of SEQ ID NO: 2 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 amino acid; or

[0100] D) an amino acid sequence as shown in SEQ ID NO: 2, including substitution, deletion and / or insertion of one or more amino acid residues.

[0101] The present invention also provides a humanized IL5 nucleotide (eg, DNA or RNA) sequence, wherein the nucleotide sequence comprises any one of the following groups:

[0102] A) nucleic acid sequences as shown in SEQ ID NOs: 3, 4, 5, 6, 7 and 8, or nucleic acid sequences encoding humanized mouse IL5 homologous amino acid sequences;

[0103] B) a nucleic acid sequence capable of hybridizing to the nucleotide sequences shown in SEQ ID NOs: 3, 4, 5, 6, 7, and 8 under low stringency conditions or stringent conditions;

[0104] C) a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% homology to the nucleotide sequences set forth in SEQ ID NOs: 3, 4, 5, 6, 7 and 8;

[0105] D) the amino acid sequence it encodes is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 2;

[0106] E) the encoded amino acid sequence differs from the amino acid sequence of SEQ ID NO: 2 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 amino acid; or

[0107] F) The encoded amino acid sequence is the same as that shown in SEQ ID NO: 2, including the amino acid sequence in which one or more amino acid residues are substituted, deleted and / or inserted.

[0108] The present invention further provides a humanized mouse IL5 genomic DNA sequence, which is obtained by reverse transcription of the mRNA transcribed from the IL5 genomic DNA sequence and is identical to or complementary to a DNA sequence homologous to the sequence shown in SEQ ID NO: 5 or 8.

[0109] The present invention also provides cells, tissues, and animals (e.g., mice) comprising the nucleotide sequences described herein, as well as cells, tissues, and animals (e.g., mice) that express human or chimeric (e.g., humanized) IL5 at an endogenous non-human IL5 locus.

[0110] In the human genome, the IL5RA gene (Gene ID: 3568) contains 12 exons: exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, and exon 12 ( Figure 7 ). The nucleotide sequence of human IL5RA mRNA is NM_175726.4, and the amino acid sequence of human IL5RA is NP_783853.1 (SEQ ID NO: 21). Based on the nucleotide and amino acid sequences of transcript NM_175726.4 and its encoded protein NP_783853.1, the corresponding positions of each exon are as follows:

[0111] Table 3

[0112] The human IL5RA gene (NCBI Gene ID: 3568) is located on chromosome 3 at positions 3066324 to 3110374 of NC_000003.12 (GRCh38.p14 (GCF_000001405.40)).The specific positions of each exon based on transcript NM_175726.4 are as follows: 5′UTR is located at positions 3,110,374 to 3109945, 3108691 to 3108550, and 3104987 to 3104985 of NC_000003.12, exon 1 is located at positions 3110374 to 3109945 of NC_000003.12, intron 1 is located at positions 3109944 to 3108692 of NC_000003.12, exon 2 is located at positions 3108691 to 3108550 of NC_000003.12, and intron 3 is located at positions 3104987 to 3104985 of NC_000003.12. 988, exon 3 is located at NC_000003.12 positions 3104987 to 3104903, intron 3 is located at NC_000003.12 positions 3104902 to 3102821, exon 4 is located at NC_000003.12 positions 3102820 to 3102675, intron 4 is located at NC_000003.12 positions 3102674 to 3101831, exon 5 is located at NC_000003.12 positions 3101830 to 3101692, intron 5 is located at NC_000003.12 positions 3101691 to 3098291, and exon 6 is located at NC_000003.12 positions 309 8290 to 3098137, intron 6 is located at NC_000003.12 positions 3098136 to 3098058, exon 7 is located at NC_000003.12 positions 3098057 to 3097870, intron 7 is located at NC_000003.12 positions 3097869 to 3095445, exon 8 is located at NC_000003.12 positions 3095444 to 3095299, intron 8 is located at NC_000003.12 positions 3095298 to 3092363, exon 9 is located at NC_000003.12 positions 3092362 to 3092224, intron 9 is located at NC_000003.12 positions 3092363 to 3092224. 03.12 positions 3092223 to 3076628, exon 10 is located at positions 3076627 to 3076531 of NC_000003.12, intron 10 is located at positions 3076530 to 3074867 of NC_000003.12, exon 11 is located at positions 3074866 to 3074782 of NC_000003.12, intron 11 is located at positions 3074781 to 3070312 of NC_000003.12, exon 12 is located at positions 3070311 to 3066324 of NC_000003.12, and 3'UTR is located at positions 3070224 to 3066324 of NC_000003.12.All relevant information on the human IL5RA locus can be retrieved from the NCBI website (Gene ID: 3568), the entire contents of which are incorporated herein by reference.

[0113] In the mouse genome, the IL5RA gene (Gene ID: 16192) contains 13 exons: exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, and exon 13 ( Figure 7 ). The nucleotide sequence of mouse IL5RA mRNA is NM_008370.2, and the amino acid sequence of mouse IL5RA is NP_032396.1 (SEQ ID NO: 20). Based on the nucleotide and amino acid sequences of transcript NM_008370.2 and its encoded protein NP_032396.1, the corresponding positions of each exon are as follows:

[0114] Table 4

[0115] The mouse IL5RA gene (NCBI Gene ID: 16192) is located on chromosome 6 at positions 106687336 to 106725998 of NC_000072.7 (GRCm39 (GCF_000001635.27)). The specific positions of each exon based on transcript NM_008370.2 are as follows: 5′UTR is located at positions 106725998 to 106725808, 106722541 to 106722480, 106722070 to 106722034, and 106,721,309 to 106,721,298 of NC_000072.7, exon 1 is located at positions 106725998 to 106,725,808 of NC_000072.7, and intron 1 is located at positions 10672541 to 106722480 of NC_000072.7. , exon 2 is located at NC_000072.7 positions 106722541 to 106722480, intron 2 is located at NC_000072.7 positions 106,722,479 to 106,722,071, exon 3 is located at NC_000072.7 positions 106,722,070 to 106,722,034, intron 3 is located at NC_000072.7 positions 106,722,033 to 106,721,310, exon 4 is located at NC_000072.7 positions 106,721,309 to 106,721,225, intron 4 is located at NC_000072.7 positions at positions 106,721,224 to 106,719,759 of NC_000072.7, exon 5 is located at positions 106,719,758 to 106,719,613 of NC_000072.7, intron 5 is located at positions 106,719,612 to 106,718,234 of NC_000072.7, exon 6 is located at positions 106,718,233 to 106,718,095 of NC_000072.7, intron 6 is located at positions 106718094 to 106715475 of NC_000072.7. 072.7 at positions 106,715,474 to 106,715,321, intron 7 is located at positions 106,715,320 to 106,715,245, exon 8 is located at positions 106,715,244 to 106,715,057, intron 8 is located at positions 106,715,056 to 106,712,812, exon 9 is located at positions 106,712,811 to 106,712,666, intron 9 is located at positions 106,712,666, intron 8 is located at positions 106,715,244 to 106,715,057, intron 8 is located at positions 106,712,811 to 106,712,666, intron 9 is located at positions 106,712,666, intron 8 is located at positions 106,715,244 to 106,715,057, intron 8 is located at positions 106,715,056 to 106,712,812, intron 9 is located at positions 106,712,811 to 106,712,666, intron 9 is located at positions 106,712,7 positions 106,712,665 to 106,708,893, exon 10 is located at NC_000072.7 positions 106,708,892 to 106,708,754, intron 10 is located at NC_000072.7 positions 106,708,753 to 106,693,752, exon 11 is located at NC_000072.7 positions 106,693,751 to 106,693,658, intron 11 is located at NC_000072.7 positions 106,693,6 The IL5RA locus is located at positions 106,692,664 to 106,692,580 of NC_000072.7, exon 12 is located at positions 106,692,579 to 106,689,427 of NC_000072.7, exon 13 is located at positions 106,689,426 to 106,687,318 of NC_000072.7, and the 3' UTR is located at positions 106689342 to 106687318 of NC_000072.7. All relevant information about the mouse IL5RA locus can be retrieved on the NCBI website (Gene ID: 16192). The entire content is incorporated herein by reference.

[0116] Figure 24 shows an alignment of the human IL5RA amino acid sequence (NP_783853.1; SEQ ID NO: 21) and the mouse IL5RA amino acid sequence (NP_032396.1; SEQ ID NO: 20). Therefore, corresponding amino acid residues or regions between human and mouse IL5RA can be found in Figure 24.

[0117] IL5RA genes, proteins, and gene loci from other species are also known in the art. For example, Rattus norvegicus (rat) IL5RA has Gene ID: 114103, Macaca mulatta (rhesus monkey) IL5RA has Gene ID: 704649, Canis lupus familiaris (dog) IL5 has Gene ID: 476553, and Sus scrofa (pig) IL5RA has Gene ID: 100137085. Relevant information (e.g., intron sequences, exon sequences, and amino acid sequences) for these genes can be found in NCBI, the entire contents of which are incorporated herein by reference.

[0118] Figure 25 shows the amino acid sequence of human IL5RA (NP_783853.1; SEQ ID NO: 21) and rat IL5RA (NP_446097.1; SEQ ID NO: 60). Therefore, the corresponding amino acid residues or regions between human and rat IL5RA can be retrieved in Figure 25.

[0119] The present invention provides a human or chimeric (e.g., humanized) IL5RA nucleotide sequence or amino acid sequence. In some embodiments, all or part of the nucleotide sequence of mouse IL5RA gene exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, and / or exon 13 is replaced by the corresponding nucleotide sequence of the human IL5RA gene. In some embodiments, "part" of mouse IL5RA gene exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, and / or exon 13 is replaced by the corresponding nucleotide sequence or amino acid sequence of the human IL5RA gene. The term "portion" refers to at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 140, 160, 200, 220, 221, 222, 223, 250, 300, 500, 700, 800, 900, 1000, 1400, 1600, 1800, 2000, 2175, 2200, 2600, 3000, 3200, 3400, 3500, 3520, 3540, 3560, 3570, 3580, 3590, 3600, 3610, 3620, 3630, 3640, 3650, 3660, 3670, 3680, 3690, 3700, 3710, 3720, 3730, 3740, 3750, 3760, 3770, 3780, 3790, 3800 400, 410, 412, 413, 414, or 415 consecutive amino acid sequences. In some embodiments, the "portion" is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or at least 100% identical to the amino acid sequence encoded by exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12 and / or exon 13.In some embodiments, a "partial" or "complete" sequence of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, and / or exon 13 of a mouse IL5RA gene (e.g., a portion of exon 4, all of exons 5-9, and a portion of exon 10, or a portion of exon 5 and all of exon 6) is included. ) is replaced by "partial" or "complete" sequence of human IL5RA gene exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11 and / or exon 12 (e.g., part of exon 3, all of exons 4-8 and part of exon 9, or part of exon 3, all of exon 4-9 and part of exon 10).

[0120] In some embodiments, a “portion” of endogenous exon 1, intron 1, exon 2, intron 2, exon 3, intron 3, exon 4, intron 4, exon 5, intron 5, exon 6, intron 6, exon 7, intron 7, exon 8, intron 8, exon 9, intron 9, exon 10, intron 10, exon 11, intron 11, exon 12, intron 12, and / or exon 13 is deleted.

[0121] In some embodiments, the present invention provides a genetically modified non-human animal, wherein the genome of the non-human animal comprises a human or humanized IL5RA nucleotide sequence. In some embodiments, the protein encoded by the human or humanized IL5RA nucleotide sequence is at least 70%, 80%, 85%, 90%, 95%, or 100% identical to the amino acid sequence of SEQ ID NO: 21 or 28. In some embodiments, the genome of the non-human animal comprises a nucleotide sequence that is at least 70%, 80%, 85%, 90%, 95%, or 100% identical to the nucleotide sequence of SEQ ID NO: 22, 23, 24, 25, 26, 27, 42, 43, 44, 45, 46, 47, 49, 50, and / or 54.

[0122] In some embodiments, the non-human animal described herein comprises a human or humanized IL5RA gene. In some embodiments, the humanized IL5RA gene comprises 13 exons. In some embodiments, the humanized IL5RA gene comprises human exon 1, human exon 2, human exon 3, human exon 4, human exon 5, human exon 6, human exon 7, human exon 8, human exon 9, human exon 10, human exon 11, and / or human exon 12. In some implementations, the humanized IL5RA gene comprises human intron 1, human intron 2, intron 3, intron 4, intron 5, intron 6, human intron 7, human intron 8, intron 9, intron 10, and / or human intron 11. In some embodiments, the humanized IL5RA gene comprises murine exon 1, murine exon 2, murine exon 3, humanized exon 4, human exon 4, human exon 5, human exon 6, human exon 7, human exon 8, humanized exon 10, murine exon 11, murine exon 12, and / or murine exon 13. In some embodiments, the humanized IL5RA gene comprises a human or humanized 5'UTR. In some implementations, the humanized IL5RA gene comprises a human or humanized 3'UTR. In some embodiments, the humanized IL5RA gene comprises an endogenous 5'UTR. In some embodiments, the humanized IL5RA gene comprises an endogenous 3'UTR.

[0123] In some embodiments, the genetically modified non-human animal can express human IL5RA and / or humanized IL5RA protein, wherein the endogenous IL5RA gene sequence is replaced with a human IL5RA gene and / or nucleotide sequence. Furthermore, the human IL5RA gene and / or nucleotide sequence encodes a human IL5RA protein with an amino acid sequence that is at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 100% identical to the amino acid sequence of the human IL5RA protein set forth in SEQ ID NO: 21. In some embodiments, the endogenous IL5RA gene is replaced in whole or in part with a nucleotide sequence encoding a mature human IL5RA protein. In some embodiments, the human IL5RA gene and / or nucleotide sequence encodes all or a portion of a human IL5RA protein. In some embodiments, the human IL5RA gene and / or nucleotide sequence encodes the entire human IL5RA protein.

[0124] In some embodiments, the human or humanized IL5RA protein comprises all or part of the signal peptide, extracellular region, transmembrane and / or cytoplasmic region of the human IL5RA protein. In some embodiments, the human or humanized IL5RA protein comprises all or a portion of the extracellular region of a human IL5RA protein, further comprising at least 50 consecutive amino acids, such as at least 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 310, 320, 321, or 322 consecutive amino acids, and the extracellular region of the human or humanized IL5RA protein comprises at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 100% identity to the amino acid sequence of positions 24-323 or 21-340 of SEQ ID NO: 21.

[0125] In some embodiments, the human or humanized IL5RA protein comprises all or a portion of a human IL5RA protein signal peptide. In some embodiments, the portion of the human IL5RA protein signal peptide comprises at least 10 consecutive amino acids, such as at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 19, or 20 consecutive amino acids, and the human or humanized IL5RA protein signal peptide comprises at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 100% identity to the amino acid sequence of positions 1-20 of SEQ ID NO: 21.

[0126] In some embodiments, the human or humanized IL5RA protein comprises all or part of the signal peptide, extracellular region, transmembrane and / or cytoplasmic region of a mouse IL5RA protein. In some embodiments, the human or humanized IL5RA protein comprises all or part of the signal peptide of a mouse IL5RA protein, further comprising at least 10 consecutive amino acids, such as at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, or 17 consecutive amino acids, and the human or humanized IL5RA protein signal peptide comprises at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 100% identity to the amino acid sequence of positions 1-17 of SEQ ID NO: 20.

[0127] In some embodiments, the human or humanized IL5RA protein comprises all or part of the extracellular region of a mouse IL5RA protein, further comprising at least 1, 2, 3, 4, 5, 8, 10, 12, 14, 16, 17, 18, 19, 20, 21, 22, 23, 25, 26, 27, 28, 29, 30, 31, 35, 40, 60, 80, 110, 150, 190, 200, 230, 260, 280, 290, 300, 310, 320, 321 or 322 consecutive amino acids, and the extracellular region of the human or humanized IL5RA protein comprises the residues corresponding to SEQ ID NO: The amino acid sequence identity of NO:20 at positions 18-20, 321-339, 18-45, and / or 337-339 is at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98% or 100%.

[0128] In some embodiments, the human or humanized IL5RA protein comprises all or a portion of the transmembrane region of a mouse IL5RA protein, further comprising at least 10 consecutive amino acids, such as at least 1, 2, 3, 4, 5, 6, 8, 10, 12, 14, 16, 18, 20, 21, or 22 consecutive amino acids, and the cytoplasmic region of the human or humanized IL5RA protein comprises at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 100% identity to the amino acid sequence of positions 340-361 of SEQ ID NO: 20.

[0129] In some embodiments, the human or humanized IL5RA protein comprises all or a portion of the cytoplasmic region of a mouse IL5RA protein, further comprising at least 20 consecutive amino acids, such as at least 10, 12, 15, 17, 18, 20, 22, 24, 26, 28, 32, 36, 40, 44, 48, 50, 51, 52, 53, or 54 consecutive amino acids, and the cytoplasmic region of the human or humanized IL5RA protein comprises at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 100% identity to the amino acid sequence of positions 362-415 of SEQ ID NO: 20.

[0130] In some embodiments, the human or humanized IL5RA protein comprises at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 100% identity to the amino acid sequence as set forth in SEQ ID NO: 20, positions 1-20, 321-415, 1-45, 337-415, SEQ ID NO: 21, positions 24-323, and / or 1-340.

[0131] In some embodiments, the genetically modified non-human animal expresses human IL5RA and / or humanized IL5RA protein under a mouse endogenous promoter and / or regulatory elements. Replacement of the mouse endogenous locus provides a non-human animal that expresses human or humanized IL5RA protein in the same cell type. The genetically modified mouse does not develop potential diseases observed in certain other transgenic mice known in the art. The human IL5RA or humanized IL5RA protein expressed in the non-human animal can maintain one or more functions of wild-type or human IL5RA protein, for example, the expressed IL5RA protein can bind to human or non-human IL5 protein. Further, in some embodiments, the genetically modified non-human animal does not express endogenous IL5RA protein. In some embodiments, the endogenous IL5RA protein of the genetically modified non-human animal is expressed at a reduced level compared to IL5RA in wild-type animals. As used herein, "endogenous IL5RA protein" refers to the IL5RA protein encoded by the nucleotide sequence of the endogenous IL5RA gene of the non-human animal (e.g., mouse) before genetic modification.

[0132] The genome of the non-human animal comprises a nucleotide sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequence of human IL5RA protein (NP_783853.1; SEQ ID NO: 21, positions 24-323 or SEQ ID NO: 21, positions 1-340). In some embodiments, the genome comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or at least 100% identical to the nucleotide sequence of SEQ ID NO: 24, 27, 44, 47, and / or 54.

[0133] The nucleotide sequence encoding the endogenous IL5RA region in the non-human animal genome is replaced with a nucleotide sequence encoding the corresponding region of human IL5RA. In some embodiments, the nucleotide sequence encoding the endogenous IL5RA region is any sequence of the endogenous IL5RA locus, such as exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, 5'UTR, 3'UTR, intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, intron 10, intron 11, intron 12, or any combination thereof. In some embodiments, the nucleotide sequence encoding the endogenous IL5RA region is located within the endogenous IL5RA regulatory region. In some embodiments, the nucleotide sequence encoding the endogenous IL5RA region is located in exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12 and / or exon 13 of the endogenous IL5RA gene, or a portion thereof.

[0134] One or more cells of the genetically modified non-human animal express a human or humanized IL5RA protein. In some embodiments, the human or humanized IL5RA protein comprises at least 1, 2, 3, 4, 5, 8, 10, 20, 30, 40, 60, 80, 110, 150, 190, 200, 230, 260, 280, 290, 300, 310, 320, 330, 340, 350, 380, 390, 400, 410, or 420 consecutive amino acids of the amino acid sequence of SEQ ID NO: 21.

[0135] In some embodiments, the genetically modified non-human animal genome comprises all or part of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, and / or exon 12 of the human IL5RA gene. In some embodiments, the genetically modified non-human animal genome comprises a portion of exon 3, all of exons 4-8, and a portion of exon 9 of the human IL5RA gene. In some embodiments, the portion of exon 3 of the human IL5RA gene comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 20, 30, 40, 50, 60, 70, 80, 81, 82, 83, 84, or 85 bp of contiguous nucleotide sequence. In some embodiments, the portion of exon 3 comprises 13 bp of contiguous nucleotide sequence. In some embodiments, the portion of exon 9 comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 92, 94, 95, 96, 97, 98, 99, 100, 114, 120, 130, 132, 134, 136, 137, 138, or 139 bp of contiguous nucleotide sequence. In some embodiments, the portion of exon 9 comprises 114 bp of contiguous nucleotide sequence. In some embodiments, the genetically modified non-human animal genome comprises a portion of exon 3, all of exons 4-9, and a portion of exon 10 of the human IL5RA gene. In some embodiments, the portion of exon 3 of the human IL5RA gene comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 81, 82, 83, 84, or 85 bp of continuous nucleotide sequence. In some embodiments, the portion of exon 3 comprises 82 bp of continuous nucleotide sequence. In some embodiments, the portion of exon 10 comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 21, 22, 23, 24, 25, 26, 30, 40, 50, 70, 90, 92, 93, 94, 95, 96, or 97 bp of continuous nucleotide sequence. In some embodiments, the portion of exon 10 comprises 26 bp of continuous nucleotide sequence.

[0136] In some embodiments, the nucleotide sequence encoding the corresponding region of human IL5RA is located at nucleotides 645-1544 or 576-1595 of the human IL5RA gene transcript NM_175726.4. In some embodiments, the non-human animal genome comprises a nucleotide sequence encoding all or part of the amino acid sequence of human IL5RA; in some embodiments, the non-human animal genome comprises all or part of the nucleotide sequence set forth in SEQ ID NO: 24 or 44.

[0137] In some embodiments, the genetically modified non-human animal genome comprises all of exons 1-3, a portion of exon 4, a portion of exon 10, and all of exons 11-13 of an endogenous IL5RA gene (e.g., mouse). In some embodiments, the portion of exon 4 comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 71, 72, 75, 80, 81, 82, 84, or 85 bp of contiguous nucleotide sequence. In some embodiments, the portion of exon 4 comprises 72 bp of contiguous nucleotide sequence. In some embodiments, the portion of exon 10 comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 21, 22, 23, 24, 25, 30, 50, 70, 90, 100, 110, 120, 130, 132, 134, 135, 136, 137, 138, or 139 bp of contiguous nucleotide sequence. In some embodiments, the portion of exon 10 comprises 25 bp of contiguous nucleotide sequence. In some embodiments, the genetically modified non-human animal genome comprises all of exons 1-4, a portion of exon 5, a portion of exon 11, all of exon 12, and a portion of exon 13 of an endogenous IL5RA gene (e.g., mouse). In some embodiments, the portion of exon 5 comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 61, 62, 65, 70, 80, 100, 120, 140, 142, 143, 144, 145, or 146 bp of continuous nucleotide sequence. In some embodiments, the portion of exon 5 comprises 62 bp of continuous nucleotide sequence. In some embodiments, the portion of exon 11 comprises 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 71, 75, 80, 85, 90, or 94 bp of continuous nucleotide sequence. In some embodiments, the portion of exon 11 comprises 71 bp of continuous nucleotide sequence. In some embodiments, the portion of exon 13 comprises 20, 50, 100, 150, 200, 250, 400, 444, 500, 1000, 1500, 1540, 1545, 1546, 1547, 1548, 1549, 2000, 2050, or 2091 bp of contiguous nucleotide sequence. In some embodiments, the portion of exon 11 comprises 444 bp of contiguous nucleotide sequence.

[0138] In some embodiments, the modified gene in the genome of the modified animal is homozygous or heterozygous for the endogenous replaced locus. In a specific embodiment, the modified IL5RA gene in the genome is heterozygous or homozygous for the endogenous replaced locus.

[0139] In some embodiments, the humanized IL5RA genome comprises a 5'UTR of the human IL5RA gene. In some embodiments, the humanized IL5RA genome comprises an endogenous (e.g., mouse) 5'UTR. In some embodiments, the humanized IL5RA genome comprises an endogenous (e.g., mouse) 3'UTR. Where appropriate, based on the similarity of the 5' flanking sequences, it is reasonable to infer that the mouse and human IL5RA genes are similarly regulated. As described herein, humanized IL5RA mice comprise a replacement of the endogenous mouse locus that retains the mouse endogenous regulatory elements but comprises the human IL5RA coding sequence. Expression of IL5RA in the genetically modified heterozygous or homozygous mice is completely normal.

[0140] In another aspect, the present invention provides a genetically modified non-human animal, the genome of which comprises a deletion of an endogenous IL5RA gene, wherein the deletion of the endogenous IL5RA gene comprises exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12 and / or exon 13, or a partial deletion thereof.

[0141] In some embodiments, the portion comprises a portion of exon 4, all of exons 5-9, and a portion of exon 10. In some embodiments, the portion of exon 4 comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 20, 30, 40, 50, 60, 70, 80, 81, 82, 83, 84, or 85 bp of continuous nucleotide sequence or more. In some embodiments, the portion of exon 4 comprises 13 bp of continuous nucleotide sequence. In some embodiments, the portion of exon 10 comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 111, 112, 113, 114, 120, 130, 132, 134, 135, 136, 137, 138, or 139 bp of continuous nucleotide sequence or more. In some embodiments, the portion of exon 10 comprises 114 bp of contiguous nucleotide sequence.

[0142] In some embodiments, the portion comprises a portion of exon 5 and all of exon 6. In some embodiments, the portion of exon 5 comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 81, 82, 83, 84, 90, 100, 110, 120, 130, 140, 141, 142, 143, 144, 145, or 146 bp of contiguous nucleotide sequence or more. In some embodiments, the portion of exon 5 comprises 84 bp of contiguous nucleotide sequence.

[0143] In some embodiments, the deletion of the endogenous IL5RA gene further comprises one or more of intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, intron 10, intron 11, and intron 12.

[0144] In some embodiments, the deletion comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 200, 210, 220, 221, 223, 250, 300, 350, 400, 500, 700, 800, 900, 1000, 1500, 2000, 2500, 3500, 3520, 3530, 3550, 3551, 3553, 3554, 3555, 3556, 3557, 5000, 10000, 11000 or 12000 bp of contiguous nucleotide sequence, or more.

[0145] The present invention provides a humanized mouse IL5RA genomic DNA sequence; provides a construct expressing the amino acid sequence of a humanized IL5RA protein; a cell comprising the construct; and a tissue comprising the cell. Therefore, in some embodiments, the present invention provides a humanized IL5RA nucleotide sequence and / or amino acid sequence, wherein in some embodiments, the humanized nucleotide sequence is homologous to mouse endogenous IL5RA mRNA (e.g., NM_008370.2), mouse IL5RA amino acid sequence (e.g., NP_032396.1, SEQ ID NO: 20) or a portion thereof (e.g., all of exons 1-3, a portion of exon 4, a portion of exon 10, and all of exons 11-13, or all of exons 1-4, a portion of exon 5, a portion of exon 11, all of exon 12, and a portion of exon 13) having a sequence identity of at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the humanized nucleotide sequence has at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a human IL5RA mRNA sequence (e.g., NM_175726.4), an IL5RA amino acid sequence (e.g., NP_783853.1, SEQ ID NO: 21), or a portion thereof (e.g., a portion of exon 3, all of exons 4-8, and a portion of exon 9, or a portion of exon 3, all of exons 4-9, and a portion of exon 10).

[0146] In some embodiments, the humanized nucleic acid sequence is operably linked to an endogenous promoter or regulatory element, such as a mouse IL5RA promoter, an inducible promoter, an enhancer, and / or a mouse regulatory element.

[0147] In some embodiments, at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., a contiguous or non-contiguous nucleotide sequence) of a humanized nucleic acid sequence described herein differs from all or a portion of a mouse IL5RA nucleotide sequence (e.g., a portion of exon 4, all of exons 4-9, and a portion of exon 10 of mouse IL5RA gene transcript NM_008370.2, or a portion of exon 5 and all of exon 6).

[0148] In some embodiments, at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., a contiguous or non-contiguous nucleotide sequence) of the chimeric nucleic acid sequence is identical to all or a portion of a mouse IL5RA nucleotide sequence (e.g., all of exons 1-3, a portion of exon 4, a portion of exon 10, and all of exons 11-13 of mouse IL5RA gene transcript NM_008370.2, or all of exons 1-4, a portion of exon 5, and all of exons 7-13).

[0149] In some embodiments, at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., a contiguous or non-contiguous nucleotide sequence) of the human IL5RA nucleotide sequence differs from all or a portion of a human IL5RA nucleotide sequence (e.g., all of exons 1-2, a portion of exon 3, a portion of exon 9, and all of exons 10-12 of the human IL5RA gene transcript NM_175726.4, or all of exons 1-2, a portion of exon 3, a portion of exon 10, and all of exons 11-12).

[0150] In some embodiments, at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., a contiguous or non-contiguous nucleotide sequence) of the humanized nucleic acid sequence is identical to all or part of a human IL5RA nucleotide sequence (e.g., part of exon 3, all of exons 4-8, and part of exon 9 of the human IL5RA gene transcript NM_175726.4, or part of exon 3, all of exons 4-9, and part of exon 10).

[0151] In some embodiments, the humanized nucleic acid sequence encodes at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) of the amino acid sequence that differs from all or a portion of the mouse IL5RA protein amino acid sequence (e.g., amino acids 21-320 and / or 46-119 of mouse IL5RA protein sequence NP_032396.1 (SEQ ID NO: 20)).

[0152] In some embodiments, at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) of the amino acid sequence encoded by the humanized nucleic acid sequence is identical to all or part of the amino acid sequence of the mouse IL5RA protein (e.g., amino acids 1-21, 321-415, or 337-415 of the mouse IL5RA protein sequence NP_032396.1 (SEQ ID NO: 20)).

[0153] In some embodiments, the humanized nucleic acid sequence encodes at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) of the amino acid sequence that differs from all or a portion of the amino acid sequence of a human IL5RA protein (e.g., amino acids 1-23, 324-420, or 341-420 of the human IL5RA protein sequence NP_783853.1 (SEQ ID NO: 21)).

[0154] In some embodiments, at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) of the amino acid sequence encoded by the humanized nucleic acid sequence is identical to all or part of the amino acid sequence of the human IL5RA protein (e.g., amino acids 24-323 or 1-340 of the human IL5RA protein sequence NP_783853.1 (SEQ ID NO: 21)).

[0155] The present invention also provides a humanized IL5RA mouse amino acid sequence, wherein the amino acid sequence comprises any one of the following groups:

[0156] A) the amino acid sequence shown in SEQ ID NO: 28 or 48;

[0157] B) at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99% identical to the amino acid sequence of SEQ ID NO: 28 or 48;

[0158] C) differs from the amino acid sequence of SEQ ID NO: 28 or 48 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 amino acid; or

[0159] D) an amino acid sequence as shown in SEQ ID NO: 28 or 48, comprising substitution, deletion and / or insertion of one or more amino acid residues.

[0160] The present invention also provides a humanized IL5RA amino acid sequence, wherein the amino acid sequence comprises any one of the following groups:

[0161] A) the amino acid sequence set forth in positions 24-343 of SEQ ID NO: 21 or positions 1-340 of SEQ ID NO: 2;

[0162] B) is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence set forth in positions 24-343 of SEQ ID NO:21 or positions 1-340 of SEQ ID NO:2;

[0163] C) differs from the amino acid sequence as set forth in positions 24-343 of SEQ ID NO: 21 or positions 1-340 of SEQ ID NO: 2 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 amino acid; or

[0164] D) an amino acid sequence comprising substitutions, deletions and / or insertions of one or more amino acid residues compared to those shown in SEQ ID NO: 21, positions 24-343 or SEQ ID NO: 2, positions 1-340.

[0165] The present invention also provides a humanized IL5RA amino acid sequence, wherein the amino acid sequence comprises any one of the following groups:

[0166] A) the amino acid sequence set forth in positions 1-20, 321-415, or 337-415 of SEQ ID NO: 20;

[0167] B) at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence set forth in positions 1-20, 321-415 or 337-415 of SEQ ID NO: 20;

[0168] C) differs from the amino acid sequence of SEQ ID NO: 20 at positions 1-20, 321-415, or 337-415 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 amino acid; or

[0169] D) an amino acid sequence comprising substitutions, deletions and / or insertions of one or more amino acid residues as shown in positions 1-20, 321-415 or 337-415 of SEQ ID NO: 20.

[0170] The present invention also provides a humanized IL5RA nucleotide (eg, DNA or RNA) sequence, wherein the nucleotide sequence comprises any one of the following groups:

[0171] A) a nucleic acid sequence as set forth in SEQ ID NO: 22, 23, 24, 25, 26, 27, 40, 41, 42, 43, 44, 45, 46, 47, 49, 50, or 54, or a nucleic acid sequence encoding a humanized mouse IL5RA homologous amino acid sequence;

[0172] B) a nucleic acid sequence capable of hybridizing to the nucleotide sequence of SEQ ID NO: 22, 23, 24, 25, 26, 27, 40, 41, 42, 43, 44, 45, 46, 47, 49, 50 or 54 under low stringency conditions or stringent conditions;

[0173] C) a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% homology to the nucleotide sequence of SEQ ID NO: 22, 23, 24, 25, 26, 27, 40, 41, 42, 43, 44, 45, 46, 47, 49, 50 or 54;

[0174] D) the amino acid sequence encoded by it is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence set forth in SEQ ID NO:21 at positions 24-343, SEQ ID NO:21 at positions 1-340, SEQ ID NO:20 at positions 1-20, 321-415 or 337-415;

[0175] E) the amino acid sequence encoded by the amino acid sequence differs by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 amino acid from the amino acid sequence set forth in SEQ ID NO:21 at positions 24-343, SEQ ID NO:21 at positions 1-340, SEQ ID NO:20 at positions 1-20, 321-415, or 337-415; or

[0176] F) The amino acid sequence encoded by the amino acid sequence is the same as that shown in SEQ ID NO: 21 positions 24-343, SEQ ID NO: 21 positions 1-340, SEQ ID NO: 20 positions 1-20, 321-415 or 337-415, including the amino acid sequence with substitution, deletion and / or insertion of one or more amino acid residues.

[0177] The present invention further provides a humanized mouse IL5RA genomic DNA sequence, which is obtained by reverse transcription of the mRNA transcribed from the humanized mouse IL5RA and is identical to or complementary to a DNA sequence homologous to the sequence shown in SEQ ID NO: 24, 27, 44, 47, or 54.

[0178] In order to determine the percent identity of two amino acid sequences or two nucleotide sequences, for the best comparison purpose, the sequence is compared (for example, for best comparison, a gap can be introduced in one or both of the first and second amino acid or nucleotide sequences, and non-homologous sequences can be ignored for the purpose of comparison). The amino acid residues or nucleotides on the corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the amino acid residue or nucleotide identical to the corresponding position in the second sequence, the molecule is identical at that position. The percent identity between the two sequences is a function of the quantity of the same positions shared by the sequences, which, considering the number of gaps and the length of each gap, needs to be introduced to realize the best comparison of the two sequences. For example, the comparison of the sequence and the determination of the percent identity between the two sequences can be completed using the Blossum 62 scoring matrix of gap penalty 12, gap extension penalty 4 and frameshift gap penalty 5.

[0179] The percentage ratio (homology percentage) of conserved residues with similar physicochemical properties, such as leucine and isoleucine, can also be used to measure sequence similarity. Families of amino acid residues with similar physicochemical properties have been defined in the art. These families include amino acids with basic side chains (such as lysine, arginine, histidine), acidic side chains (such as aspartic acid, glutamic acid), uncharged polar side chains (such as glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), non-polar side chains (such as alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), β-branched side chains (such as threonine, valine and isoleucine) and aromatic side chains (such as tyrosine, phenylalanine, tryptophan, histidine). In many cases, the homology percentage ratio is higher than the identity percentage ratio.

[0180] The invention also provides cells, tissues, and animals (eg, mice) comprising the nucleotide sequences described herein, as well as cells, tissues, and animals (eg, mice) that express human or chimeric (eg, humanized) IL5RA at an endogenous non-human IL5RA locus.

[0181] Genetically modified non-human animals

[0182] The "genetically modified non-human animal" described in the present invention refers to a non-human animal in which at least one chromosome in the genome of the animal has exogenous DNA. In some embodiments, at least one or more cells, for example, at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50% of the cells in the genetically modified non-human animal have exogenous DNA. The cells with exogenous DNA can be various cells, for example, endogenous cells, somatic cells, immune cells, T cells, B cells, NK cells, antigen presenting cells, macrophages, dendritic cells, germ cells, blastocysts or endogenous tumor cells. In some embodiments, a genetically modified non-human animal is provided, which comprises an endogenous IL5 and / or IL5RA locus and an exogenous IL5 and / or IL5RA locus (e.g., a human sequence), for example, replacing one or more non-human sequences with one or more human sequences, or inserting one or more human and / or non-human sequences. Animals are generally able to pass genetic modifications to offspring through germline transmission.

[0183] The "chimeric gene" or "chimeric nucleic acid" of the present invention refers to a gene or nucleic acid, wherein two or more parts of the gene or nucleic acid are from different species, or at least one sequence of the gene or nucleic acid is different from the wild-type nucleic acid in the animal. In some embodiments, the chimeric gene or chimeric nucleic acid has at least a portion of the sequence derived from two or more different species, for example, sequences encoding different proteins or sequences encoding the same (or homologous) proteins of two or more different species. In some embodiments, the chimeric gene or chimeric nucleic acid refers to a humanized gene or humanized nucleic acid.

[0184] As used herein, a "chimeric protein" or "chimeric polypeptide" refers to a protein or polypeptide in which two or more portions of the polypeptide or protein are derived from different species, or at least one sequence of the protein or polypeptide differs from the wild-type amino acid sequence in an animal. In some embodiments, at least a portion of the sequence of a chimeric protein or chimeric polypeptide is derived from two or more different species, for example, the same (or homologous) proteins from different species. In some embodiments, a chimeric protein or chimeric polypeptide is a humanized protein or polypeptide.

[0185] The "humanized protein" or "humanized polypeptide" of the present invention refers to a protein or polypeptide, wherein at least a portion of the protein or polypeptide is derived from a human protein or polypeptide. In some embodiments, the humanized protein or polypeptide refers to a human protein or polypeptide.

[0186] As used herein, a "humanized nucleic acid" refers to a nucleic acid wherein at least a portion of the nucleic acid is derived from human nucleic acid. In some embodiments, the nucleic acid in the humanized nucleic acid is entirely human in origin. In some embodiments, the humanized nucleic acid refers to humanized exons, which can be human exons or chimeric exons.

[0187] Animals with a humanized IL5 locus

[0188] In some embodiments, the chimeric gene or nucleic acid is a humanized IL5 gene or a humanized IL5RA nucleic acid. In some embodiments, at least a portion of the gene or nucleic acid is derived from a human IL5 gene, and at least a portion of the gene or nucleic acid is derived from a non-human IL5 gene. In some embodiments, the gene or nucleic acid comprises a sequence encoding an IL5 protein. The encoded IL5 protein has at least one activity of a human IL5 protein or a non-human animal IL5 protein.

[0189] In some embodiments, the chimeric protein or polypeptide is a humanized IL5 protein or polypeptide. In some embodiments, at least one or more portions of the amino acid sequence of the protein or polypeptide are derived from a human IL5 protein, and at least one or more portions of the amino acid sequence of the protein or polypeptide are derived from a non-human animal IL5 protein. The humanized IL5 protein or polypeptide is functional or possesses at least one activity of a human IL5 protein or a non-human animal IL5 protein.

[0190] In some embodiments, the humanized IL5 protein comprises a polypeptide sequence of 1-134 amino acids (continuous or non-continuous) identical to a human IL5 protein. In some embodiments, the polypeptide sequence is 1-134 amino acids in length.

[0191] Genetically modified non-human animals include modifications of endogenous non-human animal IL5 gene sites. In some embodiments, the modification comprises a nucleotide sequence encoding at least a portion of a mature IL5 protein (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% identity to a mature IL5 protein amino acid sequence). Although cells (e.g., ES cells, somatic cells) that may comprise the genetic modifications described herein are provided herein, in many embodiments, the genetically modified non-human animals include modifications of endogenous IL5 gene sites in the animal.

[0192] Genetically modified animals can express human IL5 and / or chimeric (e.g., humanized) IL5 at the endogenous mouse locus, wherein the endogenous mouse IL5 gene has been replaced or inserted with a human IL5 gene and / or a nucleotide sequence encoding a human IL5 sequence region or an amino acid sequence that is at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97% or 100% identical to the human IL5 sequence. In various embodiments, the endogenous non-human animal IL5 locus is modified by comprising all or part of a human nucleic acid sequence encoding a mature IL5 protein.

[0193] In certain embodiments, genetically modified mice can express human IL5 and / or chimeric IL5 (for example, humanized IL5) under the control of mouse promoter and / or mouse regulatory elements. A kind of in cell expression human IL5 or chimeric IL5 (for example, humanized IL5) albumen is provided through insertion or replacement at mouse endogenous locus, and the non-human animal of potential pathology observed in some other transgenic mice known in the art is not produced. Human IL5 or chimeric IL5 (for example, humanized IL5) expressed in animal can maintain one or more functions of wild-type mouse or human IL5 in animal. In addition, in certain embodiments, animal does not express endogenous IL5. In certain embodiments, compared with the IL5 expression level in wild-type animal, animal endogenous IL5 expression level reduces. As used in the present invention, term " endogenous IL5 " refers to the IL5 protein expressed by the endogenous IL5 nucleotide sequence of non-human animal (for example mouse) before any genetic modification.

[0194] The genome of the animal comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to the amino acid sequence of human IL5 (NP_000870.1; SEQ ID NO: 2). In some embodiments, the genome comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ ID NOs: 3, 4, 5, 6, 7, and 8. In some embodiments, the genome comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to positions 45-449 of NM_000879.3.

[0195] The genome of the genetically modified animal can include a sequence that replaces the sequence encoding the endogenous IL5 region with a sequence encoding the corresponding region of human IL5 at the endogenous IL5 locus. In certain embodiments, the replaced sequence is any sequence of the endogenous IL5 locus, such as exon 1, exon 2, exon 3, exon 4, 5'UTR, 3'UTR, intron 1, intron 2, intron 3, or any combination thereof. In certain embodiments, the replaced sequence is within the regulatory region of the endogenous IL5 gene. In certain embodiments, the replaced sequence is a portion of exon 1, all of exons 2-3, and a portion of exon 4 of the endogenous mouse IL5 locus.

[0196] One or more cells of the genetically modified non-human animal express a human or humanized IL5 protein. In some embodiments, the human or humanized IL5 protein comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 131, 132, 133, or 134 consecutive amino acids of the amino acid sequence of SEQ ID NO: 2.

[0197] In some embodiments, the genome of the genetically modified non-human animal comprises all or part of exon 1, exon 2, exon 3, and / or exon 4 of the human IL5 gene. In some embodiments, the genome of the genetically modified non-human animal comprises part of exon 1, all of exons 2-3, and part of exon 4 of the human IL5 gene. In some embodiments, the portion of exon 1 of the human IL5 gene comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 140, 141, 142, 143, 144, 150, 160, 170, 180, 182, 184, 185, 186, 187, or 188 bp of continuous nucleotide sequence. In some embodiments, the portion of exon 1 comprises 144 bp of continuous nucleotide sequence. In some embodiments, the portion of exon 4 comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 92, 94, 95, 96, 97, 98, 99, 100, 120, 140, or 465 bp of continuous nucleotide sequence. In some embodiments, the portion of exon 1 comprises 99 bp of continuous nucleotide sequence. In some embodiments, the nucleotide sequence encoding the corresponding region of human IL5 is located at nucleotides 45-449 of human IL5 gene transcript NM_000879.3.

[0198] In some embodiments, the non-human animal genome comprises a nucleotide sequence encoding all or part of the amino acid sequence of human IL5; in some embodiments, the non-human animal genome comprises all or part of the nucleotide sequence shown in SEQ ID NO:5.

[0199] In some embodiments, the genetically modified non-human animal genome comprises a portion of exon 1 and a portion of exon 4 of an endogenous IL5 gene (e.g., mouse). In some embodiments, the portion of exon 1 comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 41, 42, 43, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 181, 182, 183, or 184 bp of continuous nucleotide sequence. In some embodiments, the portion of exon 1 comprises 43 bp of continuous nucleotide sequence. In some embodiments, the portion of exon 4 comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 400, 600, 700, 800, 900, 1000, 1020, 1040, 1060, 1070, 1080, 1082, 1084, 1085, 1086, 1087, 1088, 1089, 1090, 1100, 1120, 1140, 1160, 1180, 1182, 1184, 1186, 1187, or 1188 bp of contiguous nucleotide sequence. In some embodiments, the portion of exon 4 comprises 1089 bp of contiguous nucleotide sequence.

[0200] In some embodiments, the modified gene in the modified animal genome is homozygous or heterozygous for the endogenous replaced locus. In a specific embodiment, the modified IL5 gene in the genome is heterozygous or homozygous for the endogenous replaced locus.

[0201] In another aspect, the present invention provides a genetically modified non-human animal, wherein the genome of the non-human animal comprises a deletion of an endogenous IL5 gene, wherein the deletion of the endogenous IL5 gene comprises exon 1, exon 2, exon 3, and / or exon 4, or a partial deletion thereof. In some embodiments, the portion comprises a portion of exon 1, all of exons 2-3, and a portion of exon 4.

[0202] In some embodiments, the portion of exon 1 comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 21, 22, 25, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 141, 150, 160, 170, 180, 181, 182, 183 or 184 bp of continuous nucleotide sequence or more. In some embodiments, the portion of exon 4 comprises 141 bp of continuous nucleotide sequence. In some embodiments, the portion of exon 4 comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 21, 22, 25, 30, 40, 50, 60, 70, 80, 90, 92, 94, 96, 98, 99, 110, 150, 200, 300, 500, 800, 1000, 1100, 1120, 1140, 1160, 1180, 1182, 1184, 1186, 1187, or 1188 bp of contiguous nucleotide sequence or more. In some embodiments, the portion of exon 8 comprises 99 bp of contiguous nucleotide sequence.

[0203] In some embodiments, the deletion of the endogenous IL5 gene further includes one or more introns among intron 1, intron 2, and intron 3.

[0204] In some embodiments, the deletion comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 200, 250, 300, 350, 400, 401, 402, 450, 500, 800, 1000, 1200, 1400, 1500, 1520, 1530, 1531, 1532, 1533, 1534, 2000, 3000, or 3178 bp of contiguous nucleotide sequence, or more.

[0205] Animals with a humanized IL5RA locus

[0206] In some embodiments, the chimeric gene or nucleic acid is a humanized IL5RA gene or nucleic acid. In some embodiments, at least a portion of the gene or nucleic acid is derived from a human IL5RA gene, and at least a portion of the gene or nucleic acid is derived from a non-human IL5RA gene. In some embodiments, the gene or nucleic acid comprises a sequence encoding an IL5RA protein. The encoded IL5RA protein has at least one activity of a human IL5RA protein or a non-human animal IL5RA protein.

[0207] In some embodiments, the chimeric protein or polypeptide is a humanized IL5RA protein or polypeptide. In some embodiments, at least one or more portions of the amino acid sequence of the protein or polypeptide are derived from a human IL5RA protein, and at least one or more portions of the amino acid sequence of the protein or polypeptide are derived from a non-human IL5RA protein. The humanized IL5RA protein or polypeptide is functional or has at least one activity of a human IL5RA protein or a non-human IL5RA protein.

[0208] In some embodiments, the humanized IL5RA protein comprises a polypeptide sequence of 1-420 amino acids (contiguous or non-contiguous) identical to a human IL5RA protein. In some embodiments, the polypeptide sequence is 1-340 or 24-323 contiguous amino acids in length.

[0209] Genetically modified non-human animals include modifications to an endogenous non-human animal IL5RA gene locus. In some embodiments, the modifications comprise a nucleotide sequence encoding at least a portion of a mature IL5RA protein (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99% identity to the amino acid sequence of a mature IL5RA protein). While cells (e.g., ES cells, somatic cells) that may include the genetic modifications described herein are provided herein, in many embodiments, the genetically modified non-human animal includes modifications to an endogenous IL5RA gene locus in the animal.

[0210] The genetically modified animal can express human IL5RA and / or chimeric (e.g., humanized) IL5RA protein at an endogenous mouse locus, wherein the endogenous mouse IL5RA gene is replaced or inserted with a human or chimeric IL5RA gene and / or a nucleotide sequence encoding a corresponding region of human or chimeric IL5RA that is at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, or 100% identical to the human IL5RA sequence. In various embodiments, the endogenous non-human animal IL5 locus is modified with a nucleotide sequence comprising all or part of a human nucleic acid sequence encoding a mature IL5RA protein. In some embodiments, the nucleotide sequence encoding the corresponding region of human or chimeric IL5RA comprises, from 5' to 3', the following: 1) a first sequence encoding all or part of the human IL5RA signal peptide and extracellular region; and 2) a second sequence encoding all or part of the extracellular, transmembrane, and cytoplasmic regions of the murine IL5RA protein. In some embodiments, the amino acids encoded by the first sequence are at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 100% identical to the amino acid sequence as set forth in positions 1-340 of SEQ ID NO: 21. In some embodiments, the amino acids encoded by the second sequence are at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 100% identical to the amino acid sequence as set forth in positions 337-415 of SEQ ID NO: 20.

[0211] In some embodiments, the genetically modified mouse can express human IL5RA and / or chimeric IL5RA (e.g., humanized IL5RA) under the control of a mouse promoter and / or mouse regulatory elements. Insertion or replacement at the mouse endogenous locus provides a non-human animal that expresses human IL5RA or chimeric IL5RA (e.g., humanized IL5RA) protein in cells and does not produce the potential pathology observed in some other transgenic mice known in the art. The human IL5RA or chimeric IL5RA (e.g., humanized IL5RA) expressed in the animal can maintain one or more functions of wild-type mouse or human IL5RA in the animal. In addition, in some embodiments, the animal does not express endogenous IL5RA protein. In some embodiments, the animal's endogenous IL5RA expression level is reduced compared to the IL5RA expression level in the wild-type animal. As used herein, the term "endogenous IL5RA" refers to the IL5RA protein expressed by the endogenous IL5RA nucleotide sequence of the non-human animal (e.g., mouse) before any genetic modification.

[0212] The genome of the animal comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% identical to the amino acid sequence of human IL5RA (NP_783853.1; SEQ ID NO: 21). In some embodiments, the genome comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% identical to SEQ ID NO: 22, 23, 24, 25, 26, 27, 40, 41, 42, 43, 44, 45, 46, 47, 49, 50 or 54. In some embodiments, the genome comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% identical to positions 645-1544 or positions 576-1595 of NM_175726.4.

[0213] The genome of the genetically modified animal can include a replacement of a sequence encoding a region of the endogenous IL5RA locus with a sequence encoding a corresponding region of human or chimeric IL5RA. In some embodiments, the replaced sequence is any sequence of the endogenous IL5RA locus, such as exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, 5'UTR, 3'UTR, intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, intron 10, intron 11, intron 12, or any combination thereof. In some embodiments, the replaced sequence is within the regulatory region of the endogenous IL5RA gene. In some embodiments, the replaced sequence is a portion of exon 4, all of exons 5-9, and a portion of exon 10 of the endogenous mouse IL5RA locus. In some embodiments, the replaced sequence is a portion of exon 5 and a portion of exon 6 of the endogenous mouse IL5RA locus.

[0214] One or more cells of the genetically modified non-human animal express a human or humanized IL5RA protein. In some embodiments, the human or humanized IL5RA protein comprises at least 1, 2, 3, 4, 5, 8, 10, 20, 30, 40, 60, 80, 110, 150, 190, 200, 230, 260, 280, 290, 300, 310, 320, 330, 340, 350, 380, 390, 400, 410, or 420 consecutive amino acids of the amino acid sequence of SEQ ID NO: 21.

[0215] The genetically modified animal can have one or more cells expressing human or chimeric IL5RA (e.g., humanized IL5RA), wherein the cells have a signal peptide, an extracellular region, a transmembrane region, and a cytoplasmic region from the N-terminus to the C-terminus. In some embodiments, the cells comprise, from the N-terminus to the C-terminus, all or part of the signal peptide and extracellular region of the human IL5RA protein, and all or part of the extracellular region, transmembrane region, and cytoplasmic region of the mouse IL5RA protein. In some embodiments, the signal peptide comprises all or part of the signal peptide of the human IL5RA protein. In some embodiments, the portion of the human IL5RA protein signal peptide comprises at least 10 consecutive amino acids, for example, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 19, or 20 consecutive amino acids, and the human IL5RA protein signal peptide comprises at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 100% identity to the amino acid sequence of positions 1-20 of SEQ ID NO: 21. In some embodiments, the signal peptide comprises all or part of a mouse IL5RA protein signal peptide, further comprising at least 10 consecutive amino acids, for example, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, or 17 consecutive amino acids, and the mouse IL5RA protein signal peptide comprises at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 100% identity to the amino acid sequence of positions 1-17 of SEQ ID NO: 20.

[0216] In some embodiments, the extracellular region comprises all or part of the extracellular region of a human IL5RA protein. Further, the portion of the extracellular region of a human IL5RA protein comprises at least 50 consecutive amino acids, for example, at least 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 310, 320, 321 or 322 consecutive amino acids, and the extracellular region of a human IL5RA protein comprises at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98% or 100% identity to the amino acid sequence of positions 24-323 or 21-340 of SEQ ID NO: 21. In some embodiments, the extracellular region comprises all or part of the extracellular region of mouse IL5RA protein, further, the portion of the extracellular region of mouse IL5RA protein comprises at least 1, 2, 3, 4, 5, 8, 10, 12, 14, 16, 17, 18, 19, 20, 21, 22, 23, 25, 26, 27, 28, 29, 30, 31, 35, 40, 60, 80, 110, 150, 190, 200, 230, 260, 280, 290, 300, 310, 320, 321 or 322 consecutive amino acids, and the mouse IL5RA extracellular region comprises the residues corresponding to SEQ ID The amino acid sequence identity of NO:20 at positions 18-20, 321-339, 18-45, and / or 337-339 is at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98% or 100%.

[0217] In some embodiments, the transmembrane region comprises all or part of the transmembrane region of the mouse IL5RA protein. Further, the portion of the transmembrane region of the mouse IL5RA protein comprises at least 10 consecutive amino acids, for example, at least 1, 2, 3, 4, 4, 5, 6, 8, 10, 12, 14, 16, 18, 20, 21 or 22 consecutive amino acids, and the transmembrane region of the mouse IL5RA protein comprises at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98% or 100% identity to the amino acid sequence shown in positions 340-361 of SEQ ID NO: 20.

[0218] In some embodiments, the cytoplasmic region comprises all or part of the cytoplasmic region of the mouse IL5RA protein, further, the portion of the cytoplasmic region of the mouse IL5RA protein comprises at least 20 consecutive amino acids, for example, at least 10, 12, 15, 17, 18, 20, 22, 24, 26, 28, 32, 36, 40, 44, 48, 50, 51, 52, 53 or 54 consecutive amino acids, and the cytoplasmic region of the mouse IL5RA protein comprises at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98% or 100% identity to the amino acid sequence as shown in positions 362-415 of SEQ ID NO: 20.

[0219] In some embodiments, the genetically modified non-human animal genome comprises all or part of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, and / or exon 12 of the human IL5RA gene. In some embodiments, the genetically modified non-human animal genome comprises a portion of exon 3, all of exons 4-8, and a portion of exon 9 of the human IL5RA gene. In some embodiments, the portion of exon 3 of the human IL5RA gene comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 20, 30, 40, 50, 60, 70, 80, 81, 82, 83, 84, or 85 bp of contiguous nucleotide sequence. In some embodiments, the portion of exon 3 comprises 13 bp of contiguous nucleotide sequence. In some embodiments, the portion of exon 9 comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 92, 94, 95, 96, 97, 98, 99, 100, 114, 120, 130, 132, 134, 136, 137, 138, or 139 bp of contiguous nucleotide sequence. In some embodiments, the portion of exon 9 comprises 114 bp of contiguous nucleotide sequence. In some embodiments, the genetically modified non-human animal genome comprises a portion of exon 3, all of exons 4-9, and a portion of exon 10 of the human IL5RA gene. In some embodiments, the portion of exon 3 of the human IL5RA gene comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 81, 82, 83, 84, or 85 bp of continuous nucleotide sequence. In some embodiments, the portion of exon 3 comprises 82 bp of continuous nucleotide sequence. In some embodiments, the portion of exon 10 comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 21, 22, 23, 24, 25, 26, 30, 40, 50, 70, 90, 92, 93, 94, 95, 96, or 97 bp of continuous nucleotide sequence. In some embodiments, the portion of exon 10 comprises 26 bp of continuous nucleotide sequence.

[0220] In some embodiments, the nucleotide sequence encoding the corresponding region of human IL5RA is located at nucleotides 645-1544 or 576-1595 of the human IL5RA gene transcript NM_175726.4. In some embodiments, the non-human animal genome comprises a nucleotide sequence encoding all or part of the amino acid sequence of human IL5RA; in some embodiments, the non-human animal genome comprises all or part of the nucleotide sequence set forth in SEQ ID NO: 24 or 44.

[0221] In some embodiments, the genetically modified non-human animal genome comprises all of exons 1-3, a portion of exon 4, a portion of exon 10, and all of exons 11-13 of an endogenous IL5RA gene (e.g., mouse). In some embodiments, the portion of exon 4 comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 71, 72, 75, 80, 81, 82, 84, or 85 bp of contiguous nucleotide sequence. In some embodiments, the portion of exon 4 comprises 72 bp of contiguous nucleotide sequence. In some embodiments, the portion of exon 10 comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 21, 22, 23, 24, 25, 30, 50, 70, 90, 100, 110, 120, 130, 132, 134, 135, 136, 137, 138, or 139 bp of contiguous nucleotide sequence. In some embodiments, the portion of exon 10 comprises 25 bp of contiguous nucleotide sequence.

[0222] In some embodiments, the genetically modified non-human animal comprises all of exons 1-4, a portion of exon 5, and all of exons 7-13 of an endogenous IL5RA gene (e.g., mouse). In some embodiments, the portion of exon 5 comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 61, 62, 65, 70, 80, 100, 120, 140, 142, 143, 144, 145, or 146 bp of contiguous nucleotide sequence.

[0223] In some embodiments, the modified gene in the genome of the modified animal is homozygous or heterozygous for the endogenous replaced locus. In a specific embodiment, the modified IL5RA gene in the genome is heterozygous or homozygous for the endogenous replaced locus.

[0224] In some embodiments, the humanized IL5RA genome comprises a 5'UTR of the human IL5RA gene. In some embodiments, the humanized IL5RA genome comprises an endogenous (e.g., mouse) 5'UTR. In some embodiments, the humanized IL5RA genome comprises an endogenous (e.g., mouse) 3'UTR. Where appropriate, based on the similarity of the 5' flanking sequences, it is reasonable to infer that the mouse and human IL5RA genes are similarly regulated. As described herein, humanized IL5RA mice comprise a replacement of the endogenous mouse locus that retains the mouse endogenous regulatory elements but comprises the human IL5RA coding sequence. Expression of IL5RA in the genetically modified heterozygous or homozygous mice is completely normal.

[0225] In another aspect, the present invention provides a genetically modified non-human animal, the genome of which comprises a deletion of an endogenous IL5RA gene, wherein the deletion of the endogenous IL5RA gene comprises exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12 and / or exon 13, or a partial deletion thereof.

[0226] In some embodiments, the portion comprises a portion of exon 4, all of exons 5-9, and a portion of exon 10. In some embodiments, the portion of exon 4 comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 20, 30, 40, 50, 60, 70, 80, 81, 82, 83, 84, or 85 bp of continuous nucleotide sequence or more. In some embodiments, the portion of exon 4 comprises 13 bp of continuous nucleotide sequence. In some embodiments, the portion of exon 10 comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 111, 112, 113, 114, 120, 130, 132, 134, 135, 136, 137, 138, or 139 bp of continuous nucleotide sequence or more. In some embodiments, the portion of exon 10 comprises 114 bp of contiguous nucleotide sequence.

[0227] In some embodiments, the portion comprises a portion of exon 5 and all of exon 6. In some embodiments, the portion of exon 5 comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 81, 82, 83, 84, 90, 100, 110, 120, 130, 140, 141, 142, 143, 144, 145, or 146 bp of contiguous nucleotide sequence or more. In some embodiments, the portion of exon 5 comprises 84 bp of contiguous nucleotide sequence.

[0228] In some embodiments, the deletion of the endogenous IL5RA gene further comprises one or more of intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, intron 10, intron 11, and intron 12.

[0229] In some embodiments, the deletion comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 200, 250, 300, 350, 400, 500, 700, 800, 820, 840, 860, 870, 871, 872, 873, 900, 1000, 1500, 2000, 2500, 3500, 3520, 3530, 3550, 3551, 3553, 3554, 3555, 3556, 3557, 5000, 10000, 11000 or 12000 bp of contiguous nucleotide sequence or more.

[0230] The non-human animal of genetic modification can be various animals, for example, mouse, rat, rabbit, pig, cattle (for example, cattle, bull, buffalo), deer, sheep, goat, chicken, cat, dog, ferret, primate (for example, marmoset, rhesus monkey).For the non-human animal of suitable genetically modified embryonic stem cell (ES) that is not easy to obtain, adopt alternative methods to construct the non-human animal comprising genetic modification.Such method includes, for example, modifying non-ES cell genome (for example, fibroblast or induced pluripotent stem cell) and adopting nuclear transplantation to transfer the modified genome to suitable cell, for example oocyte, and incubating the modified cell (for example, modified oocyte) to form embryo in non-human animal under appropriate conditions.Above-mentioned construction method is known in the art, and is described in " A.Nagy, et al., " Manipulating the Mouse Embryo:A Laboratory Manual (Third Edition), " Cold Spring Harbor Laboratory Press, 2003 ", its entire contents are incorporated herein by reference.

[0231] In one aspect, the animal is a mammal. In some embodiments, the genetically modified non-human animal is a rodent. The rodent can be selected from a mouse, a rat, and a hamster. In one embodiment, the rodent is selected from the family Muridae. In one embodiment, the genetically modified animal is selected from the families Cricetidae (e.g., mouse-like hamsters), Cricetidae (e.g., hamsters, New World rats and mice, voles), Muroidea (true mice and rats, gerbils, spiny mice, crested rats), Malinomys (climbing mice, rock mice, tailed rats, Madagascar rats, and mice), Spiny Mouse (e.g., spiny dormouse), and Murid (e.g., mole rats, bamboo rats, and zokors). In a specific embodiment, the genetically modified rodent is selected from true mice or rats (Muroidea), gerbils, spiny mice, and crested rats. In one embodiment, the genetically modified mouse is from a member of the Muridae family. In one embodiment, the animal is a rodent. In a specific embodiment, the rodent is selected from mice and rats. In one embodiment, the non-human animal is a mouse.

[0232] In some embodiments, the animal is a mouse of the C57BL strain selected from the group consisting of C57BL / a, C57BL / An, C57BL / GrFa, C57BL / KaLwN, C57BL / min, C57BL6J, C57Bl / 6ByJ, C57BL / 6NJ, C57BL / 10, C57BL10SnSn, C57BL / 10Cr, and C57BL / Ola. In some embodiments, the mouse is a 129 strain selected from 129P1, 129P2, 129P3, 129X1, 129S1 (e.g., 129S1 / SV, 129S1 / SvIm), 129S2, 129S4, 129S5, 129S9 / SvEvH, 129S6 (129 / SvEvTac), 129S7, 129S8, 129T1, 129T2. These mice are described, for example, in Festing et al., Revised nomenclature for strain 129 mice, Mammalian Genome 10:836 (1999); Auerbach et al., Establishment and Chimera Analysis of 129 / SvEv- and C57BL / 6-Derived Mouse Embryonic Stem Cell Lines (2000), the relevant contents of which are incorporated herein by reference in their entirety. In some embodiments, the genetically modified mouse is a hybrid of 129 strains and C57BL / 6 strains. In some embodiments, the mouse is a hybrid of 129 strains, or a hybrid of BL / 6 strains. In some embodiments, the mouse is a BALB strain, such as a BALB / c strain. In some embodiments, the mouse is a hybrid of a BALB strain and another strain. In some embodiments, the mouse is from a hybrid system (e.g., 50% BALB / c-50% 12954 / Sv; or 50% C57BL / 6-50% 129). In some embodiments, the non-human animal is a rodent. In some embodiments, the non-human animal is a mouse having a BALB / c, a, a / He, a / J, a / WySN, AKR, AKR / a, AKR / J, AKR / N, TA1, TA2, RF, SWR, C3H, C57BR, SJL, C57L, DBA / 2, KM, NIH, ICR, CFW, FACA, C57BL / a, C57BL / An, C57BL / GrFa, C57BL / KaLwN, C57BL6, C57L / 6J, C57BL / 6ByJ, or C5C57BL / 6NJ.Mice of C57BL / 10, C57BL / 10ScSn, C57BL (C57BL / 10Cr and C57BL / Ola), C58, CBA / Br, CBA / Ca, CBA / J, CBA / st, or CBA / H strains, and mice on the NOD, NOD / SCID, or NOD-Prkdcscid IL-2rgnull background.

[0233] Genetically modified non-human animals include modifications to endogenous non-human IL5 and / or IL5RA gene loci. In some embodiments, the modifications comprise a nucleotide sequence encoding at least a portion of a mature IL5 and / or IL5RA protein (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a mature IL5 and / or IL5RA protein amino acid sequence). While cells (e.g., ES cells, somatic cells) that may include the genetic modifications described herein are provided herein, in many embodiments, the genetically modified non-human animals include modifications to endogenous IL5 and / or IL5RA gene loci in the animal.

[0234] The present invention further provides a non-human mammal constructed using the above method. In some embodiments, the non-human mammal comprises a human genome. In some embodiments, the non-human mammal is a rodent, and more preferably, the rodent is a mouse. In some embodiments, the non-human mammal expresses a protein encoded by a humanized IL5 and / or IL5RA gene.

[0235] In addition, the present invention also provides a non-human mammal carrying a tumor, wherein the non-human mammal model is obtained by the method described herein. In some embodiments, the non-human mammal is a rodent (eg, mouse).

[0236] The present invention also provides a cell or cell line derived from a non-human mammal or its progeny, or a non-human mammal carrying a tumor, or a primary cell culture derived from a non-human mammal or its progeny, or a non-human mammal carrying a tumor, or a tissue, organ, or culture thereof derived from a non-human mammal or its progeny, or, in the case of a tumor, from a tumor tissue of a non-human mammal or its progeny, or a non-human mammal carrying a tumor.

[0237] The present invention provides a non-human mammal produced by any of the methods described herein. In some embodiments, a non-human mammal or a genetically modified non-human animal is provided, wherein the genome of the genetically modified non-human animal comprises DNA of human or humanized IL5 and / or IL5RA.

[0238] In some embodiments, a non-human mammal comprises a genetic construct described herein (e.g., a genetic construct as shown in Figures 3, 9, 13, and 14). In some embodiments, a non-human mammal expressing a human or humanized IL5 and / or IL5RA protein is provided. In some embodiments, tissue-specific expression of a human or humanized IL5 and / or IL5RA protein is provided.

[0239] In some embodiments, the expression of human or humanized IL5 and / or IL5RA protein in non-human animals is controllable, such as by adding a specific inducer or repressor. In some embodiments, the specific inducer is selected from the tetracycline system (Tet-Off System / Tet-On System) or the tamoxifen system (Tamoxifen System).

[0240] The non-human mammal can be any non-human animal known in the art that can be used in the methods described herein. Preferred non-human mammals are mammals (e.g., rodents). In some embodiments, the non-human mammal is a mouse.

[0241] The non-human mammal described above is subjected to genetic, molecular and behavioral analysis. The present invention provides offspring produced by mating with a non-human mammal of the same genotype or another genotype.

[0242] The present invention provides a cell line or primary cell culture derived from a non-human mammal or its descendants. For example, a cell culture-based model can be prepared by the following methods. The cell culture can be obtained by isolation from the non-human mammal, or by obtaining cells from a cell culture established using the same construct and cell transfection techniques. Integration of a genetic construct comprising a DNA sequence encoding human IL5 and / or IL5RA protein can be detected by various methods.

[0243] There are many analytical methods that can be used to detect exogenous DNA, including nucleic acid level methods (including the use of reverse transcription-polymerase chain reaction (RT-PCR) or Southern Blot and in situ hybridization) and protein level methods (including histochemical analysis, immunoblotting analysis and in vitro binding studies). In addition, the expression level of the target gene can be quantified by the ELSA method well known to those skilled in the art. Many standard analytical methods can be used to achieve quantitative detection. For example, RT-PCR and hybridization methods can be used to detect transcript levels, including RNase protection assays, Southern Blots, and RNA dot hybridization analysis (RNAdot). Immunohistochemical staining, flow cytometry, and Western blots can also be used to detect the presence of human or humanized IL5 and / or IL5RA proteins.

[0244] In some embodiments, the genetically modified animals described herein (eg, mice homozygous for humanized IL5 and / or IL5RA genes) can express human or humanized IL5 and / or IL5RA protein in one or more leukocytes.

[0245] carrier

[0246] The present invention provides a targeting vector targeting the IL5 and / or IL5RA gene, comprising: a) a DNA fragment (5' arm) homologous to the 5' end of the switch region to be altered, which is selected from the genomic DNA of the IL5 and / or IL5RA gene of a non-human animal and has a length of 100-10,000 nucleotides; b) a DNA sequence encoding a donor region; c) a DNA fragment (3' arm) homologous to the 3' end of the switch region to be altered, which is selected from the genomic DNA of the IL5 and / or IL5RA gene of a non-human animal and has a length of 100-10,000 nucleotides.

[0247] In some embodiments, a) the DNA fragment homologous to the 5' end of the switch region to be altered is selected from a nucleotide sequence having at least 90% homology to NCBI Accession No. NC_000077.7; c) the DNA fragment homologous to the 3' end of the switch region to be altered is selected from a nucleotide sequence having at least 90% homology to NCBI Accession No. NC_000077.7;

[0248] In some embodiments, a) the DNA fragment homologous to the 5' end of the switch region to be altered is selected from nucleotides 53608127 to 53611663 of NCBI Accession No. NC_000077.7; c) the DNA fragment homologous to the 3' end of the switch region to be altered is selected from nucleotides 53616228 to 53620795 of NCBI Accession No. NC_000077.7;

[0249] In some embodiments, a) the DNA fragment homologous to the 5' end of the switch region to be altered is selected from a nucleotide sequence having at least 90% homology to NCBI Accession No. NC_000072.7; c) the DNA fragment homologous to the 3' end of the switch region to be altered is selected from a nucleotide sequence having at least 90% homology to NCBI Accession No. NC_000072.7;

[0250] In some embodiments, a) a DNA fragment homologous to the 5' end of the switch region to be altered is selected from nucleotides 106721238 to 106724767 of NCBI Accession No. NC_000072.7; c) a DNA fragment homologous to the 3' end of the switch region to be altered is selected from nucleotides 106705452 to 106708451 of NCBI Accession No. NC_000072.7 that is at least 95% identical;

[0251] In some embodiments, a) a DNA fragment homologous to the 5' end of the switch region to be altered is selected from nucleotides 106719697 to 106723871 of NCBI Accession No. NC_000072.7; c) a DNA fragment homologous to the 3' end of the switch region to be altered is selected from nucleotides 106713071 to 106717521 of NCBI Accession No. NC_000072.7 that is at least 95% identical;

[0252] In some embodiments, a) a DNA fragment homologous to the 5' end of the switch region to be altered is selected from nucleotides 106719697 to 106720999 of NCBI Accession No. NC_000072.7; c) a DNA fragment homologous to the 3' end of the switch region to be altered is selected from nucleotides 106716153 to 106717521 of NCBI Accession No. NC_000072.7 that is at least 95% identical;

[0253] In some embodiments, the length of the genomic nucleotide sequence selected for the targeting vector can exceed about 3 kb, 3.5 kb, 4 kb, 4.5 kb, 5 kb, 5.5 kb, 6 kb, 6.5 kb, 7 kb, 7.5 kb, 8 kb, 8.5 kb, 9 kb, 9.5 kb, or 10 kb.

[0254] In some embodiments, the switch region to be altered is located on exons 1 to 4 of the IL5 gene of a non-human animal.

[0255] In some embodiments, the switch region to be altered is located on exon 1 and exon 4 of the IL5 gene of a non-human animal (eg, positions 44-445 of NM_010558.1).

[0256] In some embodiments, the switch region to be altered is located on exons 1 to 13 of the IL5RA gene of a non-human animal.

[0257] In some embodiments, the switch region to be altered is located on exon 4 and exon 10 of the IL5RA gene of a non-human animal (eg, positions 363-1262 of NM_008370.2).

[0258] In some embodiments, the switch region to be altered is located on exon 5 and exon 6 of the IL5RA gene of a non-human animal (eg, positions 438-660 of NM_008370.2).

[0259] In some embodiments, the targeting vector further comprises one or more marker genes. For example, a positive screening marker gene or a negative screening marker gene. In some embodiments, the resistance gene for positive clone screening is a neomycin phosphotransferase coding sequence Neo. In some embodiments, the coding gene for the negative screening marker is a gene encoding the diphtheria toxin A subunit (DTA).

[0260] In some embodiments, the 5' arm sequence is a nucleotide sequence as shown in SEQ ID NOs: 3, 22, 42 and 49; the 3' arm sequence is a nucleotide sequence as shown in SEQ ID NOs: 4, 23, 43 and 50.

[0261] In some embodiments, the 5' arm comprises nucleotides having at least 90% homology to NCBI Accession No. NC_000077.7, and more preferably, the 5' arm sequence comprises the nucleotide sequence set forth in SEQ ID NO: 3. In some embodiments, the 3' arm comprises nucleotides having at least 90% homology to NCBI Accession No. NC_000077.7, and more preferably, the 3' arm sequence comprises the nucleotide sequence set forth in SEQ ID NO: 4.

[0262] In some embodiments, the 5' arm comprises nucleotides having at least 90% homology to NCBI Accession No. NC_000072.7, and more preferably, the 5' arm sequence comprises the nucleotide sequences set forth in SEQ ID NOs: 22, 42, and 49. In some embodiments, the 3' arm comprises nucleotides having at least 90% homology to NCBI Accession No. NC_000072.7, and more preferably, the 3' arm sequence comprises the nucleotide sequences set forth in SEQ ID NOs: 23, 43, and 50.

[0263] In some embodiments, the targeting vector comprises a human sequence (e.g., positions 132541811-132543478 of NC_000005.10). For example, the targeting region in the targeting vector includes all or part of the nucleotide sequence of the human IL5 gene, preferably part of exon 1, all of exons 2-3, and part of exon 4 of the human IL5 gene. In some embodiments, the nucleotide sequence of the humanized IL5 gene encodes all or part of the nucleotide sequence of the human IL5 protein, and the NCBI protein number is NP_000870.1 (SEQ ID NO: 2).

[0264] In some embodiments, the targeting vector comprises a human sequence (e.g., positions 3066324-3110374 of NC_000003.12). For example, the targeting region in the targeting vector includes all or part of the nucleotide sequence of the human IL5RA gene, preferably part of exon 3, all of exons 4-8, and part of exon 9 of the human IL5RA gene. In some embodiments, the nucleotide sequence of the humanized IL5RA gene encodes all or part of the nucleotide sequence of the human IL5RA protein, and the NCBI protein number is NP_783853.1 (SEQ ID NO: 21).

[0265] In some embodiments, the targeting vector comprises a human sequence (e.g., positions 576-1595 of NM_175726.4). For example, the targeting region in the targeting vector includes all or part of the nucleotide sequence of the human IL5RA gene, preferably part of exon 3, all of exons 4-9, and part of exon 10 of the human IL5RA gene. In some embodiments, the nucleotide sequence of the humanized IL5RA gene encodes all or part of the nucleotide sequence of the human IL5RA protein, and the NCBI protein number is NP_783853.1 (SEQ ID NO: 21).

[0266] The present invention also provides a vector for constructing a humanized animal model or a knockout model. In some embodiments, the vector comprises an sgRNA sequence, wherein the sgRNA sequence targets the IL5RA gene, and the sgRNA is unique on the target sequence of the gene to be changed and satisfies the sequence arrangement rule of 5'-NNN(20)-NGG3' or 5'-CCN-N(20)-3'; and in some embodiments, the targeting site of the sgRNA in the mouse IL5RA gene is located at exon 1, intron 1, exon 2, intron 2, exon 3, intron 3, exon 4, intron 4, exon 5, intron 5, exon 6, intron 6, exon 7, intron 7, exon 8, intron 8, exon 9, intron 9, exon 10, intron 10, exon 11, intron 11, exon 12, intron 12, exon 13.

[0267] In some embodiments, the targeting sequences are shown as SEQ ID NOs: 51 and 52. In some embodiments, the present disclosure relates to plasmid constructs (e.g., pT7-sgRNA) comprising sgRNA sequences and / or cells comprising the constructs.

[0268] The present disclosure also relates to cells comprising the targeting vector described above.

[0269] In addition, the present invention also provides a non-human mammalian cell having any one of the above-mentioned targeting vectors and one or more in vitro transcripts of the constructs described herein. In some embodiments, the cell comprises Cas9 mRNA or its in vitro transcript.

[0270] In some embodiments, the cell is heterozygous for the gene. In some embodiments, the cell is homozygous for the gene.

[0271] In some embodiments, the non-human mammalian cell is a mouse cell. In some embodiments, the cell is a fertilized egg cell. In some embodiments, the cell is an embryonic stem cell.

[0272] Method for constructing genetically modified non-human animals

[0273] Genetically modified non-human animals can be prepared by several techniques known in the art, including gene targeting technology using embryonic stem cells, CRISPR / Cas9 technology, zinc finger nuclease technology, transcription activator-like effector nuclease technology, homing endonuclease or other molecular biology techniques. In some embodiments, homologous recombination technology is preferably used. In some embodiments, CRISPR / Cas9 gene editing technology can construct genetically modified non-human animals. In some embodiments, CRISPR / Cas9 genome editing is used to produce genetically modified non-human animals. Many of these genome editing technologies are known in the art and are described in Yin et al. "Delivery technologies for genome editing," Nature Reviews Drug Discovery 16.6 (2017): 387-399, the entire contents of which are incorporated herein by reference.

[0274] The present invention also provides many other methods for genome editing, for example, microinjection of a transgenic cell into an enucleated oocyte and fusing the enucleated oocyte with another transgenic cell.

[0275] In some embodiments, the nucleotide sequence encoding the endogenous IL5 region in the endogenous genome of at least one cell of the non-human animal is replaced with the nucleotide sequence encoding the corresponding region of human IL5. In some embodiments, the non-human animal endogenous IL5 protein is expressed at a reduced level or is absent compared to wild-type IL5. In some embodiments, the replacement occurs in germ cells, somatic cells, blastocysts, or fibroblasts. The nucleus of a somatic cell or fibroblast can be inserted into an enucleated oocyte.

[0276] Figure 3 shows a humanized targeting strategy for the mouse IL5 gene locus. The targeting vector comprises a 5' homology arm, a human or humanized IL5 gene fragment, and a 3' homology arm. The process involves using homologous recombination to replace the endogenous corresponding IL5 nucleotide sequence with a human or humanized nucleotide sequence. In some embodiments, cleavage upstream and downstream of the target site (e.g., by zinc finger nucleases, TALENs, or CRISPR) can result in a double-strand break in the DNA, and homologous recombination is used to replace the mouse endogenous IL5 sequence with the human or humanized IL5 sequence.

[0277] In some embodiments, the non-human animal is constructed by introducing any of the following nucleotide sequences into the non-human animal IL5 locus:

[0278] A) a portion of the human IL5 gene, preferably comprising all or part of exons 1 to 4 of the human IL5 gene, further preferably comprising part of exon 1, all of exons 2-3 and part of exon 4 of the human IL5 gene, wherein the portion of exon 1 of the human IL5 gene comprises at least 20 bp to at least 188 bp of exon 1 of the human IL5 gene, for example, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 144, 145, 150, 160, 170, 180 or 188 consecutive nucleotide sequences, or, The portion of exon 1 of the human IL5 gene comprises the nucleotide sequence of the coding region, the portion of exon 4 of the human IL5 gene comprises at least 20 bp to at least 465 bp, for example, 20, 30, 40, 50, 60, 70, 80, 90, 99, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450 or 465 bp of exon 4 of the human IL5 gene, or the portion of exon 4 of the human IL5 gene comprises the nucleotide sequence of the coding region, more preferably comprises SEQ. 5; or, comprising a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99% identical to the nucleotide sequence of SEQ ID NO: 5; or, comprising a nucleotide sequence that differs from the nucleotide sequence of SEQ ID NO: 5 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 nucleotide; or, comprising a nucleotide sequence having a substitution, deletion and / or insertion of one or more nucleotides as set forth in the nucleotide sequence of SEQ ID NO: 5;

[0279] B) a nucleotide sequence encoding all or part of a human IL5 protein, preferably comprising a nucleotide sequence encoding at least 50 to at least 134, for example 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 134 consecutive amino acids of a human IL5 protein, further preferably comprising a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 2; or, comprising a nucleotide sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99% identical to the amino acid sequence of SEQ ID NO: 2; or, comprising a nucleotide sequence that differs from the nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 2 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 nucleotide sequence; or, comprising a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 2. The nucleotide sequence of the amino acid sequence shown in NO: 2, including the nucleotide sequence of substitution, deletion and / or insertion of one or more nucleotides;

[0280] C) a nucleotide sequence encoding the above-mentioned humanized IL5 protein; or

[0281] D) The humanized IL5 gene described above.

[0282] Preferably, the non-human animal further comprises a nucleotide sequence encoding other human or chimeric proteins, more preferably, the other human or chimeric proteins are selected from at least one of PD-1, PD-L1, GLP1R, OX40, NKP46, IL36R, HER2, TROP2, CD28, CTLA4, IL4, IL4R or IL5RA.

[0283] Further preferably, the other human or chimeric proteins are IL5RA, IL4 and IL4R proteins.

[0284] In some embodiments, other genetic modifications in the non-human animals are described in PCT / CN2017 / 090320, PCT / CN2017 / 099574, PCT / CN2021 / 119112, PCT / CN2017 / 099575, PCT / CN2023 / 073036, PCT / CN2022 / 127313, PCT / CN2022 / 113594, PCT / CN2022 / 120819, PCT / CN2018 / 091846, and PCT / CN2017 / 099577, the entire contents of which are incorporated herein by reference.

[0285] Preferably, the human or humanized IL5 gene and / or other genes are homozygous for the endogenous modified (preferably replaced or inserted) locus.

[0286] Preferably, the human or humanized IL5 gene and / or other genes are heterozygous for the endogenous modified (preferably replaced or inserted) locus.

[0287] Preferably, the non-human animal can be selected from any non-human animal that can be gene-edited to produce humanized genes, such as rodents, pigs, rabbits, monkeys, etc.

[0288] Preferably, the non-human animal is a non-human mammal. Further preferably, the non-human mammal is a rodent. Even more preferably, the rodent is a rat or a mouse.

[0289] Therefore, the present invention provides a method for constructing a non-human animal with a humanized IL5 gene, wherein the non-human animal expresses human or humanized IL5 protein in vivo, and / or the genome of the non-human animal contains a portion of a human IL5 gene or a humanized IL5 gene.

[0290] Therefore, in some embodiments, the method for preparing genetically modified humanized animals is included in the replacement of the nucleic acid sequence encoding the endogenous IL5 region with the nucleotide sequence encoding the corresponding region of human IL5 at the endogenous IL5 locus (or site). The replaced sequence can include the region (for example, part or all of the region) of exon 1, exon 2, exon 3 and / or exon 4 of the human IL5 gene. In certain embodiments, the sequence includes the part of exon 1, exon 2-3 and exon 4 of the human IL5 gene (for example, the nucleotide sequence of positions 45-449 of NM_000879.3). In certain embodiments, the sequence includes the part of exon 1 and the part of exon 4 of the endogenous IL5 gene (for example, the nucleotide sequence of positions 1-43 and 446-1534 of NM_010558.1).

[0291] The present invention also provides a method for establishing an IL5 gene humanized animal model, comprising the following steps:

[0292] (a) providing a cell (e.g., a fertilized egg cell) according to the method described herein;

[0293] (b) culturing the cells in a liquid culture medium;

[0294] (c) transplanting the cultured cells into the oviduct or uterus of a recipient female non-human mammal, and allowing the cells to develop in the uterus of the female non-human mammal;

[0295] (d) identifying germline transmission in offspring of the genetically modified humanized non-human mammal of the pregnant female in step (c).

[0296] In some embodiments, the non-human mammal in the above methods is a mouse (eg, a C57BL / 6 mouse).

[0297] In some embodiments, the non-human mammal in step (c) is a female with pseudopregnancy (or pseudo-pregnancy).

[0298] In some embodiments, the fertilized eggs used in the above methods are C57BL / 6 fertilized eggs. Other fertilized eggs that can also be used in the methods described herein include, but are not limited to, FVB / N fertilized eggs, BALB / c fertilized eggs, DBA / 1 fertilized eggs, and DBA / 2 fertilized eggs.

[0299] The fertilized egg can be from any non-human animal, such as any of the non-human animals described herein. In some embodiments, the fertilized egg cell is derived from a rodent. The genetic construct can be introduced into the fertilized egg by microinjection. For example, by culturing the fertilized egg after microinjection, the cultured fertilized egg can be transferred to a pseudopregnant non-human animal, which can then give birth to a non-human mammal, thereby producing the non-human mammal mentioned in the above method.

[0300] In certain embodiments, the method for preparing genetically modified animals includes modifying the coding frame of the IL5 gene of non-human animals, for example, by replacing the nucleic acid sequence (for example, DNA or cDNA sequence) encoding endogenous IL5 region with the nucleotide sequence encoding human IL5 corresponding region under the control of the IL5 gene endogenous regulatory element of non-human animals. For example, one or more functional region sequences of the IL5 gene of non-human animals can be knocked out or inserted into a sequence so that the endogenous IL5 protein of non-human animals can not be expressed or the expression level is reduced. In certain embodiments, the coding frame of the IL5 gene of the non-human animal modified can be all or part of the nucleotide sequence of IL5 gene exon 1 to exon 4 of non-human animals.

[0301] In some embodiments, the method for preparing a genetically modified animal comprises inserting a nucleotide sequence encoding a human or humanized IL5 protein and / or an auxiliary sequence after the endogenous regulatory elements of the IL5 gene of a non-human animal. In some embodiments, the auxiliary sequence can be a stop codon, such that the IL5 gene humanized animal model can express a human or humanized IL5 protein in vivo, but does not express the IL5 protein of the non-human animal.

[0302] In some embodiments, the method for preparing a transgenic animal comprises:

[0303] (1) providing a plasmid comprising a human IL5 gene fragment, wherein the plasmid is flanked by a 5' homology arm and a 3' homology arm, wherein the 5' and 3' homology arms target endogenous IL5;

[0304] (2) providing one or more guide RNAs (sgRNAs) targeting the endogenous IL5 gene;

[0305] (3) modifying the genome of a fertilized egg or embryonic stem cell by using the plasmid of step (1), the sgRNA of step (2), and Cas9;

[0306] (4) transplanting the fertilized egg obtained in step (3) into the oviduct of a pseudo-pregnant female mouse, or transplanting the embryonic stem cells obtained in step (3) into a blastocyst, and then transplanting the blastocyst into the oviduct of a pseudo-pregnant female mouse to produce offspring mice that functionally express the humanized IL5 protein;

[0307] (5) The offspring mice obtained in step (4) are mated to obtain homozygous mice.

[0308] In some embodiments, the zygote is modified by CRISPR with sgRNAs targeting a 5'-terminal targeting site and a 3'-terminal target site.

[0309] In some embodiments, the sequence encoding the humanized IL5 protein is operably linked to endogenous regulatory elements at the endogenous IL5 locus.

[0310] In some embodiments, the genetically modified animal does not express endogenous IL5 protein.

[0311] In some embodiments, the method for preparing a transgenic animal comprises:

[0312] (1) providing a plasmid comprising a human or chimeric IL5 gene segment, said plasmid being flanked by 5' homology arms and 3' homology arms, wherein said 5' and 3' homology arms target endogenous IL5;

[0313] (2) providing one or more guide RNAs (sgRNAs) targeting the endogenous IL5 gene;

[0314] (3) Modifying the genome of a fertilized egg or embryonic stem cell by inserting the human or chimeric IL5 gene fragment into the genome.

[0315] In some embodiments, the nucleotide sequence encoding the endogenous IL5RA region in the endogenous genome of at least one cell of the non-human animal is replaced with a nucleotide sequence encoding the corresponding region of human IL5RA. In some embodiments, the expression level of the endogenous IL5RA protein in the non-human animal is reduced or absent compared to wild-type. In some embodiments, the replacement occurs in a cell such as a germ cell, a somatic cell, a blastocyst, or a fibroblast. The nucleus of a somatic cell or fibroblast can be inserted into an enucleated oocyte.

[0316] Figures 9, 13, and 14 illustrate strategies for humanizing the mouse IL5RA locus. The targeting vector comprises a 5' homology arm, a human or humanized IL5RA gene fragment, and a 3' homology arm. This process involves replacing the endogenous corresponding IL5RA sequence with the human or humanized IL5RA sequence using homologous recombination. In some embodiments, cleavage upstream and downstream of the target site (e.g., by zinc finger nucleases, TALENs, or CRISPR) results in DNA double-strand breaks, which replace the endogenous mouse IL5RA sequence with the human or humanized IL5RA sequence using homologous recombination.

[0317] In some embodiments, the non-human animal is constructed by introducing any of the following nucleotide sequences into the IL5RA locus of a non-human animal:

[0318] A) a portion of the human IL5RA gene, preferably comprising all or part of exon 1 to exon 12 of the human IL5RA gene, further comprising all or part of one, two, or three or more exons, or a combination of two or more consecutive exons of exon 1 to exon 12 of the human IL5RA gene, more preferably comprising all or part of exon 3 to exon 12 of the human IL5RA gene, further preferably comprising all or part of exon 3 to exon 9 of the human IL5RA gene, and still more preferably comprising all or part of exon 1 to exon 12 of the human IL5RA gene. RA gene, preferably further comprising introns 3-4 and / or introns 8-9, wherein the portion of exon 3 of the human IL5RA gene comprises at least 5 bp to at least 85 bp, such as 5, 10, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80 or 85 bp of exon 3 of the human IL5RA gene, or, The portion of exon 3 of the gene includes a nucleotide sequence from the first 1-10 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10) amino acids C-terminal to the amino acids encoded by exon 3 to the last nucleotide in exon 3, and more preferably includes the first 4 amino acids C-terminal to the amino acids encoded by exon 3. The portion of exon 9 of the human IL5RA gene includes at least 5 bp to 139 bp of exon 9 of the human IL5RA gene, for example, 5, 10, 15, 20, 25, 30, 35, 40, 45 , 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 111, 112, 113, 114, 115, 120, 125, 130, 135 or 139 bp consecutive nucleotide sequence, or, the portion of exon 9 of the human IL5RA gene includes nucleotides starting from the first nucleotide of exon 9 to the first 1-10 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10) amino acids C-terminal to the amino acids encoded by exon 9;Alternatively, it is preferred that the amino acid sequence comprises part of human IL5RA gene exon 3, all of exons 4-9 and part of exon 10, wherein the part of human IL5RA gene exon 3 comprises at least 20 bp to at least 85 bp of human IL5RA gene exon 3, for example, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 81, 82, 83, 84 or 85 bp of continuous nucleotide sequence, or the part of human IL5RA gene exon 3 comprises The nucleotide sequence comprising the coding region, the portion of human IL5RA gene exon 10 comprises at least 5 bp to at least 97 bp of human IL5RA gene exon 10, for example, 5, 10, 15, 20, 25, 26, 27, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 97 bp of continuous nucleotide sequence, or the portion of human IL5RA gene exon 10 comprises the nucleotide sequence of a portion of the coding region; further preferably, it comprises SEQ or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99% identity to the nucleotide sequence of SEQ ID NO: 24 or 44; or a nucleotide sequence having no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 nucleotide difference from the nucleotide sequence of SEQ ID NO: 24 or 44; or a nucleotide sequence having a substitution, deletion and / or insertion of one or more nucleotides from the nucleotide sequence of SEQ ID NO: 24 or 44;

[0319] B) all or part of a nucleotide sequence encoding a human IL5RA protein, preferably comprising all or part of a nucleotide sequence encoding the signal peptide, extracellular region, transmembrane region and / or cytoplasmic region of a human IL5RA protein, further preferably comprising all or part of a nucleotide sequence encoding the extracellular region of an IL5RA protein, preferably comprising a nucleotide sequence encoding at least 50 to at least 322, preferably 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320 or 322 consecutive amino acids of the extracellular region of a human IL5RA protein, more preferably comprising a nucleotide sequence encoding the amino acid sequence of positions 21-340 or positions 24-323 of SEQ ID NO: 21; or comprising the nucleotide sequence encoding the amino acid sequence of positions 21-340 or positions 24-323 of SEQ ID NO: 21; A nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99% identical to the nucleotide sequence of the amino acid sequence as set forth at positions 21-340 or 24-323 of SEQ ID NO: 21; or a nucleotide sequence that differs by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 nucleotide from the nucleotide sequence encoding the amino acid sequence as set forth at positions 21-340 or 24-323 of SEQ ID NO: 21; or a nucleotide sequence that differs by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 nucleotide from the nucleotide sequence encoding the amino acid sequence as set forth at positions 21-340 or 24-323 of SEQ ID NO: 21; NO:21, including substitutions, deletions and / or insertions of one or more nucleotides, more preferably comprising all or part of the nucleotide sequence encoding the signal peptide of the human IL5RA protein, preferably comprising a nucleotide sequence encoding at least 5 to at least 20, such as 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 consecutive amino acids of the signal peptide of the human IL5RA protein, preferably comprising a nucleotide sequence encoding the amino acid sequence of positions 1-20 of SEQ ID NO:21; or comprising a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99% identical to the nucleotide sequence encoding the amino acid sequence of positions 1-20 of SEQ ID NO:21; or comprising a nucleotide sequence that is at least 99%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99% identical to the nucleotide sequence encoding the amino acid sequence of positions 1-20 of SEQ ID NO:21; a nucleotide sequence that differs from the nucleotide sequence of the amino acid sequence set forth in positions 1-20 of NO: 21 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 nucleotide;or a nucleotide sequence that differs from the nucleotide sequence encoding the amino acid sequence set forth in positions 1-20 of SEQ ID NO:21 in no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or no more than 1 nucleotide. Or, the nucleotide sequence comprises a substitution, deletion, and / or insertion of one or more nucleotides as set forth in the nucleotide sequence encoding the amino acid sequence set forth in positions 1-20 of SEQ ID NO:21; more preferably, the nucleotide sequence comprises a substitution, deletion, and / or insertion of one or more nucleotides as set forth in the nucleotide sequence encoding the amino acid sequence set forth in positions 1-340 of SEQ ID NO:21; or, the nucleotide sequence comprises a substitution, deletion, and / or insertion of one or more nucleotides as set forth in the nucleotide sequence encoding the amino acid sequence set forth in positions 1-340 of SEQ ID NO:21;

[0320] C) encoding the humanized IL5RA protein described above; or

[0321] D) The humanized IL5RA gene described above.

[0322] Preferably, the A) further comprises a portion of the non-human animal IL5RA gene. Further preferably, the portion of the non-human animal IL5RA gene comprises all or part of exons 1 to 13 of the non-human animal IL5RA gene, more preferably comprises part of exon 11, all of exon 12, and part of exon 13 of the non-human animal IL5RA gene; wherein the portion of exon 11 of the non-human animal IL5RA gene comprises at least 20 bp to at least 94 bp of exon 11 of the non-human animal IL5RA gene, for example, 20, 25, 30, 35, 40, The portion of exon 13 of the non-human animal IL5RA gene comprises at least 20 bp to at least 2091 bp of exon 13 of the non-human animal IL5RA gene, such as a 20, 50, 100, 150, 200, 250, 500, 1000, 1500, 1540, 1545, 1546, 1547, 1548, 1549, 2000, 2050 or 2091 bp continuous nucleotide sequence; more preferably, the portion of exon 13 of the non-human animal IL5RA gene comprises at least 20 bp to at least 2091 bp of exon 13 of the non-human animal IL5RA gene; or a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99% identical to the nucleotide sequence of SEQ ID NO: 54; or a nucleotide sequence that differs from the nucleotide sequence of SEQ ID NO: 54 in no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 nucleotide. Alternatively, the nucleotide sequence may comprise a substitution, deletion and / or insertion of one or more nucleotides from the nucleotide sequence of SEQ ID NO: 54.

[0323] Preferably, said B) further comprises a nucleotide sequence encoding all or part of a non-human animal IL5RA protein, further preferably comprises a nucleotide sequence encoding all or part of a signal peptide, extracellular region, transmembrane region and / or cytoplasmic region of a non-human animal IL5RA protein, further preferably comprises a nucleotide sequence encoding all or part of a signal peptide of a non-human animal IL5RA protein, preferably comprises a nucleotide sequence encoding the amino acid sequence as shown in positions 1-17 of SEQ ID NO: 20; or comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99% identical to a nucleotide sequence encoding the amino acid sequence as shown in positions 1-17 of SEQ ID NO: 20. More preferably, the protein comprises all or part of the transmembrane region of a non-human IL5RA protein, preferably comprising a nucleotide sequence encoding the amino acid sequence as shown at positions 340-361 of SEQ ID NO: 20; or, comprising a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99% identity to the nucleotide sequence encoding the amino acid sequence as shown at positions 340-361 of SEQ ID NO: 20; and more preferably, the protein comprises all or part of the cytoplasmic region of a non-human IL5RA protein, preferably comprising a nucleotide sequence encoding the amino acid sequence as shown at positions 362-415 of SEQ ID NO: 20; or, comprising a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99% identity to the nucleotide sequence encoding the amino acid sequence as shown at positions 340-361 of SEQ ID NO: 20. : The nucleotide sequence of the amino acid sequence as set forth at positions 362-415 of SEQ ID NO:20 is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identical to the nucleotide sequence of the amino acid sequence as set forth at positions 362-415 of SEQ ID NO:20; more preferably, the nucleotide sequence comprises all or part of the extracellular region of a non-human animal IL5RA protein, preferably comprises a nucleotide sequence encoding the amino acid sequence as set forth at positions 18-45 or 337-339 of SEQ ID NO:20; or, the nucleotide sequence comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identical to the nucleotide sequence encoding the amino acid sequence as set forth at positions 18-45 or 337-339 of SEQ ID NO:20.

[0324] Preferably, the non-human animal further comprises other gene modifications, more preferably, the other genes are selected from at least one of PD-1, PD-L1, GLP1R, OX40, NKP46, IL36R, HER2, TROP2, CD28, CTLA4, IL4, IL4R or IL5RA.

[0325] Preferably, the human or humanized IL5RA gene and / or other genes are homozygous for the endogenous modified (preferably replaced or inserted) locus.

[0326] Preferably, the human or humanized IL5RA gene and / or other genes are heterozygous for the endogenous modified (preferably replaced or inserted) locus.

[0327] Preferably, the non-human animal can be selected from any non-human animal that can be gene-edited to produce humanized genes, such as rodents, pigs, rabbits, monkeys, etc.

[0328] Preferably, the non-human animal is a non-human mammal. Further preferably, the non-human mammal is a rodent. Even more preferably, the rodent is a rat or a mouse.

[0329] Therefore, the present invention provides a method for constructing a non-human animal with a humanized IL5RA gene, wherein the non-human animal expresses human or humanized IL5RA protein in vivo, and / or the genome of the non-human animal contains a portion of a human IL5RA gene or a humanized IL5RA gene.

[0330] Therefore, in some embodiments, a method for preparing a genetically modified humanized animal comprises replacing a nucleic acid sequence encoding an endogenous IL5RA region at an endogenous IL5RA locus (or site) with a nucleotide sequence encoding a corresponding region of human IL5RA. The nucleotide sequence of the corresponding region of human IL5RA can include regions (e.g., part or all) of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, and / or exon 12 of the human IL5RA gene. In some embodiments, the sequence includes a portion of exon 3, exons 5-8, and a portion of exon 9 of the human IL5RA gene (e.g., nucleotide sequence 645-1544 of NM_175726.4). In some embodiments, the sequence includes a portion of exon 3, exons 4-9, and a portion of exon 10 of the human IL5RA gene (e.g., the nucleotide sequence of positions 576-1595 of NM_175726.4).

[0331] The present invention also provides a method for establishing an IL5RA gene humanized animal model, comprising the following steps:

[0332] (a) providing a cell (e.g., a fertilized egg cell) according to the method described herein;

[0333] (b) culturing the cells in a liquid culture medium;

[0334] (c) transplanting the cultured cells into the oviduct or uterus of a recipient female non-human mammal, and allowing the cells to develop in the uterus of the female non-human mammal;

[0335] (d) identifying germline transmission in offspring of the genetically modified humanized non-human mammal of the pregnant female in step (c).

[0336] In some embodiments, the non-human mammal in the above methods is a mouse (eg, a C57BL / 6 mouse).

[0337] In some embodiments, the non-human mammal in step (c) is a female with pseudopregnancy (or pseudo-pregnancy).

[0338] In some embodiments, the fertilized eggs used in the above methods are C57BL / 6 fertilized eggs. Other fertilized eggs that can also be used in the methods described herein include, but are not limited to, FVB / N fertilized eggs, BALB / c fertilized eggs, DBA / 1 fertilized eggs, and DBA / 2 fertilized eggs.

[0339] The fertilized egg can be from any non-human animal, such as any of the non-human animals described herein. In some embodiments, the fertilized egg cell is derived from a rodent. The genetic construct can be introduced into the fertilized egg by microinjection. For example, by culturing the fertilized egg after microinjection, the cultured fertilized egg can be transferred to a pseudopregnant non-human animal, which can then give birth to a non-human mammal, thereby producing the non-human mammal mentioned in the above method.

[0340] In some embodiments, a method for preparing a genetically modified animal comprises modifying the coding frame of the IL5RA gene of a non-human animal, for example, by replacing a nucleic acid sequence (e.g., a DNA or cDNA sequence) encoding a region of endogenous IL5RA with a nucleotide sequence encoding a corresponding region of human IL5RA under the control of an endogenous regulatory element of the IL5RA gene of the non-human animal. For example, one or more functional region sequences of the IL5RA gene of the non-human animal can be deleted or inserted into a sequence such that the endogenous IL5RA protein of the non-human animal cannot be expressed or the expression level is reduced. In some embodiments, the coding frame of the modified IL5RA gene of the non-human animal can be all or part of the nucleotide sequence of exon 1 to exon 13 of the IL5RA gene of the non-human animal.

[0341] In some embodiments, a method for preparing a genetically modified animal comprises inserting a nucleotide sequence encoding a human or humanized IL5RA protein and / or an auxiliary sequence after the endogenous regulatory elements of the IL5RA gene of a non-human animal. In some embodiments, the auxiliary sequence can be a stop codon, such that the IL5RA gene humanized animal model can express the human or humanized IL5RA protein in vivo without expressing the IL5RA protein of the non-human animal. In some embodiments, the auxiliary sequence comprises at least one of an endogenous P2A, a 3'UTR, and / or a STOP.

[0342] In some embodiments, the method for making a transgenic animal comprises:

[0343] (1) providing a plasmid comprising a human IL5RA gene fragment, wherein the plasmid is flanked by a 5' homology arm and a 3' homology arm, wherein the 5' and 3' homology arms target endogenous IL5RA;

[0344] (2) providing one or more guide RNAs (sgRNAs) targeting the endogenous IL5RA gene;

[0345] (3) modifying the genome of a fertilized egg or embryonic stem cell by using the plasmid of step (1), the sgRNA of step (2), and Cas9;

[0346] (4) transplanting the fertilized egg obtained in step (3) into the oviduct of a pseudo-pregnant female mouse, or transplanting the embryonic stem cells obtained in step (3) into a blastocyst, and then transplanting the blastocyst into the oviduct of a pseudo-pregnant female mouse to produce offspring mice that functionally express the humanized IL5RA protein;

[0347] (5) The offspring mice obtained in step (4) are mated to obtain homozygous mice.

[0348] In some embodiments, the zygote is modified by CRISPR with sgRNAs targeting a 5'-terminal targeting site and a 3'-terminal target site.

[0349] In some embodiments, the sequence encoding the humanized IL5RA protein is operably linked to endogenous regulatory elements at the endogenous IL5RA locus.

[0350] In some embodiments, the genetically modified animal does not express endogenous IL5RA protein.

[0351] In some embodiments, the method for preparing a transgenic animal comprises:

[0352] (1) providing a plasmid comprising a human or chimeric IL5RA gene fragment, said plasmid being flanked by 5' homology arms and 3' homology arms, wherein said 5' and 3' homology arms target endogenous IL5RA;

[0353] (2) providing one or more guide RNAs (sgRNAs) targeting the endogenous IL5RA gene;

[0354] (3) Modifying the genome of a fertilized egg or embryonic stem cell by inserting the human or chimeric IL5RA gene fragment into the genome.

[0355] Use of genetically modified non-human animals

[0356] Replacing a non-human animal gene with a homologous or orthologous human gene or human sequence or inserting a homologous or orthologous human gene or human sequence into a non-human animal at an endogenous non-human animal locus and under the control of an endogenous promoter and / or regulatory elements can produce a non-human animal with qualities and characteristics that may be significantly different from those of a typical knockout plus transgenic animal. In a typical knockout plus transgenic animal, the endogenous locus is removed or destroyed and a fully human transgene is inserted into the genome of the animal and may integrate randomly into the genome. Typically, the location of the integrated transgene is unknown; expression of the human protein is measured by transcription of the human gene and / or protein assays and / or functional assays. In a human transgene, the human sequences upstream and / or downstream provide suitable support for expression and / or regulation of the transgene.

[0357] In some cases, transgenes with human regulatory elements are expressed in a non-physiological or otherwise unsatisfactory manner and may actually be harmful to the animal. The present invention demonstrates that the replacement or insertion of human sequences at endogenous gene loci under the control of endogenous regulatory elements to generate humanized animals provides physiologically appropriate expression patterns and levels that are meaningful and appropriate in the context of the physiology of the humanized animal with respect to the physiology of the replaced gene.

[0358] Genetically modified animals that express human or humanized IL5 and / or IL5RA protein, e.g., in a physiologically appropriate manner, offer a variety of uses, including, but not limited to, developing treatments for human diseases and disorders, and evaluating the toxicity and / or efficacy of these human treatments in animal models.

[0359] The present invention also provides a use of the above-mentioned IL5 and / or IL5RA gene-modified non-human animal or a non-human animal obtained by any of the above-mentioned construction methods.

[0360] In some embodiments, the application comprises:

[0361] A) Applications in the development of products involving human cells in immune processes associated with IL5 and / or IL5RA;

[0362] B) Use as a model system for IL5 and / or IL5RA-related research in pharmacology, immunology, microbiology, and medicine;

[0363] C) applications involving the production and use of animal experimental disease models for the study of the etiology associated with IL5 and / or IL5RA and / or for the development of diagnostic strategies and / or for the development of therapeutic strategies;

[0364] D) in vivo studies on the screening, efficacy testing, efficacy assessment, validation or evaluation of human IL5 and / or IL5RA signaling pathway modulators; or

[0365] E) Study the gene function of IL5 and / or IL5RA, study the drugs and efficacy targeting human IL5 and / or IL5RA target sites, and study the application of IL5 and / or IL5RA in immune-related disease drugs and anti-tumor drugs.

[0366] The present invention provides a non-human animal expressing human or humanized IL5 and / or IL5RA protein, which can be used to screen for human IL5 and / or IL5RA-specific modulators. In some embodiments, the non-human animal is an animal model for human disease. For example, the disease is genetically induced (knock-in or knock-out). In various embodiments, the genetically modified non-human animal further comprises a compromised immune system, such as a genetically modified human tissue xenograft, including a human solid tumor (e.g., bladder cancer) or a blood cell tumor (e.g., a lymphocyte tumor, B or T cell tumor).

[0367] In some embodiments, genetically modified non-human animals can be used to determine the effectiveness of therapeutic agents (e.g., anti-IL5 antibodies and / or anti-IL5RA antibodies) in treating various immune diseases. In some embodiments, the immune diseases include, but are not limited to, GVHD (graft-versus-host disease), systemic lupus erythematosus, systemic sclerosis, systemic vasculitis, sinusitis, urticaria, and the like.

[0368] In some embodiments, genetically modified non-human animals can be used to determine the effectiveness of therapeutic agents (e.g., anti-IL5 antibodies and / or anti-IL5RA antibodies) in treating various inflammatory infections. In some embodiments, the inflammation includes both acute and chronic inflammation, including, but not limited to, chronic obstructive pulmonary disease (COPD), atopic dermatitis, and dermatitis.

[0369] In some embodiments, genetically modified non-human animals can be used to determine the effectiveness of therapeutic agents (e.g., anti-IL5 antibodies and / or anti-IL5 antibodies) for treating cancer. In some embodiments, a therapeutic agent (e.g., IL5 antibody and / or anti-IL5RA antibody) is administered to a non-human animal, wherein the non-human animal has cancer or a tumor, and the inhibitory effect of the therapeutic agent on the cancer or tumor is detected. In some embodiments, the detection includes measuring the size and / or proliferation rate of tumor cells. In some embodiments, the detection method includes vernier caliper measurement, flow cytometry and / or in vivo animal imaging detection. In some embodiments, the detection includes assessing individual body weight, fat mass, activation pathways, neuroprotective activity or metabolic changes, and the metabolic changes include changes in food consumption or water consumption.

[0370] In some embodiments, the tumor cells include one or more cancer cells injected into an animal (e.g., cancer cells derived from a human or non-human animal). In some embodiments, the therapeutic agent inhibits an IL5 / IL5RA-mediated signaling pathway. In some embodiments, the therapeutic agent does not inhibit an IL5 / IL5RA-mediated signaling pathway.

[0371] In some embodiments, genetically modified non-human animals can be used to detect whether anti-IL5 antibodies and / or anti-IL5RA antibodies are agonists or antagonists. In some embodiments, the methods described herein can be used to detect the function of therapeutic agents (e.g., anti-IL5 antibodies and / or anti-IL5RA antibodies), for example, whether the therapeutic agent can upregulate the immune response or downregulate the immune response, and / or whether the therapeutic agent can induce complement-mediated cytotoxicity (CMC) or antibody-dependent cellular cytotoxicity (ADCC). In some embodiments, genetically modified non-human animals can be used to determine the effective dose of a therapeutic agent for treating a disease (e.g., an immune disease) in a subject. The inhibitory effect on tumors can also be determined by methods known in the art, for example, measuring the tumor volume in the animal, and / or determining the tumor (volume) inhibition rate (TGI). TV ). The tumor growth inhibition rate can be calculated using the formula TGI TV (%) = (1-TVt / TVc) x 100, where TVt and TVc are the mean tumor volumes (or weights) of the treatment and control groups.

[0372] In some embodiments, therapeutic agents (e.g., anti-IL5 antibodies and / or anti-IL5RA antibodies) can be used to treat various cancers. As used herein, "cancer" refers to cells with autonomous growth capacity, i.e., an abnormal state or condition characterized by rapid cell growth and proliferation. The term is intended to include all types of cancerous growth or carcinogenic processes, metastatic tissues, or malignantly transformed cells, tissues, or organs, regardless of the histopathological type or invasive stage. As used herein, "tumors" include, but are not limited to, lymphomas, non-small cell lung cancer, cervical cancer, leukemia, ovarian cancer, nasopharyngeal cancer, breast cancer, endometrial cancer, colon cancer, rectal cancer, gastric cancer, bladder cancer, gliomas, lung cancer, bronchial cancer, bone cancer, prostate cancer, pancreatic cancer, liver and bile duct cancer, esophageal cancer, kidney cancer, thyroid cancer, head and neck cancer, testicular cancer, glioblastoma, astrocytoma, melanoma, myelodysplastic syndrome, and sarcoma. Wherein, the leukemia is selected from acute lymphocytic (lymphoblastic) leukemia, acute myeloid leukemia, myeloid leukemia, chronic lymphocytic leukemia, multiple myeloma, plasma cell leukemia and chronic myeloid leukemia;The lymphoma is selected from Hodgkin lymphoma and non-Hodgkin lymphoma, including B cell lymphoma, diffuse large B cell lymphoma, follicular lymphoma, mantle cell lymphoma, marginal zone B cell lymphoma, T cell lymphoma and Waldenstrom macroglobulinemia;The sarcoma is selected from osteosarcoma, Ewing sarcoma, leiomyosarcoma, synovial sarcoma, soft tissue sarcoma, angiosarcoma, liposarcoma, fibrosarcoma, rhabdomyosarcoma and chondrosarcoma.In a specific embodiment of the present invention, the tumor is cancer, malignant tumor, acute myeloid leukemia, bladder cancer, colorectal cancer, genitourinary system cancer.

[0373] The present invention also provides a method for determining the toxicity of a therapeutic agent (e.g., an anti-IL5 antibody and / or an anti-IL5RA antibody). The method comprises administering an antibody to the non-human animal described above and assessing the animal's weight change, red blood cell count, hematocrit, and / or hemoglobin. In some embodiments, the antibody can reduce red blood cells (RBC), hematocrit, or hemoglobin by 20%, 30%, 40%, or more than 50%. In some embodiments, the animal's body weight is at least 5%, 10%, 20%, 30%, or 40% less than a control group (e.g., the average weight of an animal not treated with the antibody).

[0374] The present invention also provides an animal model constructed by the method described herein for use in developing products related to human cellular immune processes, producing human antibodies, or as a model system for pharmacology, immunology, microbiology, and medical research.

[0375] In some embodiments, an animal model generated by the methods described herein is provided for producing and utilizing human cell-based immune processes as animal experimental disease models, studying pathogens, or developing new diagnostic and / or therapeutic strategies.

[0376] The present invention also provides animal models generated by the methods described herein for screening, validating, evaluating or studying IL5 and / or IL5RA gene function, human IL5 and / or IL5RA antibodies, drugs or effectiveness of human IL5 and / or IL5RA target sites, drugs for immune-related diseases and anti-tumor drugs.

[0377] In some embodiments, the present disclosure provides a method for verifying the in vivo efficacy of TCR-T, CAR-T and / or other immunotherapies (e.g., T cell adoptive transfer therapy). For example, the method includes transplanting human tumor cells into animals described herein and applying human CAR-T to animals with human tumor cells. The effectiveness of CAR-T therapy can be determined and evaluated. In some embodiments, the animal is selected from IL5 and / or IL5RA gene humanized non-human animals prepared by the methods described herein, IL5 and / or IL5RA gene humanized non-human animals described herein, double or multiple humanized non-human animals (or their offspring) produced by the methods described herein, non-human animals expressing human or humanized IL5 and / or IL5RA proteins, or tumor-bearing or inflammatory animal models described herein. In some embodiments, TCR-T, CAR-T and / or other immunotherapies can treat IL5 and / or IL5RA related diseases described herein. In some embodiments, TCA-T, CAR-T and / or other immunotherapies provide evaluation methods for treating IL5 and / or IL5RA related diseases described herein.

[0378] Non-human animal models with two or more human or chimeric genes

[0379] The present invention also provides a non-human animal with two or more human or chimeric genes, wherein the animal model comprises a human or chimeric IL5 and / or IL5RA gene and a nucleic acid sequence encoding other human or chimeric proteins. In some embodiments, the other genes are non-human animals modified with at least one gene of PD-1, PD-L1, GLP1R, OX40, NKP46, IL36R, HER2, TROP2, CD28, CTLA4, IL4, IL4R or IL5RA. In some embodiments, the non-human animal further expresses at least one human or humanized PD-1, PD-L1, GLP1R, OX40, NKP46, IL36R, HER2, TROP2, CD28, CTLA4, IL4, IL4R or IL5RA.

[0380] The present invention also provides a method for constructing a non-human animal with two or more human or chimeric genes, the method comprising:

[0381] (1) Providing the above-mentioned construction method to obtain a non-human animal;

[0382] (2) mating, in vitro fertilization, or direct gene editing of the non-human animal provided in step (1) with other genetically modified non-human animals, and screening to obtain multi-gene modified non-human animals.

[0383] In some embodiments, the other genetically modified non-human animals include non-human animals humanized with one or a combination of two or more of the genes PD-1, PD-L1, GLP1R, OX40, NKP46, IL36R, HER2, TROP2, CD28, CTLA4, IL4, IL4R or IL5RA.

[0384] In some embodiments, IL5 and / or IL5RA humanization is performed directly on a non-human animal with a modified human or chimeric PD-1, PD-L1, GLP1R, OX40, NKP46, IL36R, HER2, TROP2, CD28, CTLA4, IL4, IL4R or IL5RA gene.

[0385] Since these proteins may be involved in different mechanisms, combination therapy targeting two or more of them may be a more effective treatment method. In fact, many related clinical trials are underway and have shown good results. Multigene modified non-human animal models can be used to determine the effectiveness of combination therapy targeting two or more proteins, for example, anti-IL5 antibodies or anti-IL5RA antibodies, and additional therapeutic agents for treating cancer or metabolic diseases (e.g., obesity or cardiovascular disease). The method comprises administering an anti-IL5 antibody or anti-IL5RA antibody and an additional therapeutic agent to an animal, wherein the animal has a tumor or an immune disease, and determining the effect of the combination therapy on the immune tumor or immune disease. In some embodiments, the additional therapeutic agent is an antibody that specifically binds to PD-1, PD-L1, GLP1R, OX40, NKP46, IL36R, HER2, TROP2, CD28, CTLA4, IL4, IL4R or IL5RA. In some embodiments, the additional therapeutic agent is an anti-CTLA4 antibody (e.g., ipilimumab), an anti-PD-1 antibody (e.g., nivolumab) or an anti-PD-L1 antibody. In some embodiments, the non-human animal further comprises a sequence encoding human or humanized PD-1, a sequence encoding human or humanized PD-L1, or a sequence encoding human or humanized CTLA-4. In some embodiments, the additional therapeutic agent is an anti-PD-1 antibody (e.g., nivolumab, pembrolizumab), an anti-PD-L1 antibody, or an anti-CTLA-4 antibody. In some embodiments, the tumor comprises one or more tumor cells expressing PD-L1 and / or CTLA-4.

[0386] In some embodiments, the combination therapy can also be used to treat various cancers described herein, such as solid tumors, bladder cancer, superficial urothelial carcinoma, cervical cancer, endometrial cancer, esophageal cancer, squamous cell carcinoma, renal cancer, non-small cell lung cancer, ovarian cancer, squamous cell carcinoma, gastric cancer, uterine cancer, colorectal metastasis, liver cancer, and gastrointestinal cancer.

[0387] In some embodiments, the methods of treatment described above can be used in combination with conventional cancer chemotherapy drugs. In some embodiments, the methods of treating cancer can be used alone or in combination with the methods described herein, including treating the subject with chemotherapy, such as camphor, doxorubicin, cisplatin, carboplatin, procarbazine, methylchloroethylamine, cyclophosphamide, doxorubicin, ifosfamide, melphalan, chlorambucil, endosulfan, nitrosulfamethoxazole, dactinomycin, daunorubicin, bleomycin, prinomycin, mitomycin, etoposide, verapir, podophyllotoxin, tamoxifen, paclitaxel, transplatin, 5-fluorouracil, vincristine, vinblastine and / or methotrexate. The methods may include performing surgery on the subject to remove at least a portion of the cancer, such as removing part or all of a tumor from the patient. DETAILED DESCRIPTION

[0388] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are merely exemplary and do not constitute any limitation to the scope of the present invention. It should be understood by those skilled in the art that the details and forms of the technical solutions of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, and such modifications and replacements fall within the scope of protection of the present invention.

[0389] In each of the following examples, equipment and materials were obtained from the following companies:

[0390] ScaI, EcoRI, StuI, EcoNI, NdeI, BclI, and BgIII enzymes were purchased from NEB with catalog numbers R3122S, R0101S, R0187S, R0521S, R0111S, R0160S, and R0144S, respectively;

[0391] C57BL / 6 mice were purchased from the National Rodent Laboratory Animal Center, China Food and Drug Administration;

[0392] MOUSE IL-5 ELISA KIT was purchased from ExCell Bio, catalog number: EM019-96;

[0393] HUMAN IL-5 ELISA KIT was purchased from ExCell Bio, catalog number: EH044-96;

[0394] Brilliant Violet 510 TM Anti-mouse CD45 Antibody was purchased from Biolegend, catalog number: 103138;

[0395] Brilliant Violet 785 TM Anti-mouse / human CD11b Antibody was purchased from Biolegend, catalog number: 101243;

[0396] Brilliant Violet 711 TM Anti-mouse CD11c Antibody was purchased from Biolegend, catalog number: 117349;

[0397] PE / Cyanine7 anti-mouse CD170 (Siglec-F) Antibody was purchased from Biolegend, catalog number: 155528;

[0398] Alexa 488 Rat Anti-Mouse CD125 was purchased from BD Pharmingen TM , item number: 558533;

[0399] PE Mouse Anti-Human CD125 was purchased from BD Pharmingen TM , item number: 555902;

[0400] BioLegend PerCP anti-mouse Ly-6C Antibody was purchased from Biolegend, catalog number: 128028;

[0401] Brilliant Violet 421 TM Anti-mouse CD193 (CCR3) Antibody was purchased from Biolegend, catalog number: 144517;

[0402] V450 Rat Anti-CD11b Antibody was purchased from BD Horizon, catalog number: 560455;

[0403] FITC anti-mouse CD45 Antibody was purchased from Biolegend, catalog number: 103108;

[0404] PE Rat anti-mouse Siglec-F Antibody was purchased from BD Pharmingen, catalog number: 552126;

[0405] CD11c Monoclonal Antibody (N418), PE-Cyanine7 were purchased from BD eBioscience, catalog number: 25-0114-81;

[0406] Alexa 700 anti-mouse ly-6G was purchased from Biolegend, catalog number: 127622;

[0407] Purified anti-mouse CD16 / 32 Antibody was purchased from Biolegend, catalog number: 101302;

[0408] Fixable Viability Dye eFluor TM506 Antibody was purchased from BD eBioscience, catalog number: 65-0866-14;

[0409] Human IL5 recombinant protein was purchased from PeproTech, catalog number: 200-5;

[0410] Brilliant Violet 421 TM Anti-mouse CD193 (CCR3) Antibody was purchased from Biolegend, catalog number: 144517;

[0411] Zombie NIR TM Fixable Viability Kit was purchased from Biolegend, catalog number: 423106.

[0412] Example 1 Method for constructing IL5 gene humanized mice

[0413] A schematic diagram of the comparison of the mouse IL5 gene (NCBI Gene ID: 16191, Primary source: MGI: 96557, UniProt: P04401, located at positions 53611621 to 53615930 of chromosome 11 NC_000077.7, based on transcript NM_010558.1 and its encoded protein NP_034688.1 (SEQ ID NO: 1)) and the human IL5 gene (NCBI Gene ID: 3567, Primary source: HGNC: 6016, UniProt ID: P05113, located at positions 132541445 to 132556815 of chromosome 5 NC_000005.10, based on transcript NM_000879.3 and its encoded protein NP_000870.1 (SEQ ID NO: 2) is shown in FIG1 .

[0414] To achieve the objectives of the present invention, a nucleotide sequence encoding a human IL5 protein can be introduced into the endogenous IL5 locus of a mouse, thereby enabling the mouse to express a human or humanized IL5 protein. Specifically, the nucleotide sequence from the start codon to the stop codon of the human IL5 gene is replaced with the corresponding mouse nucleotide sequence to achieve humanization of the mouse IL5 locus. The resulting humanized IL5 locus is shown in Figure 2.

[0415] Based on Figure 2, a schematic diagram of the targeting strategy was further designed as shown in Figure 3. The diagram shows the upstream and downstream homology arm sequences of the mouse IL5 gene on the targeting vector V1, as well as the A1 segment containing the nucleotide sequence encoding the human IL5 protein. The upstream homology arm sequence (5' homology arm, SEQ ID NO: 3) is identical to nucleotides 53608127 to 53611663 of NCBI Accession No. NC_000077.7, and the downstream homology arm sequence (3' homology arm, SEQ ID NO: 4) is identical to nucleotides 53616228 to 53620795 of NCBI Accession No. NC_000077.7. The human IL5 nucleotide sequence (SEQ ID NO: 5) contained in the A1 segment is identical to nucleotides 132541811 to 132543478 of NCBI Accession No. NC_000005.10.

[0416] The targeting vector V1 also includes a resistance gene for positive clone screening, namely the neomycin phosphotransferase coding sequence Neo, and two site-specific recombination system Frt recombination sites arranged in the same direction are installed on both sides of the resistance gene to form a Neo cassette. The upstream connection between the Neo cassette and mouse IL5 is designed to be 5'- The last "T" in the sequence "GCTGT" is the last nucleotide of mouse IL5. The first "G" in the Neo box is the first nucleotide; the downstream linker of the Neo box to the mouse is designed to be 5'- The "C" in the sequence "AATTC" is the last nucleotide of the Neo box, and the sequence The first "A" in the target vector corresponds to the first nucleotide of mouse IL-5. Furthermore, a gene encoding a negative selection marker (the gene encoding the diphtheria toxin A subunit (DTA)) was constructed downstream of the 3' homology arm of the targeting vector. The mRNA sequence of the modified humanized mouse IL-5 is shown in SEQ ID NO: 8, and the expressed protein sequence is shown in SEQ ID NO: 2.

[0417] The targeting vector construction can adopt ordinary method to carry out, as enzyme digestion and connection etc.The targeting vector built is carried out preliminary verification by enzyme digestion, then sends sequencing company to carry out sequencing verification.The correct targeting vector electroporation transfection of sequencing verification is entered in the embryonic stem cell of C57BL / 6 mice, utilize positive clone screening marker gene that the cell obtained is screened, and utilize PCR and Southern Blot technology to detect the integration situation of confirming foreign gene, screen out correct positive clone cell, be identified as positive clone through PCR, then carry out Southern Blot (respectively with ScaI or EcoRI or StuI digested cell DNA and use 3 probes to hybridize, probe and purpose fragment length are as shown in Table 5) detect, exemplary results as shown in Figure 4.Further verification through sequencing finds that 8 clones numbered 1-C01, 1-E12, 2-C04, 2-D07, 3-A07, 3-F09, 4-A04 and 4-H03 are positive clones and do not have random insertion.

[0418] Table 5: Specific probes and target fragment lengths

[0419] The PCR assay included the following primers:

[0420] PCR-F: 5'-GAAGACAATAGCAGGCATGCTGGG-3' (SEQ ID NO: 9),

[0421] PCR-R: 5'-CACTCTGTTAACTAGACTGGCTTCAAC-3' (SEQ ID NO: 10);

[0422] Southern Blot assay includes the following probe primers:

[0423] 5'Probe:

[0424] 5'Probe-F: 5'-CCGTGGTTCCTGCTTCACTGCTAAC-3' (SEQ ID NO: 11),

[0425] 5'Probe-R: 5'-TGTCCATGAGTATGTGTCACGAGGA-3' (SEQ ID NO: 12);

[0426] 3'Probe:

[0427] 3'Probe-F: 5'-GCATGCATAGTAGCTGACCTCCACT-3' (SEQ ID NO: 13),

[0428] 3'Probe-R: 5'-TAGTACCCCTGAGCCTTCTGGTTCC-3' (SEQ ID NO: 14);

[0429] Neo Probe:

[0430] Neo Probe-F: 5'-GGATCGGCATTGAACAAGAT-3' (SEQ ID NO: 15),

[0431] Neo Probe-R: 5'-CAGAAGAACTCGTCAAGAAGGC-3' (SEQ ID NO: 16).

[0432] The correct positive clone cells (black mice) screened out are introduced into isolated blastocysts (white mice) according to techniques known in the art. The resulting chimeric blastocysts are transferred to culture medium for a short period of culture and then transplanted into the oviducts of recipient female mice (white mice), producing F0 generation chimeric mice (black and white). F0 generation chimeric mice are backcrossed with wild-type mice to obtain F1 generation mice, and then the F1 generation heterozygous mice are mated with each other to obtain F2 generation homozygous mice. Positive mice can also be mated with Flp tool mice to remove the positive clone screening marker gene, and then mated with each other to obtain IL5 gene homozygous mice. The genotype of the somatic cells of the offspring mice can be identified by PCR (primers are shown in Table 6). The identification results of exemplary F1 generation mice (with the Neo marker gene removed) are shown in Figure 5, among which the four mice numbered F1-1, F1-2, F1-3, and F1-4 are all positive heterozygous mice.

[0433] Table 6: Primer names and specific sequences

[0434] The expression of human IL5 protein in IL5 gene-humanized mice can be detected by ELISA. Specifically, one 8-week-old female wild-type C57BL / 6 mouse and one IL5 humanized pure heterozygous mouse were selected and euthanized by cervical dislocation. Serum was collected and assayed according to the instructions of the Mouse IL5 ELISA Kit and the Human IL5 ELISA Kit. The results are shown in Figure 6. In the wild-type C57BL / 6 mice (+ / +), only mouse IL5 protein (mIL-5) was detected; in the IL5 humanized heterozygous mice (H / +), not only mouse IL5 protein but also human IL5 protein (hIL-5) was detected. The results show that the IL5 humanized mice prepared by this method can successfully express human IL5 protein.

[0435] Example 2 Method for constructing IL5RA gene humanized mice

[0436] A schematic diagram of the comparison of the mouse IL5RA gene (NCBI Gene ID: 16192, Primary source: MGI: 96558, UniProt: P21183, located at positions 106687336 to 106725998 on chromosome 6 NC_000072.7, based on transcript NM_008370.2 and its encoded protein NP_032396.1 (SEQ ID NO: 20)) and the human IL5RA gene (NCBI Gene ID: 3568, Primary source: HGNC: 6017, UniProt ID: Q01344-1, located at positions 3066324 to 3110374 on chromosome 3 NC_000003.12, based on transcript NM_175726.4 and its encoded protein NP_783853.1 (SEQ ID NO: 21)) is shown in Figure 7.

[0437] To achieve the objectives of the present invention, a nucleotide sequence encoding a human IL5RA protein can be introduced into the mouse endogenous IL5RA locus, allowing the mouse to express a human or humanized IL5RA protein. Specifically, the mouse IL5RA locus is humanized by replacing the mouse exons 4-10 coding sequence with a sequence comprising exons 3-9 of the human IL5RA gene. A schematic diagram of the resulting humanized IL5RA locus is shown in Figure 8 . Based on Figure 8 , a targeting strategy schematic was further designed, as shown in Figure 9 , which shows the targeting vector V2 containing upstream and downstream homology arm sequences of the mouse IL5RA gene, as well as the A2 segment containing the nucleotide sequence encoding the human IL5RA protein. Among them, the upstream homology arm sequence (5' homology arm, SEQ ID NO: 22) is identical to the nucleotide sequence of positions 106721238 to 106724767 of NCBI Accession No. NC_000072.7, and the downstream homology arm sequence (3' homology arm, SEQ ID NO: 23) is identical to the nucleotide sequence of positions 106705452 to 106708451 of NCBI Accession No. NC_000072.7; the human IL5RA nucleotide sequence contained in the A2 fragment (SEQ ID NO: 24) is identical to the nucleotide sequence of positions 3092249 to 3104915 of NCBI Accession No. NC_000003.12.

[0438] The targeting vector V2 also includes a resistance gene for positive clone screening, namely the neomycin phosphotransferase coding sequence Neo, and two site-specific recombination system Frt recombination sites arranged in the same direction are installed on both sides of the resistance gene to form a Neo cassette. The upstream connection between the Neo cassette and mouse IL5RA is designed to be 5'- The last "G" in the sequence "ACAGG" is the last nucleotide of mouse IL5RA. The first "G" in the Neo box is the first nucleotide; the downstream linker of the Neo box to the mouse is designed to be 5'- The "T" in the sequence "GGCCT" is the last nucleotide of the Neo box, and the sequence The "C" in the target vector represents the first nucleotide of the mouse IL5RA. Furthermore, a gene encoding a negative selection marker (the gene encoding the diphtheria toxin A subunit (DTA)) was constructed downstream of the 3' homology arm of the targeting vector. The mRNA sequence of the engineered humanized mouse IL5RA is shown in SEQ ID NO: 27, and the expressed protein sequence is shown in SEQ ID NO: 28.

[0439] The targeting vector construction can adopt ordinary method to carry out, as enzyme digestion and connection etc.The targeting vector built is carried out preliminary verification by enzyme digestion, then sends sequencing company to carry out sequencing verification.The correct targeting vector electroporation transfection of sequencing verification is entered in the embryonic stem cell of C57BL / 6 mice, positive clone screening marker gene is utilized to screen the cell obtained, and PCR and Southern Blot technology are utilized to detect the integration situation of confirming foreign gene, screen out correct positive clone cell, be identified as positive clone through PCR and carry out Southern Blot (respectively with EcoNI or StuI or NdeI digested cell DNA and use 3 probes to hybridize, probe and purpose fragment length are as shown in Table 7) detect again, exemplary result as shown in Figure 10, further verified discovery through sequencing, be numbered 1-D09, 1-F10, 2-G08, 3-H01 and 4-H09 for positive clone and do not have random insertion.

[0440] Table 7: Specific probes and target fragment lengths

[0441] The PCR assay included the following primers:

[0442] PCR-F1:5'-ATACAACAGGCAGTGGTGGTTTCG-3' (SEQ ID NO: 29),

[0443] PCR-R1:5'-AAAGCATCTGTCTTCTGATGGGGAT-3' (SEQ ID NO: 30);

[0444] PCR-F2:5'-GCTCGACTAGAGCTTGCGGA-3' (SEQ ID NO: 31),

[0445] PCR-R2:5'-CGGTGCCTATTGGACTGACCTTACC-3' (SEQ ID NO: 32);

[0446] Southern Blot assay includes the following probe primers:

[0447] 5'Probe:

[0448] 5'Probe-F: 5'-AAAAGCAAAGGGCAGGAGACTCCAA-3' (SEQ ID NO: 33),

[0449] 5'Probe-R: 5'-GCAGGTTCCTCCACCCTGATTTTGA-3' (SEQ ID NO: 34);

[0450] 3'Probe:

[0451] 3'Probe-F: 5'-TGGTCCTTTTGCTTGAAACCTATTGT-3' (SEQ ID NO: 35),

[0452] 3'Probe-R: 5'-GAAATTCTGTGGGAAGTGTGCACTGG-3' (SEQ ID NO: 36);

[0453] Neo Probe:

[0454] Neo Probe-F: 5'-GGATCGGCATTGAACAAGAT-3' (SEQ ID NO: 15),

[0455] Neo Probe-R: 5'-CAGAAGAACTCGTCAAGAAGGC-3' (SEQ ID NO: 16).

[0456] The correctly selected positive clone cells (black mice) are introduced into isolated blastocysts (white mice) according to techniques known in the art. The resulting chimeric blastocysts are transferred to culture medium for a short period of time and then transplanted into the oviducts of recipient female mice (white mice), producing F0 generation chimeric mice (black and white). F0 generation chimeric mice are backcrossed with wild-type mice to obtain F1 generation mice. F1 generation heterozygous mice are then mated with each other to obtain F2 generation homozygous mice. Positive mice can also be mated with Flp tool mice to remove the positive clone screening marker gene, and then mated with each other to obtain mice homozygous for the IL5RA gene. The genotype of the somatic cells of the offspring mice can be identified by PCR (primers are shown in Table 8). The identification results of exemplary F1 generation mice (with the Neo marker gene removed) are shown in Figure 11, where two mice numbered F1-1 and F1-2 are both positive heterozygous mice.

[0457] Table 8: Primer names and specific sequences

[0458] Example 3 Method 2 for constructing IL5RA gene humanized mice

[0459] To achieve the objectives of the present invention, a nucleotide sequence encoding a human IL5RA protein can also be introduced into the mouse endogenous IL5RA locus, allowing the mouse to express a human or humanized IL5RA protein. Specifically, a chimeric sequence comprising a partial coding sequence of exons 3-10 of the human IL5RA gene and a partial sequence of exons 11-13 of mouse IL5RA is used to replace a portion of the nucleotide sequence of exons 5-6 of the mouse IL5RA locus, thereby achieving humanization of the mouse IL5RA locus. A schematic diagram of the resulting humanized IL5RA locus is shown in FIG12 . Based on FIG12 , a targeting strategy schematic diagram as shown in FIG13 was further designed. The schematic diagram shows the targeting vector V3 containing upstream and downstream homology arm sequences of the mouse IL5RA gene, as well as the A3 segment comprising the P2A junction segment (SEQ ID NO: 40), a partial nucleotide sequence of human IL5RA, a partial nucleotide sequence of mouse IL5RA, and a STOP sequence (SEQ ID NO: 41). Among them, the upstream homology arm sequence (5' homology arm, SEQ ID NO: 42) is identical to the nucleotide sequence from 106719697 to 106723871 of NCBI Accession No. NC_000072.7, and the downstream homology arm sequence (3' homology arm, SEQ ID NO: 43) is identical to the nucleotide sequence from 106713071 to 106717521 of NCBI Accession No. NC_000072.7; the human IL5RA nucleotide sequence contained in the A3 fragment (SEQ ID NO: 44) is identical to the nucleotide sequence from 576 to 1509 of NM_175726.4; the mouse IL5RA nucleotide sequence contained in the A3 fragment is shown in SEQ ID NO: 54.

[0460] The targeting vector V3 also includes a resistance gene for positive clone screening, namely the neomycin phosphotransferase coding sequence Neo, and two site-specific recombination system Frt recombination sites arranged in the same direction are installed on both sides of the resistance gene to form a Neo cassette. The connection between the upstream of the Neo cassette and the STOP sequence was designed as 5'-GATCCCCATCAAGCTGATCCGGAACTCGAGGTCGACGGTATCGATAAGCTTGATATCGAATTCCGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC-3'UTR (SEQ ID NO: 45), wherein the last "G" in the sequence "TCGAG" is the last nucleotide of the STOP sequence, and the first "G" in the sequence "GTCGA" is the first nucleotide of the Neo cassette; the connection between the downstream of the Neo cassette and the mouse was designed as 5'-GAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCATCAGTCAGGTACATAATGGTGGATCCgccaggaagcaaacaggaagcacaaaaaagacaagggtct-3' (SEQ ID NO: 46), wherein the last "C" in the sequence "GATCC" is the last nucleotide of the Neo cassette, and the first "G" in the sequence "gccag" is the first nucleotide of the mouse. In addition, a gene encoding a negative selection marker (the gene encoding the diphtheria toxin A subunit (DTA)) was constructed downstream of the 3' homology arm of the targeting vector. The mRNA sequence of the modified humanized mouse IL5RA is shown in SEQ ID NO: 47, and the expressed protein sequence is shown in SEQ ID NO: 48.

[0461] Alternatively, the CRISPR / Cas9 system can be used for gene editing. A schematic diagram of the targeting strategy, shown in FIG14 , was designed based on FIG12 . The diagram shows the A4 fragment on the targeting vector V4, which contains upstream homology arm (5' homology arm) and downstream homology arm (3' homology arm), as well as a partial nucleotide sequence of human IL5RA, a partial nucleotide sequence of mouse IL5RA, and a STOP sequence. The upstream homology arm sequence (5' homology arm, SEQ ID NO: 49) is identical to nucleotides 106719697 to 106720999 of NCBI accession number NC_000072.7, and the downstream homology arm sequence (3' homology arm, SEQ ID NO: 50) is identical to nucleotides 106716153 to 106717521 of NCBI accession number NC_000072.7. The mRNA sequence of the modified humanized mouse IL5RA is shown in SEQ ID NO: 47, and the expressed protein sequence is shown in SEQ ID NO: 48.

[0462] The target sequence determines the targeting specificity of the sgRNA and the efficiency of inducing Cas9 to cut the target gene. Therefore, efficient and specific target sequence selection and design are prerequisites for constructing sgRNA expression vectors. Design and synthesize sgRNA sequences that recognize the 5' and 3' target sites, and screen sgRNAs with good activity and high sequence specificity for subsequent experiments. Example target sequences are shown below:

[0463] sgRNA1 target site (SEQ ID NO: 51): 5'-TTTGCTCTTGGTCAGGATTTGGG-3'

[0464] sgRNA2 target site (SEQ ID NO: 52): 5'-GGGGGTTTCCACCCCTGACCTGG-3'

[0465] Restriction sites were added to the 5' end and complementary strand of the sgRNA to generate forward and reverse oligonucleotide sequences. After annealing, the annealed products were ligated into the pT7-sgRNA plasmid (the plasmid was first linearized with BbsI) to obtain expression vectors pT-IL5RA-1 and pT-IL5RA-2. The pT-sgRNA vector was synthesized from a plasmid. The company synthesized a fragment DNA containing the T7 promoter and sgRNA scaffold (SEQ ID NO: 53) and ligated it to the backbone vector (source: Takara, product number 3299) through restriction enzyme digestion (EcoRI and BamHI). Sequencing verification by a professional sequencing company confirmed that the target plasmid was obtained.

[0466] Pronuclear fertilized eggs of mice, such as C57BL / 6 mice, are obtained. In vitro transcription products of the expression vectors pT-IL5RA-1 and pT-IL5RA-2 plasmids (transcribed using the Ambion in vitro transcription kit according to the instructions), a premix of the targeting vector and Cas9 mRNA are injected into the cytoplasm or nucleus of the mouse fertilized eggs using a microinjector. Microinjection of the fertilized eggs is performed according to the methods described in the Mouse Embryo Handbook (3rd Edition) (Andras Nagy, Chemical Industry Press, 2006). The injected fertilized eggs are transferred to culture medium for a short period of culture and then transplanted into the oviduct of a recipient female mouse for development. The resulting mice (F0 generation) are then hybridized and selfed to expand the population and establish a stable IL5RA gene humanized mouse strain.

[0467] F0 mice identified as positive for the IL5RA gene were mated with wild-type mice to obtain F1 mice. F1 mice were mated with each other to obtain homozygous IL5RA humanized mice. Positive clones were screened by PCR, and the results are shown in Figure 15. Clones identified as positive by PCR were then subjected to Southern Blot (cell DNA was digested with BclI or BglII and hybridized using two probes, respectively. The probes and target fragment lengths are shown in Table 9). Exemplary results are shown in Figure 16. Sequencing further confirmed that six clones numbered F1-1 to F1-6 were positive clones and had no random insertions.

[0468] Table 9: Specific probes and target fragment lengths

[0469] Example 4 Preparation of IL5 / IL5RA Dual Humanized Mice

[0470] The mouse IL5 and IL5RA genes are located on chromosomes 11 and 6, respectively. To achieve dual-gene humanization of IL5 and IL5RA, the IL5 gene humanized mice prepared in Example 1 can be mated with the IL5RA humanized mice prepared in Example 2 or Example 3. The offspring mice are screened to ultimately obtain IL5 / IL5RA dual-humanized mice.

[0471] The expression of human IL5 protein in IL5 / IL5RA double humanized mice can be detected by ELISA. Specifically, one wild-type C57BL / 6 mouse and one IL5 / IL5RA double humanized homozygous mouse were selected, and serum was collected after euthanasia by cervical dislocation. The detection was performed according to the instructions of the Mouse IL5 ELISA Kit and the Human IL5 ELISA Kit. The results are shown in Figure 17. In the wild-type C57BL / 6 mice (+ / +), only the expression of mouse IL5 protein (mIL5) was detected, and the expression of human IL5 protein (hIL5) was not detected; in the IL5 / IL5RA double humanized homozygous mice (H / H), only the expression of human IL5 protein was detected, and the expression of mouse IL5 protein was not detected. The results show that the IL5 / IL5RA double humanized mice prepared by this method can successfully express human IL5 protein.

[0472] Flow cytometry was used to confirm the expression of humanized IL5RA protein in mice. Specifically, peripheral blood and bone marrow tissues were collected from 8-week-old female wild-type C57BL / 6 mice (+ / +) and IL5RA gene heterozygous mice (H / +), and the leukocyte marker antibody Brilliant Violet 510 was used to detect the expression of humanized IL5RA protein in mice. TManti-mouse CD45Antibody (mCD45), bone marrow cell marker antibody BioLegend Brilliant Violet 785 TM anti-mouse / human CD11b Antibody (mCD11b), dendritic cell marker antibody Brilliant Violet 711 TM anti-mouse CD11c Antibody (mCD11c), eosinophil marker antibody PE / Cyanine7 anti-mouse CD170 (Siglec-F) Antibody (mSiglec-F), anti-mouse IL5RA antibody Alexa Flow cytometry was performed after staining with 488 Rat Anti-Mouse CD125 Antibody (mIL5RA) and PE Mouse Anti-Human CD125 Antibody (hIL5RA). Mouse IL5RA-positive cells were characterized by mCD45+mCD11c-mCD11b+mSiglec-F+mIL5RA+, while human IL5RA-positive cells were characterized by mCD45+mCD11c-mCD11b+mSiglec-F+hIL5RA+. The results are shown in Table 10.

[0473] Table 10: Flow cytometry results

[0474] In addition, similar to the above method, flow cytometry can also be used to detect hIL5RA protein expression and immune cell subtype analysis in IL5 / IL5RA dual-gene humanized homozygous mice. Specifically, bone marrow tissues of 8-week-old female wild-type C57BL / 6 mice (+ / +) and IL5 / IL5RA dual-gene humanized homozygous mice (H / H) were selected, and in addition to the above antibodies, anti-mouse Ly-6C antibody PerCP anti-mouse Ly-6C Antibody (mLy-6C) and anti-mouse CCR3 antibody Brilliant Violet 421 were used. TM Anti-mouse CD193 (CCR3) Antibody (mCCR3) was used for identification and staining.

[0475] Protein expression results showed that in the bone marrow eosinophils of C57BL / 6 mice, 81.1% were mIL5RA-positive cells (characterized by mCD45+mLy-6C-mCD11b+mCCR3+mSiglec-F+mIL5RA+), and 9.14% were hIL5RA-positive cells (characterized by mCD45+mLy-6C-mCD11b+mCCR3+mSiglec-F+hIL5RA+). In the eosinophils of double-gene humanized homozygous mice, 7.99% were mIL5RA-positive cells (characterized by mCD45+mLy-6C-mCD11b+mCCR3+mSiglec-F+mIL5RA+), and 86.8% were hIL5RA-positive cells (characterized by CD45+CD11b+mF4 / 80+hIL5RA+).

[0476] The results of immune cell subtype analysis showed that the expression profiles of leukocyte subsets in IL5 / IL5RA dual-gene humanized homozygous mice were similar to those in C57BL / 6 mice. Therefore, the humanization of IL5 / IL5RA did not affect the differentiation of T cells (T cells), B cells (B cells), NK cells (NK cells), granulocytes (Granulacytes), monocytes (Monocytes), DC cells (Dendritic cells) and macrophages (Macrophages), nor did it affect the differentiation of CD4+T cells and CD8+T cells in T cells.

[0477] In summary, this method successfully prepared IL5 / IL5RA double humanized mice that can express human IL5 protein and humanized IL5RA protein.

[0478] Furthermore, flow cytometry was used to analyze the expression of eosinophils in B-hIL5 / hIL5RA double-gene homozygous mice. Specifically, 8-week-old male wild-type C57BL / 6 mice (+ / +) and IL5 / IL5RA double-gene homozygous mice (H / H, H / H) were selected. The experimental group (1 wild-type mouse and 1 double-gene homozygous human mouse) was intraperitoneally injected with 20 μg / 200 μL human IL5 recombinant protein (Recombinant Human IL-5 (hIL5)) for 4 consecutive days. The peripheral blood of the mice was collected on the 5th day. The blank group (1 wild-type mouse and 1 double-gene homozygous human mouse) was injected with PBS. The bone marrow cell marker antibody BioLegend Brilliant Violet 510 was used. TM anti-mouse CD45 Antibody(mCD45), BioLegend Brilliant Violet 421 TMAnti-mouse CD193 (CCR3) Antibody (mCCR3) and Purified anti-mouse CD16 / 32 Antibody were used for identification and staining. The results are shown in Table 11.

[0479] Table 11: Flow cytometry results

[0480] The results showed that due to cross-reactivity between human and mouse IL5, the number of eosinophils in the peripheral blood of wild-type mice and IL5 / IL5RA bi-gene homozygous mice in the experimental group was significantly increased compared to the control group. The number of eosinophils in the bi-gene homozygous mice in the experimental group was higher than that in wild-type mice. In summary, the constructed IL5 / IL5RA bi-gene homozygous mice can normally activate the IL-5 molecular mechanism and signaling pathway.

[0481] Example 5 Asthma model induced by ovalbumin (OVA) combined with aluminum hydroxide

[0482] Mepolizumab, developed by GlaxoSmithKline (GSK) (VH and VL sequences are shown in SEQ ID NO: 55 and SEQ ID NO: 56, respectively), is a humanized monoclonal antibody targeting IL-5. Benralizumab, developed by AstraZeneca (VH and VL sequences are shown in SEQ ID NO: 57 and SEQ ID NO: 58, respectively), is an IgG1 antibody drug targeting human IL5RA.

[0483] Eight-week-old male IL5 / IL5RA dual-gene humanized homozygous mice were selected. The modeling group was sensitized three times with intraperitoneal injections of ovalbumin (OVA) combined with aluminum hydroxide on days 0, 7, and 14 after grouping. Three weeks after the first injection, the mice were challenged with 2% OVA nebulized continuously for 5 days to induce an asthma model (see Figures 18A-18B for the modeling scheme). The blank group was injected with PBS, and samples were obtained on day 26 for analysis. When the IL5 / IL5RA dual-gene humanized homozygous mice were used for modeling, compared with the control group (PBS), the model mice had typical symptoms such as increased serum IgE levels and lung histological pathological features (analysis of infiltrating cells in the bronchoalveolar lavage fluid (BALF) showed an increase in the total number of eosinophils (Eos) (Figure 19A) and the proportion of CD45+ cells (Figure 19C), indicating that the IL5 / IL5RA dual-gene humanized homozygous mice were successfully modeled). Treatment with anti-human IL5 antibodies or anti-human IL5RA antibodies can be performed. At the end of the experiment, the efficacy of the anti-human antibodies can be evaluated by conventional methods, such as airway responsiveness testing, hematoxylin and eosin staining (HE) or immunohistochemistry (IHC) pathological testing, inflammatory cells, and IgE testing.

[0484] Multiple IL5 / IL5RA dual-gene humanized homozygous mice were randomly divided into 6 groups (see Table 12). The asthma model was induced according to the above method, among which Groups G3, G4, and G5 were drug-treated groups. After injection sensitization, the anti-human IL5 antibody Mepolizumab analog or the anti-human IL5RA antibody Benralizumab analog was intraperitoneally injected according to different dosing schedules (dosing schedules are shown in Table 12 and Figures 18A-18B).

[0485] Table 12: Grouping and medication

[0486] Bronchoalveolar lavage fluid was collected from mice and the leukocyte marker antibody FITC anti-mouse CD45 (mCD45), bone marrow cell marker antibody V450 Rat Anti-CD11b Antibody (mCD11b), and anti-mouse Brilliant Violet 605 were used. TMAfter staining with antibodies such as anti-mouse CD11c Antibody (mCD11c), eosinophil marker antibody PE / Cyanine7 anti-mouse CD170 (Siglec-F) Antibody (mSiglec-F). The results showed (Figure 19) that compared with the modeling groups (G2 and G6), the number of white blood cells (mCD45) and the number of eosinophils in the BALF of the drug-treated groups (G3, G4 and G5) decreased in the drug-treated groups, and the proportion of eosinophils in white blood cells (mCD45) decreased, indicating that the asthma symptoms of the mice were alleviated after treatment. In addition, compared with the G4 group administered with intraperitoneal injection, there was no difference in the content of eosinophils and basophils in the G5 group of mice using airway aerosol administration, indicating that the newly established airway aerosol administration method was successful.

[0487] Peripheral blood was collected for routine blood tests, including eosinophils (EO#), basophils (BASO#), eosinophil percentage (EO%), and basophil percentage (BASO%). The results are detailed in Table 13. Compared with the modeling groups (G2 and G6), the eosinophils and basophils in the mice in the drug-treated groups (G3, G4, and G5) were reduced to a certain extent. Compared with the control group G2, the eosinophils and eosinophil percentage (EO%) in the drug-treated group G3 were significantly reduced.

[0488] Table 13: Blood routine test results

[0489] In addition, lung tissues of mice were further collected and stained with H&E. The overall score was calculated based on the severity of inflammatory cell infiltration around blood vessels and bronchial tubes, bronchial mucus, and eosinophil infiltration, with scores of 0, 0.5, 1, 1.5, and 2, respectively. The results showed (Figures 20 and 21) that no obvious pathological changes were observed in the blank group G1, while increased inflammatory cell infiltration around blood vessels and bronchial tubes, eosinophil infiltration, and bronchial mucus formation were observed in the modeling groups G2 and G6. After antibody treatment, the inflammatory cell infiltration and eosinophil infiltration in the lung vessels and bronchial tubes of mice in the drug-treated groups G3, G4, and G5 were improved.

[0490] These results demonstrate that IL5 / IL5RA bi-gene homozygous humanized mice can be used to screen and evaluate the in vivo efficacy of anti-human IL5 / IL5RA antibodies. Furthermore, the newly established airway aerosol drug delivery method is successful.

[0491] Example 6 Preparation of Multigene Humanized Mice

[0492] The IL5 and / or IL5RA gene humanized mice produced by this method can also be used to prepare multi-humanized mouse models. For example, in Example 1 above, the embryonic stem cells used for microinjection can be derived from mice modified with genes containing PD-1, PD-L1, GLP1R, OX40, NKP46, IL36R, HER2, TROP2, CD28, CTLA4, IL4, or IL4R. Alternatively, based on humanized IL5 and / or IL5RA mice, double-humanized or multi-humanized mouse models can be obtained by isolating mouse ES embryonic stem cells and using gene recombination targeting technology. Homozygous or heterozygous IL5 and / or IL5RA mice obtained by this method can also be mated with other genetically modified mice, and the offspring screened. According to Mendelian inheritance, there is a certain probability of obtaining multi-gene mice modified with humanized IL5 and / or IL5RA genes and other genes. Heterozygous mice can then be mated with each other to obtain homozygous double-gene or multi-gene modified mice.

[0493] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the scope of protection of the present invention.

[0494] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any appropriate manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

[0495] In addition, the various embodiments of the present invention may be arbitrarily combined, and as long as they do not violate the concept of the present invention, they should also be regarded as the contents disclosed by the present invention.

Claims

1. A genetically modified non-human animal, characterized in that The genome of the animal comprises at least one chromosome comprising a nucleotide sequence encoding a human or chimeric interleukin 5 (IL5) protein.

2. The animal according to claim 1, characterized in that The nucleotide sequence encoding the human or chimeric IL5 protein is operably linked to endogenous regulatory elements (eg, 5'UTR and / or 3'UTR) of the endogenous IL5 locus on at least one chromosome.

3. The animal according to claim 1 or 2, characterized in that The human or chimeric IL5 protein has at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% identity to the amino acid sequence of SEQ ID NO:

2.

4. The animal according to any one of claims 1 to 3, characterized in that The nucleotide sequence encoding the human or chimeric IL5 protein is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% identical to the nucleotide sequence shown in SEQ ID NO: 5 or 8.

5. The animal according to any one of claims 1 to 4, characterized in that The animal is a mammal, such as a monkey, rodent, mouse or rat.

6. The animal according to any one of claims 1 to 5, characterized in that The animal is a mouse.

7. The animal according to any one of claims 1 to 6, characterized in that The animal does not express endogenous IL5 protein or the expression level is reduced compared to IL5 in wild-type animals.

8. The animal according to any one of claims 1 to 7, characterized in that One or more cells of the animal express human or chimeric IL5 protein.

9. The animal according to any one of claims 1 to 8, characterized in that The human or chimeric IL5 protein can bind to the endogenous IL5RA receptor and induce activation of downstream signaling pathways.

10. The animal according to any one of claims 1 to 8, characterized in that The human or chimeric IL5 protein can bind to the human IL5RA receptor and induce activation of downstream signaling pathways.

11. A genetically modified non-human animal, characterized in that The genome of the non-human animal comprises a nucleotide sequence encoding an endogenous IL5 region at an endogenous IL5 locus replaced by a nucleotide sequence encoding a corresponding region of human IL5.

12. The animal according to claim 11, characterized in that The nucleotide sequence encoding the corresponding region of human IL5 is operably linked to endogenous regulatory elements (eg, 5'UTR and / or 3'UTR) of the endogenous IL5 locus, and one or more cells of the animal express the human or chimeric IL5 protein.

13. The animal according to claim 11 or 12, characterized in that The animal does not express endogenous IL5 protein or the protein expression level is reduced compared with IL5 in wild-type animals.

14. The animal according to any one of claims 11 to 13, characterized in that The nucleotide sequence encoding the corresponding region of human IL5 includes a portion of exon 1, all of exons 2-3 and / or a portion of exon 4 of the human IL5 genome.

15. The animal according to any one of claims 11 to 14, characterized in that The nucleotide sequence encoding the corresponding region of human IL5 includes the entire nucleotide sequence of the coding region.

16. The animal according to any one of claims 11 to 15, characterized in that The nucleotide sequence encoding the corresponding region of human IL5 is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% identical to the nucleotide sequence shown in SEQ ID NO:

5.

17. The animal according to any one of claims 11 to 16, characterized in that The nucleotide sequence encoding the endogenous IL5 region includes a portion of exon 1, all of exons 2-3 and / or a portion of exon 4 of the mouse IL5 gene.

18. The animal according to any one of claims 11 to 17, characterized in that The modified IL5 gene in the genome of the animal is homozygous or heterozygous for the endogenous replaced locus.

19. A non-human animal, characterized in that The animal comprises at least one cell that contains a nucleotide sequence encoding a human or chimeric IL5 protein, wherein the human or chimeric IL5 protein comprises at least 50, 60, 70, 80, 90, 100, 110, 120, 130, 131, 132, 133 or 134 consecutive amino acids that are identical to the corresponding region of the human amino acid sequence.

20. The animal according to claim 19, characterized in that The human or chimeric IL5 protein has at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% identity to the amino acid sequence of SEQ ID NO:

2.

21. The animal according to any one of claims 19 or 20, characterized in that The nucleotide sequence encoding the human or chimeric IL5 protein is operably linked to endogenous regulatory elements (eg, 5'UTR and / or 3'UTR) of the endogenous IL5 locus in at least one chromosome.

22. The animal according to any one of claims 19 to 21, characterized in that The nucleotide sequence encoding the human or chimeric IL5 protein may be integrated into the animal's endogenous IL5 gene locus.

23. The animal according to any one of claims 19 to 22, characterized in that The humanized IL5 protein has at least one activity of mouse IL5 and / or human IL5.

24. A method for constructing a genetically modified non-human animal, characterized in that: In at least one cell of the animal, at the animal's endogenous IL5 locus, a nucleotide sequence encoding an endogenous IL5 region is replaced by a nucleotide sequence encoding a corresponding region of human IL5.

25. The animal according to claim 24, characterized in that The animal does not express endogenous IL5 protein or the protein expression level is reduced compared to IL5 in wild-type animals.

26. The method according to claim 24 or 25, characterized in that The nucleotide sequence encoding the corresponding region of human IL5 includes the entire sequence encoding human IL5 protein.

27. The method according to any one of claims 24 to 26, characterized in that: The nucleotide sequence encoding the corresponding region of human IL5 includes a portion of exon 1, all of exons 2-3 and / or a portion of exon 4 of the human IL5 gene.

28. The method according to any one of claims 24 to 27, characterized in that: The amino acid sequence encoded by the nucleotide sequence encoding the corresponding region of human IL5 comprises at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% identity with the amino acid sequence shown in SEQ ID NO:

2.

29. The method according to any one of claims 24 to 28, characterized in that: The nucleotide sequence encoding the corresponding region of human IL5 is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% identical to the nucleotide sequence shown in SEQ ID NO:

5.

30. The method according to any one of claims 24 to 29, characterized in that: The nucleotide sequence encoding the endogenous IL5 region includes a portion of exon 1, all of exons 2-3 and / or a portion of exon 4 of the mouse IL5 gene.

31. The method according to any one of claims 24 to 30, characterized in that: The nucleotide sequence encoding the corresponding region of human IL5 can be operably linked to an endogenous regulatory element or a human IL5 regulatory element, such as a promoter.

32. The method according to any one of claims 24 to 31, characterized in that: The animal is a mammal, such as a monkey, a rodent, a mouse or a rat.

33. The method according to any one of claims 24 to 32, characterized in that: The animal is a mouse.

34. A method for constructing cells of a genetically modified non-human animal expressing human or chimeric IL5 protein, the method comprising replacing a nucleotide sequence encoding an endogenous IL5 region at an endogenous mouse IL5 locus with a nucleotide sequence encoding a corresponding region of human IL5, thereby producing genetically modified non-human animal cells, wherein the animal cells express human or chimeric IL5 protein.

35. The method according to claim 34, wherein The human or chimeric IL5 protein comprises the entirety of the human IL5 protein.

36. The method according to any one of claims 34 or 35, characterized in that The amino acid sequence encoded by the nucleotide sequence encoding the corresponding region of human IL5 comprises at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% identity with the amino acid sequence shown in SEQ ID NO:

2.

37. The method according to claims 34-36, characterized in that The nucleotide sequence encoding the corresponding region of human IL5 includes a portion of exon 1, all of exons 2-3 and / or a portion of exon 4 of the human IL5 gene.

38. The method according to any one of claims 34 to 37, characterized in that: The nucleotide sequence encoding the corresponding region of human IL5 is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% identical to the nucleotide sequence shown in SEQ ID NO:

5.

39. The method according to any one of claims 34 to 38, characterized in that: The nucleotide sequence encoding the corresponding region of endogenous IL5 includes a portion of exon 1, all of exons 2-3 and / or a portion of exon 4 of the mouse IL5 gene.

40. The method according to any one of claims 34 to 39, characterized in that: The nucleotide sequence encoding the human or chimeric IL5 protein is operably linked to an endogenous regulatory element, such as a promoter.

41. The method according to any one of claims 34 to 40, characterized in that: The animal is a mammal, such as a monkey, a rodent, a mouse or a rat.

42. The method according to any one of claims 34 to 41, characterized in that: The animal is a mouse.

43. The non-human animal according to any one of claims 1 to 23, characterized in that The non-human animal comprises a nucleotide sequence of a human or chimeric protein encoded by other genes, wherein the human or chimeric protein is selected from at least one of PD-1, PD-L1, GLP1R, OX40, NKP46, IL36R, HER2, TROP2, CD28, CTLA4, IL4, IL4R or IL5RA.

44. The non-human animal according to any one of claims 43, characterized in that The human or chimeric protein is IL5RA, IL4 and / or IL4R protein.

45. The construction method according to any one of claims 24 to 42, characterized in that: The non-human animal comprises a nucleotide sequence of a human or chimeric protein encoded by other genes, wherein the human or chimeric protein is selected from at least one of PD-1, PD-L1, GLP1R, OX40, NKP46, IL36R, HER2, TROP2, CD28, CTLA4, IL4, IL4R or IL5RA.

46. ​​The construction method according to any one of claim 45, characterized in that The human or chimeric protein is IL5RA, IL4 and / or IL4R protein.

47. A genetically modified non-human animal, characterized in that The genome of the animal comprises at least one chromosome comprising a nucleotide sequence encoding a human or chimeric interleukin 5 receptor subunit alpha (IL5RA) protein.

48. The animal according to claim 47, characterized in that The nucleotide sequence encoding the human or chimeric IL5RA protein is operably linked to endogenous regulatory elements (eg, 5'UTR and / or 3'UTR) of the endogenous IL5RA locus on at least one chromosome.

49. The animal according to claim 47 or 48, characterized in that The human or chimeric IL5RA protein comprises all or part of the signal peptide, extracellular region, transmembrane and / or cytoplasmic region of the human IL5RA protein.

50. The animal according to any one of claims 47 to 49, characterized in that The human or chimeric IL5RA protein is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

21.

51. The animal according to any one of claims 47 to 50, characterized in that The human or chimeric IL5RA protein comprises all or part of the extracellular region of the human IL5RA protein.

52. The animal according to any one of claims 47 to 51, characterized in that The amino acid sequence of the extracellular region of the human or chimeric IL5RA protein is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% identical to the amino acid sequence shown in positions 21-340 or 24-323 of SEQ ID NO:

21.

53. The animal according to any one of claims 47 to 52, characterized in that The human or chimeric IL5RA protein comprises all or part of the human IL5RA protein signal peptide.

54. The animal according to any one of claims 47 to 53, characterized in that The amino acid sequence of the human or chimeric IL5RA protein signal peptide is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% identical to the amino acid sequence shown in positions 1-20 of SEQ ID NO:

21.

55. The animal according to any one of claims 47 to 54, characterized in that The amino acid sequence of the human or chimeric IL5RA protein is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% identical to the amino acid sequence shown in positions 1-340 of SEQ ID NO:

21.

56. The animal according to any one of claims 47 to 55, characterized in that The amino acid sequence of the human or chimeric IL5RA protein is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 28 or SEQ ID NO:

48.

57. The animal according to any one of claims 47 to 56, characterized in that The animal is a mammal, such as a monkey, rodent, mouse or rat.

58. The animal according to any one of claims 47 to 57, characterized in that The animal is a mouse.

59. The animal according to any one of claims 47-58, characterized in that The animal does not express endogenous IL5RA protein or the expression level is reduced compared to IL5RA in wild-type animals.

60. The animal according to any one of claims 47 to 59, characterized in that One or more cells of the animal express human or chimeric IL5RA protein.

61. The animal according to any one of claims 47 to 60, characterized in that The human or chimeric IL5RA protein can bind to endogenous IL5 ligands and induce activation of downstream signaling pathways.

62. The animal according to any one of claims 47 to 60, characterized in that The human or chimeric IL5RA protein can bind to the human IL5 ligand and induce activation of downstream signaling pathways.

63. A genetically modified non-human animal, characterized in that The genome of the non-human animal comprises a nucleotide sequence encoding a region of endogenous IL5RA at an endogenous IL5RA locus replaced by a nucleotide sequence encoding a corresponding region of human or chimeric IL5RA.

64. The animal according to claim 63, characterized in that The nucleotide sequence encoding the corresponding region of human or chimeric IL5RA is operably linked to endogenous regulatory elements (eg, 5'UTR and / or 3'UTR) of the endogenous IL5RA locus, and one or more cells of the animal express the human or chimeric IL5RA protein.

65. The animal according to claim 63 or 64, characterized in that The animal does not express endogenous IL5RA protein or expresses it at a reduced level compared to IL5RA in wild-type animals.

66. The animal according to any one of claims 63 to 65, characterized in that The nucleotide sequence encoding the corresponding region of human or chimeric IL5RA includes part of exon 3, all of exons 4-8 and / or part of exon 9 of the human IL5RA genome.

67. The animal according to any one of claims 63 to 65, characterized in that The nucleotide sequence encoding the corresponding region of human or chimeric IL5RA comprises, from 5' to 3': 1) A first sequence encoding all or part of the human IL5RA signal peptide and extracellular region; 2) a second sequence encoding all or part of the extracellular, transmembrane, and cytoplasmic regions of the mouse IL5RA protein; 68. The animal according to claim 67, characterized in that The amino acid sequence encoded by the first sequence is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% identical to the amino acid sequence set forth in positions 1-340 of SEQ ID NO: 21; and the amino acid sequence encoded by the second sequence is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% identical to the amino acid sequence set forth in positions 337-415 of SEQ ID NO: 20; 69. The animal according to claim 67 or 68, characterized in that The nucleotide sequence encoding the corresponding region of human or chimeric IL5RA comprises one or more auxiliary sequences.

70. The animal according to any one of claims 67 to 69, characterized in that The one or more auxiliary sequences comprise at least one of P2A, endogenous 3'UTR and / or STOP.

71. The animal according to any one of claims 63 to 70, characterized in that The animal genome sequence is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% identical to the nucleotide sequence shown in SEQ ID NO: 24, 27, 44 and 47.

72. The animal according to any one of claims 63 to 66, characterized in that The nucleotide sequence encoding the endogenous IL5RA region includes a portion of exon 4, all of exons 5-9, and / or a portion of exon 10 of the mouse IL5RA gene.

73. The animal according to any one of claims 67 to 70, characterized in that The nucleotide sequence encoding the endogenous IL5RA region includes a portion of exon 5 and / or a portion of exon 6 of the mouse IL5RA gene.

74. The animal according to any one of claims 63 to 73, characterized in that The modified IL5RA gene in the genome of the animal is homozygous or heterozygous for the endogenous replaced locus.

75. A non-human animal, characterized in that The animal comprises at least one cell that contains a nucleotide sequence encoding a human or chimeric IL5RA protein, wherein the human or chimeric IL5RA protein comprises at least 50, 60, 70, 80, 90, 100, 200, 300, 310, 320, 330, 340, 400, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, or 420 consecutive amino acids identical to a human corresponding region.

76. The animal according to claim 75, characterized in that The human or chimeric IL5RA protein comprises all or part of the signal peptide, extracellular region, transmembrane and / or cytoplasmic region of the human IL5RA protein.

77. The animal according to claim 75 or 76, characterized in that The human or chimeric IL5RA protein comprises all or part of the extracellular region of the human IL5RA protein.

78. The animal according to any one of claims 75 to 77, characterized in that The amino acid sequence of the extracellular region of the human or chimeric IL5RA protein is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% identical to the amino acid sequence shown in positions 21-340 or 24-323 of SEQ ID NO:

21.

79. The animal according to any one of claims 75 to 78, characterized in that The human or chimeric IL5RA protein comprises all or part of the human IL5RA protein signal peptide.

80. The animal according to any one of claims 75 to 79, characterized in that The amino acid sequence of the human or chimeric IL5RA protein signal peptide is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% identical to the amino acid sequence shown in positions 1-20 of SEQ ID NO:

21.

81. The animal according to any one of claims 75 to 80, characterized in that The amino acid sequence of the human or chimeric IL5RA protein is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% identical to the amino acid sequence shown in positions 1-340 of SEQ ID NO:

21.

82. The animal according to any one of claims 75 to 81, characterized in that The nucleotide sequence encoding the human or chimeric ILRA protein is operably linked to endogenous regulatory elements (eg, 5'UTR and / or 3'UTR) of the endogenous IL5RA locus in at least one chromosome.

83. The animal according to any one of claims 75 to 82, characterized in that The nucleotide sequence encoding the human or chimeric IL5RA protein can be integrated into the animal's endogenous IL5RA locus.

84. The animal according to any one of claims 75 to 83, characterized in that The humanized IL5RA protein has at least one activity of mouse IL5RA and / or human IL5RA.

85. A method for constructing a genetically modified non-human animal, characterized in that: In at least one cell of the animal, a nucleotide sequence encoding a region of endogenous IL5RA is replaced by a nucleotide sequence encoding a corresponding region of human or chimeric IL5RA at an endogenous IL5RA locus of the animal.

86. The animal according to claim 85, characterized in that The animal does not express endogenous IL5RA protein or expresses it at a reduced level compared to IL5RA in wild-type animals.

87. The method according to claim 85 or 86, characterized in that The nucleotide sequence encoding the corresponding region of human or chimeric IL5RA includes all or part of the sequence encoding the extracellular region of human IL5RA.

88. The method according to claim 85 or 86, characterized in that The nucleotide sequence encoding the corresponding region of human or chimeric IL5RA comprises, from 5' to 3': 1) A first sequence encoding all or part of the human IL5RA signal peptide and extracellular region; 2) a second sequence encoding all or part of the extracellular, transmembrane, and cytoplasmic regions of the mouse IL5RA protein; 89. The animal according to any one of claims 85 to 88, characterized in that The amino acids encoded by the first sequence are at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% identical to the amino acid sequence shown in positions 24-323 and / or positions 1-340 of SEQ ID NO:

21.

90. The animal according to claim 88, wherein The amino acids encoded by the second sequence are at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% identical to the amino acid sequence shown in positions 337-415 of SEQ ID NO:

20.

91. The animal according to claim 87, characterized in that The nucleotide sequence encoding the corresponding region of human or chimeric IL5RA includes part of exon 3, all of exons 4-8 and / or part of exon 9 of the human IL5RA gene.

92. The animal according to claim 91, characterized in that The nucleotide sequence encoding the corresponding region of endogenous IL5RA includes a portion of exon 4, all of exons 5-9 and / or a portion of exon 10 of the mouse IL5RA gene.

93. The animal according to claim 88, characterized in that The nucleotide sequence encoding the corresponding region of endogenous IL5RA includes a portion of exon 5 and / or a portion of exon 6 of the mouse IL5RA gene.

94. The method according to any one of claims 85-93, characterized in that The nucleotide sequence encoding the corresponding region of human or chimeric IL5RA is operably linked to an endogenous regulatory element, such as a promoter.

95. The method according to any one of claims 85-94, characterized in that The animal is a mammal, such as a monkey, a rodent, a mouse or a rat.

96. The method according to any one of claims 85-95, characterized in that The animal is a mouse.

97. A method for constructing genetically modified non-human animal cells that express human or chimeric IL5RA protein, the method comprising replacing a nucleotide sequence encoding an endogenous IL5RA region at an endogenous mouse IL5RA locus with a nucleotide sequence encoding a corresponding region of human or chimeric IL5RA, thereby producing genetically modified non-human animal cells, wherein the animal cells express human or chimeric IL5RA protein.

98. The method according to claim 97, wherein The region encoding human or chimeric IL5RA comprises all or part of the sequence encoding the human extracellular region.

99. The method according to claim 97, characterized in that The nucleotide sequence encoding the corresponding region of human or chimeric IL5RA comprises: 1) All or part of the sequence encoding the signal peptide and extracellular region of human IL5RA protein; 2) Sequences encoding all or part of the extracellular, transmembrane, and cytoplasmic regions of the mouse IL5RA protein; 100. The animal according to any one of claims 97-99, characterized in that The amino acids in the corresponding region of human or chimeric IL5RA are at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% identical to the amino acid sequence shown in positions 24-323 and / or 1-340 of SEQ ID NO:

21.

101. The animal according to claim 99, characterized in that The amino acids in the corresponding region of human or chimeric IL5RA are at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% identical to the amino acid sequence shown in positions 337-415 of SEQ ID NO:

20.

102. The animal according to claim 98, characterized in that The nucleotide sequence encoding the corresponding region of human or chimeric IL5RA includes part of exon 3, all of exons 4-8 and / or part of exon 9 of the human IL5RA gene.

103. The animal according to claim 101, characterized in that The nucleotide sequence encoding the corresponding region of endogenous IL5RA includes a portion of exon 4, all of exons 5-9 and / or a portion of exon 10 of the mouse IL5RA gene.

104. The animal according to claim 99, characterized in that The nucleotide sequence encoding the corresponding region of endogenous IL5RA includes a portion of exon 5 and / or a portion of exon 6 of the mouse IL5RA gene.

105. The method according to any one of claims 97-104, characterized in that: The nucleotide sequence encoding the corresponding region of human or chimeric IL5RA is operably linked to an endogenous regulatory element, such as a promoter.

106. The method according to any one of claims 97-1044, characterized in that The animal is a mammal, such as a monkey, a rodent, a mouse or a rat.

107. The method according to any one of claims 97 to 106, characterized in that: The animal is a mouse.

108. The non-human animal according to any one of claims 47-84, characterized in that The non-human animal comprises a nucleotide sequence of a human or chimeric protein encoded by other genes, wherein the human or chimeric protein is selected from at least one of PD-1, PD-L1, GLP1R, OX40, NKP46, IL36R, HER2, TROP2, CD28, CTLA4, IL4, IL4R or IL5.

109. The non-human animal according to claim 108, characterized in that The human or chimeric proteins are IL5, IL4 and IL4R proteins.

110. The construction method according to any one of claims 85-107, characterized in that: The non-human animal comprises a nucleotide sequence of a human or chimeric protein encoded by other genes, wherein the human or chimeric protein is selected from at least one of PD-1, PD-L1, GLP1R, OX40, NKP46, IL36R, HER2, TROP2, CD28, CTLA4, IL4, IL4R or IL5.

111. The construction method according to claim 110, characterized in that: The human or chimeric proteins are IL5, IL4 and IL4R proteins.

112. A method for determining the effectiveness of an anti-IL5 and / or IL5RA therapeutic agent in treating cancer, characterized in that: The method comprises: 1) administering an anti-IL5 and / or IL5RA therapeutic to an animal of any one of claims 1-23, 43, 47-84, and / or 108, wherein the animal has a tumor; 2) Determine the inhibitory effect of anti-IL5 and / or IL5RA therapeutic agents on tumors.

113. The method according to claim 112, characterized in that The tumor comprises one or more tumor cells, wherein the tumor cells are injected into the animal.

114. The method according to claim 112 or 113, characterized in that Determining the inhibitory effect of an anti-IL5 and / or IL5RA therapeutic agent on a tumor comprises measuring the tumor volume in the animal.

115. The method according to any one of claims 112-114, characterized in that: The tumor is cancer, malignant tumor, acute myeloid leukemia, bladder cancer, colorectal cancer, or genitourinary system cancer.

116. A method for determining the effectiveness of anti-IL5 and / or IL5RA therapeutic agents and other therapeutic agents in treating cancer, characterized in that The method comprises: 1) administering an anti-IL5 and / or IL5RA therapeutic and an additional therapeutic agent to an animal of any one of claims 1-23, 43, 47-84, and / or 108, wherein the animal has a tumor; 2) Determine the inhibitory effects of anti-IL5 and / or IL5RA therapeutics and other treatments and combinations on tumors.

117. The method according to claim 116, characterized in that The other therapeutic agent is an anti-PD-1 antibody, an anti-PD-L1 antibody and / or an anti-CTLA4 antibody.

118. The method according to claim 116 or 117, characterized in that The tumor comprises one or more tumor cells, wherein the tumor cells are injected into the animal.

119. The method according to any one of claims 116-118, characterized in that: Determining the inhibitory effect of an anti-IL5 and / or IL5RA therapeutic agent on a tumor comprises measuring the tumor volume in the animal.

120. The method according to any one of claims 116-119, characterized in that: The tumor is cancer, malignant tumor, acute myeloid leukemia, bladder cancer, colorectal cancer, or genitourinary system cancer.

121. A method for determining the effectiveness of anti-IL5 and / or IL5RA therapeutic agents in treating autoimmune diseases, characterized in that: The method comprises: 1) administering an anti-IL5 and / or IL5RA therapeutic agent to a non-human animal according to any one of claims 1-23, 43, 47-84 and / or 108, wherein the non-human animal suffers from an autoimmune disease; 2) Determine the effects of anti-IL5 and / or IL5RA therapeutics in treating autoimmune diseases.

122. The method according to claim 121, characterized in that The autoimmune diseases are systemic lupus erythematosus, systemic sclerosis, systemic vasculitis, sinusitis, and urticaria.

123. A method for determining the efficacy of anti-IL5 and / or IL5RA in treating inflammatory diseases, characterized in that: The method comprises: 1) administering an anti-IL5 and / or IL5RA therapeutic agent to an animal according to any one of claims 1-23, 43, 47-84 and / or 108; 2) Determine the therapeutic effect of anti-IL5 and / or IL5RA therapeutics on inflammatory diseases.

124. The method according to claim 123, characterized in that The inflammatory diseases are dermatitis, atopic dermatitis, and chronic obstructive pulmonary disease (COPD).

125. A method for determining the toxicity of an anti-IL5 and / or IL5RA therapeutic agent, characterized in that The method comprises: 1) administering an anti-IL5 and / or IL5RA therapeutic agent to an animal according to any one of claims 1-23, 43, 47-84 and / or 108; 2) Determine the effects of anti-IL5 and / or IL5RA therapeutics on animals.

126. The method according to claim 125, characterized in that Determining the effect of an anti-IL5 and / or IL5RA therapeutic on an animal involves measuring the animal's body weight, red blood cell count, hematocrit, and / or hemoglobin.

127. A humanized IL5 gene, characterized in that The humanized gene comprises part of exon 1, all of exons 2-3 and part of exon 4 of the human IL5 gene.

128. The humanized gene according to claim 127, characterized in that The humanized gene comprises the entire nucleotide sequence of the coding region.

129. The humanized gene according to claim 127 or 128, characterized in that The humanized gene has at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% identity with the nucleotide sequence shown in SEQ ID NO: 3, 4, 5 and 8.

130. A humanized IL5RA protein, characterized in that The humanized protein comprises all or part of the signal peptide, extracellular region, transmembrane and / or cytoplasmic region of the human IL5RA protein.

131. The humanized protein according to claim 130, characterized in that The amino acid sequence of the humanized protein is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% identical to the amino acid sequence shown in positions 24-323 and / or positions 1-340 of SEQ ID NO:

21.

132. The humanized protein according to claim 130 or 131, characterized in that The amino acid sequence of the humanized protein is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% identical to the amino acid sequence shown in SEQ ID NO: 28 and 48.

133. A humanized IL5RA gene, characterized in that The humanized IL5RA gene encodes the humanized protein according to any one of claims 130-132.

134. The humanized gene according to claim 133, characterized in that The humanized gene comprises part of exon 3, all of exons 4-8 and / or part of exon 9 of the human IL5RA gene.

135. The humanized gene according to claim 133, characterized in that The humanized gene comprises part of exon 3, all of exons 4-9 and / or part of exon 10 of the human IL5RA gene.

136. The humanized gene according to any one of claims 133-135, characterized in that The humanized gene comprises at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% identity to the nucleotide sequence shown in SEQ ID NO: 22, 23, 24, 27, 42, 43, 44, 47, 49, 50 and 54.

137. A cell, characterized in that The cell comprises the humanized gene of any one of claims 127-129 and 133-136 and the humanized IL5RA protein of any one of claims 130-132.

138. An animal model, characterized in that The animal model comprises the humanized gene described in any one of claims 127-129 and 133-136 and the humanized IL5RA protein described in any one of claims 130-132.

Images