Application of circular RNA Circ0079985 as target spot in inhibition of triple negative breast cancer cells

Abstract

The invention relates to the technical field of biology, and discloses application of circular RNA (Ribonucleic Acid) Circ0079985 as a target spot in inhibition of triple negative breast cancer, and the nucleotide sequence of the circular RNA Circ0079985 is shown in SEQ ID No: 1; the circular RNA Circ0079985 is a specific therapeutic target of the breast cancer, and the proliferation, migration and invasion capabilities of breast cancer cells can be inhibited by knocking down the circular RNA Circ0079985. A new molecular marker and a treatment target are provided for triple-negative breast cancer cells, and proliferation, migration and invasion capabilities of the triple-negative breast cancer cells can be inhibited after the circular RNA Circ0079985 is knocked down, so that rapid discovery and inhibition of the triple-negative breast cancer cells are realized, and a new thought is provided for prevention, examination and treatment of triple-negative breast cancer.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and specifically relates to the application of a circular RNA Circ_0079985 as a target in inhibiting triple-negative breast cancer cells. Background Art

[0002] Breast cancer has now become the most common malignant tumor with the first incidence rate and the second mortality rate among women. As the most frequently diagnosed cancer among women worldwide, breast cancer accounts for 25% of all cancer cases in women of all ages. Triple-negative breast cancer is the type with the most recurrence and metastasis and the worst prognosis among all types of breast cancer. As a cancer type with complex metastasis, its occurrence and development mechanism is complex, involving the regulation of a large number of signaling pathways, abnormal expression of multiple genes, and immune escape. In order to predict the development of this type of cancer and inhibit the proliferation of cancer cells, the prior art controls such cancer cells at the gene level.

[0003] For example, CircRNAs are a newly discovered class of endogenous non-coding RNAs (ncRNAs) and are the latest research hotspots in the field of RNA recently. Different from linear RNAs containing a 5' cap structure and a 3' adenosine tail, CircRNAs form a special covalently closed circular structure, having neither 5'-3' polarity nor polyadenylate tail. CircRNAs are closely related to the occurrence and development of many cancers. Research shows that CircRNAs in cancers can interact with proteins, DNAs, and RNAs, and participate in the regulation of a variety of biological processes, such as chromatin modification, transcriptional activation and inhibition, post-transcriptional regulation, immune escape, and interference with gene expression as inducers of miRNAs, etc. At the same time, they also participate in epigenetic regulation. The expression of CircRNAs is lower than that of protein-coding genes but more tissue-specific, having extremely important and complex biological significance.

[0004] However, traditional methods for finding differentially expressed circular RANs by high-throughput sequencing and other methods are inefficient and the process is cumbersome. Summary of the Invention

[0005] The purpose of the present invention is to provide an application of a circular RNA Circ_0079985 in identifying and inhibiting triple-negative breast cancer cells, so as to solve the technical problems of more steps and cumbersome process in the prior art when identifying or inhibiting the development of cancer cells.

[0006] To solve the above technical problems, the present invention specifically provides the following technical solutions:

[0007] The present invention provides an application of circular RNA Circ_0079985 as a biomarker in triple-negative breast cancer cells. The nucleotide sequence of the circular RNA Circ_0079985 is shown in SEQ ID No: 1. The circular RNA Circ_0079985 is a specific therapeutic target for breast cancer. By knocking down the circular RNA Circ_0079985, the proliferation, migration and invasion abilities of breast cancer cells can be inhibited.

[0008] As a preferred embodiment of the present invention, si-RNA for knocking out the circular RNA Circ_0079985 is provided, wherein the forward primer (5-3) of the si-RNA is shown in SEQ ID No: 2, and the reverse primer (5-3) is shown in SEQ ID No: 3.

[0009] As a preferred embodiment of the present invention, the circular RNA Circ_0079985 is a molecular biomarker for breast cancer;

[0010] The molecular biomarker is a specific diagnostic biomarker for breast cancer.

[0011] As a preferred embodiment of the present invention, the expression levels of miR-654-5p or ATF3 in cancer cells or cancer tissues are identified to determine the proliferation, migration and invasion degrees of triple-negative breast cancer cells.

[0012] The present invention provides an application of circular RNA Circ_0079985 in inhibiting triple-negative breast cancer cells. The circular RNA Circ_0079985 is a specific therapeutic target for breast cancer. By knocking down the circular RNA Circ_0079985, the proliferation, migration and invasion abilities of breast cancer cells can be inhibited.

[0013] As a preferred embodiment of the present invention, it includes the application of the Circ_0079985 / miR-654-5p / ATF3 axis in regulating the progression and immune escape of triple-negative breast cancer;

[0014] Among them, blocking the Circ_0079985 / miR-654-5p / ATF3 axis can block the promotion of apoptosis of CD8 + T cells by IL-17A in triple-negative breast cancer cells or around cancer tissues.

[0015] The present invention has the following beneficial effects compared with the prior art:

[0016] The present invention provides a therapeutic target circular RNA Circ_0079985 for inhibiting the development of cancer cells. Knocking down circular RNA Circ_0079985 can inhibit the proliferation, migration and invasion abilities of triple-negative breast cancer cells, thereby realizing the rapid discovery and inhibition of triple-negative breast cancer cells, and providing new ideas for the prevention, examination and treatment of triple-negative breast cancer.

[0017] The present invention further discloses the Circ_0079985 / miR-654-5p / ATF3 axis. By identifying the expression of miR-654-5p or ATF3 in cancer cells or cancer tissues, the proliferation, migration and invasion degrees of triple-negative breast cancer cells can be judged, providing new molecular markers and potential therapeutic targets for the treatment and prognosis of triple-negative breast cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the drawings in the following description are only exemplary, and for those of ordinary skill in the art, without creative efforts, other implementation drawings can be obtained according to the provided drawings.

[0019] Figure 1 Schematic diagram of the molecular mechanism by which the circ_0079985 / miR-654-5p / ATF3 axis mediates IL-17A to regulate CD8 + T cell apoptosis affects the progression and immune escape of triple-negative breast cancer;

[0020] Figure 2 Schematic diagram of the expression of circ_0079985, circ_0003273 and circ_0000907 detected by qRT-PCR in human mammary epithelial cell line MCF-10A and triple-negative breast cancer cell lines MDA-MB-231, MDA-MB-453 and BT-549 provided in Example 1 of the present invention;

[0021] Figure 3 Schematic diagram of the differential expression of circ_000079985 detected by fluorescence in situ hybridization in triple-negative breast cancer and adjacent tissues provided in Example 1 of the present invention;

[0022] Figure 4 Statistical chart of the differential expression of circ_0000907 in triple-negative breast cancer and adjacent tissues provided in Example 1 of the present invention, where * indicates P < 0.05 in the comparison between two groups, ** indicates P < 0.01 in the comparison between two groups, and *** indicates P < 0.001 in the comparison between two groups;

[0023] Figure 5 This is a schematic diagram showing the expression of circ_0079985 in MDA-MB-231 and BT-549 cells after knocking down circ_0079985 by qRT-PCR as provided in Example 2 of the present invention;

[0024] Figure 6 This is a schematic diagram showing the proliferation ability of MDA-MB-231 and BT-549 cells after knocking down circ_0079985 by CCK-8 as provided in Example 2 of the present invention;

[0025] Figure 7 This is a schematic diagram showing the proliferation ability of MDA-MB-231 and BT-549 cells after overexpressing circ_0079985 by CCK-8 as provided in Example 2 of the present invention;

[0026] Figure 8 This is a schematic diagram (200×) showing the invasion ability of MDA-MB-231 and BT-549 cells after knocking down circ_0079985 by Transwell as provided in Example 2 of the present invention;

[0027] Figure 9 This is a schematic diagram (200×) showing the invasion ability of MDA-MB-231 and BT-549 cells after overexpressing circ_0079985 by Transwell as provided in Example 2 of the present invention;

[0028] Figure 10 This is a schematic diagram showing the migration ability of MDA-MB-231 and BT-549 cells after knocking down circ_0079985 by scratch assay as provided in Example 2 of the present invention;

[0029] Figure 11 This is a schematic diagram showing the migration ability of MDA-MB-231 and BT-549 cells after overexpressing circ_0079985 by scratch assay as provided in Example 2 of the present invention, where * in the figure indicates P<0.05 for comparison between two groups, ** indicates P<0.01 for comparison between two groups, *** indicates P<0.001 for comparison between two groups, and **** indicates P<0.0001 for comparison between two groups;

[0030] Figure 12 This is a schematic diagram showing the differential expression of miR-654-5p in miRNAseq data of breast invasive carcinoma in the TCGA database as provided in Example 3 of the present invention. Normal group, n = 104; Tumor group, n = 1103; *** indicates P<0.001 for comparison between two groups;

[0031] Figure 13This figure shows the expression of miR-654-5p detected by qRT-PCR in human mammary epithelial cell line MCF-10A and triple-negative breast cancer cell lines MDA-MB-231, MDA-MB-453, and BT-549 in Example 3 of the present invention. *, indicates P<0.05 when comparing two groups;

[0032] Figure 14 This figure shows the predicted binding site of circ_0079985 and miR-654-5p in Example 3 of the present invention;

[0033] Figure 15 This figure shows the verification of the targeting binding relationship between circ_0079985 and miR-654-5p by dual-luciferase assay in Example 3 of the present invention. *, indicates P<0.05 when comparing two groups;

[0034] Figure 16 This figure shows the detection of miR-654-5p enrichment by circ_0079985 using RNA pull down assay in Example 3 of the present invention. **, indicates P<0.01 when comparing two groups;

[0035] Figure 17 This figure shows the box plot of differential expression of ATF3 gene in Example 3 of the present invention. Normal group, n = 3; Tumor group, n = 3;

[0036] Figure 18 This figure shows the expression of ATF3 mRNA detected by qRT-PCR in human mammary epithelial cell line MCF-10A and triple-negative breast cancer cell lines MDA-MB-231, MDA-MB-453, and BT-549 in Example 3 of the present invention. *, indicates P<0.05 when comparing two groups;

[0037] Figure 19 This figure shows the predicted binding site of miR-654-5p and ATF3 in Example 3 of the present invention;

[0038] Figure 20 This figure shows the verification of the targeting binding relationship between miR-654-5p and ATF3 by dual-luciferase assay in Example 3 of the present invention. *, indicates P<0.05 when comparing two groups;

[0039] Figure 21 This figure shows the Kaplan-Meier analysis of the correlation between the prognosis of breast cancer patients and the expression of miR-654-5p in Example 4 of the present invention;

[0040] Figure 22 This figure shows the ROC curve analysis of the accuracy of miR-654-5p in predicting the prognosis of breast cancer in Example 4 of the present invention;

[0041] Figure 23 It is a schematic diagram of Kaplan-Meier analysis of the correlation between the prognosis of breast cancer patients shown in Example 4 of the present invention and the expression of ATF3;

[0042] Figure 24 It is a schematic diagram of analyzing the accuracy of ATF3 in predicting the prognosis of breast cancer by ROC curve shown in Example 4 of the present invention;

[0043] Figure 25 It is a schematic diagram of analyzing the immune cell composition in triple-negative breast cancer samples shown in Example 4 of the present invention. The abscissa represents the sample number, the ordinate represents the relative proportion of immune cells, different colors in the bar chart represent different immune cells, and the color scale is on the right;

[0044] Figure 26 It is a heat map of the immune cell composition components shown in Example 4 of the present invention. The abscissa represents the sample number, the ordinate represents the name of immune cells, and the histogram in the upper right corner is the color scale;

[0045] Figure 27 It is a schematic diagram of analyzing the difference in immune cell components between normal breast samples and triple-negative breast cancer samples shown in Example 4 of the present invention. The abscissa represents the immune cell type, the ordinate represents the component ratio of immune cells in the samples, red is for the tumor group, and blue is for the normal group. For the normal group, n = 17; for the tumor group, n = 48;

[0046] Figure 28 It is a schematic diagram of the expression of miR-654-5p detected by qRT-PCR after treating MDA-MB-453 cells with miR-654-5p mimic shown in Example 5 of the present invention;

[0047] Figure 29 It is a schematic diagram of the expression of ATF3 detected by qRT-PCR after treating MDA-MB-453 cells with miR-654-5p mimic shown in Example 5 of the present invention;

[0048] Figure 30 It is a schematic diagram of the protein expression level of ATF3 in MDA-MB-231 cells detected by ELISA after treating with miR-654-5p mimic shown in Example 5 of the present invention;

[0049] Figure 31 It is a schematic diagram of Transwell detecting the migration and invasion abilities of MDA-MB-453 cells in each group (200×) shown in Example 5 of the present invention. In the figure, * indicates P < 0.05 for comparison between two groups, ** indicates P < 0.01 for comparison between two groups, and *** indicates P < 0.001 for comparison between two groups;

[0050] Figure 32 Schematic diagram of qRT-PCR detection of mRNA expression of IL-17A in MDA-MB-231 cells in each group provided in Example 6 of the present invention;

[0051] Figure 33 Schematic diagram of ELISA detection of protein level of IL-17A in MDA-MB-231 cells in each group provided in Example 6 of the present invention;

[0052] Figure 34 Schematic diagram of flow cytometry detection of apoptosis of CD8 + T cells after co-culture with MDA-MB-231 cells in each group provided in Example 6 of the present invention;

[0053] Figure 35 Schematic diagram of CCK-8 detection of proliferation ability of MDA-MB-231 cells in each group provided in Example 6 of the present invention;

[0054] Figure 36 Schematic diagram of Transwell detection of migration and invasion ability of MDA-MB-231 cells in each group (200×) provided in Example 6 of the present invention. In the figure, * indicates P<0.05, ** indicates P<0.01, and *** indicates P<0.001. Detailed implementation manners

[0055] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0056] The present invention provides an application of circular RNA Circ_0079985 in identifying and inhibiting triple-negative breast cancer cells, wherein the circ_0079985 / miR-654-5p / ATF3 axis mediates IL-17A to regulate CD8 + T cell apoptosis affects the progression and immune escape of triple-negative breast cancer.

[0057] The schematic diagram of the molecular mechanism by which the circ_0079985 / miR-654-5p / ATF3 axis mediates IL-17A to regulate CD8 + T cell apoptosis affects the progression and immune escape of triple-negative breast cancer is shown in Figure 1 the figure.

[0058] The following examples are provided to illustrate the molecular function of circular RNA Circ_0079985 in triple-negative breast cancer cells.

[0059] Example 1:

[0060] circ_0079985 is highly expressed in triple-negative breast cancer tissues and cells

[0061] Bioinformatics analysis and experimental detection were carried out. Differential analysis was performed on the public sequencing data (GSE113230) of the GEO database, and 94 breast cancer-related circRNAs were retrieved through the CircFunBase database. The intersection of these circRNAs and the differentially expressed circRNAs screened out from the public data analysis was taken, and 3 candidate circRNAs were obtained, among which circ_0079985 was significantly highly differentially expressed.

[0062] The expression of these three circRNAs was verified in 3 triple-negative breast cancer cell lines. The qRT-PCR detection results showed that circ_0079985 was significantly highly expressed ( Figure 2 ). The expression of circ_0079985 was verified in 40 pairs of breast cancer and adjacent tissues. The fluorescence in situ hybridization results showed that circ_0079985 was significantly highly expressed in breast cancer tissues compared with adjacent tissues ( Figures 3 - 4 ), and the difference was statistically significant, which was consistent with the results in the database.

[0063] After verification, it can be preliminarily determined that circular RNA Circ_0079985 can be used as a molecular marker for triple-negative breast cancer and can be used for cancer cell detection and cancer stage judgment.

[0064] hsa circ 0079985|NR 003655|POLR2J4:

[0065] SEQ ID No: 1:

[0066] GACAGCCACAGTGTGGAAGACCCTGTGCCCCTTCTGGGGTGAGGAGTACCAAGTGCACCTGCCGCCCACCTTCCACGCTGTGGCTTTCTACGTCATGGATGAGGATGCCCTCAGCCGGGACGACGTTATCGGAAAGGTCTGCCTTACAAGGGACACCATA GCTTCTCACCCTAAGG

[0067] The following verifies the function of circular RNA Circ_0079985 through examples.

[0068] Example 2:

[0069] Knockdown of circ_0079985 in MDA-MB-231 and BT-549 cell lines, and the knockdown efficiency was verified by qRT-PCR. It was found that the knockdown efficiency of si-circ_0079985#1 was better than that of si-circ_0079985-2( Figure 5 ). Lentivirus transfection was used to overexpress circ_0079985, and the overexpression efficiency was verified by qRT-PCR, and the overexpression efficiency was good.

[0070] Cell proliferation, migration and invasion were detected by CCK-8, Transwell and scratch assays. The results showed that compared with the NC group, the proliferation, migration and invasion abilities of MDA-MB-231 and BT-549 cells in the si-circ_0079985 group were significantly decreased, and the proliferation, migration and invasion abilities of MDA-MB-231 and BT-549 cells in the overexpression circ_0079985 group were significantly enhanced( Figures 6 - 11 ).

[0071] In si-circ_0079985#1, the si-RNA used to knock out the circular RNA Circ_0079985, wherein the forward primer (5-3) of the si-RNA is shown in SEQ ID No: 2, and the reverse primer (5-3) is shown in SEQ ID No: 3.

[0072] Thus, knockdown of circ_0079985 can inhibit the proliferation, migration and invasion abilities of cancer cells.

[0073] Example 3: Expression mechanism of circ_0079985

[0074] By retrieving miRNAs regulated by circ_0079985 through circBank and starbase databases, 14 and 5 miRNAs were obtained respectively, and the intersection was taken to obtain hsa-miR-4761-3p (miR-4761-3p) and hsa-miR-654-5p (miR-654-5p).

[0075] By analyzing the miRNAseq data of level 3 BCGSC miRNAProfiling in the BRCA (breast invasive carcinoma) project in the TCGA database, it was obtained that miR-654-5p was significantly lowly expressed in breast cancer( Figure 12 ). The expression of miR-654-5p in triple-negative breast cancer cells was verified by qRT-PCR, and it was found that miR-654-5p was significantly lowly expressed( Figure 13 ).

[0076] Further prediction by RNA22 showed that circ_0079985 has a binding site with miR-654-5p Figure 14 ). Then, dual-luciferase verification showed that circ_0079985 can bind to the miR-654-5p binding region Figure 15 ). RNA pull down experiment confirmed that circ_0079985 can enrich miR-654-5p Figure 16 ).

[0077] Gene differential expression analysis was performed on public sequencing data, and a total of 658 significantly differentially expressed genes were obtained, including 335 up-regulated genes and 323 down-regulated genes. Then, the target genes of hsa-miR-654-5p were predicted through TargetScan, miRWalk and mirDIP databases, and then intersected with the differentially expressed genes screened out, and a total of 6 candidate target genes (ATF3, FLT4, KALRN, CALN1, LSM12 and AFF3) were obtained.

[0078] The differential analysis results showed that ATF3 had the most significant differential high expression Figure 17 ), and qRT-PCR verification showed that ATF3 was significantly highly expressed in triple-negative breast cancer cells Figure 18 ). The binding site between miR-654-5p and ATF3 was predicted by miRmap Figure 19 ), and dual-luciferase verification showed that miR-654-5p can target and bind to the 3'-UTR region of ATF3 Figure 20 ).

[0079] According to Example 3, the circ_0079985 / miR-654-5p / ATF3 axis is involved in regulating the progression of triple-negative breast cancer.

[0080] The following Example 4 illustrates the relationship between the expression of miR-654-5p and ATF3 and the prognosis of breast cancer patients

[0081] Example 4:

[0082] The results of Kaplan-Meier survival curve analysis showed that the survival rate of patients with high miR-654-5p expression was higher, while that of patients with low miR-654-5p expression was lower, indicating that patients with low miR-654-5p expression had a poor prognosis Figure 21) Receiver operating characteristic (ROC) analysis was performed, and the results showed that the area under the ROC curve (AUC) was 0.806, indicating that miR-654-5p had a certain accuracy in predicting the prognosis of breast cancer. Figure 22 )

[0083] Similarly, through Kaplan-Meier survival curve and ROC curve analysis, it was found that patients with high expression of ATF3 had a poor prognosis, and the AUC of ATF3 was 0.870, indicating that it had a certain accuracy in predicting the prognosis of breast cancer. Figures 23 - 24 )

[0084] The above results suggest that the expressions of miR-654-5p and ATF3 are related to the prognosis of breast cancer patients. Patients with poor prognosis have low expression of miR-654-5p and high expression of ATF3.

[0085] Furthermore, by searching for ATF3-related genes on the genemania website, a total of 20 ATF3-related genes were obtained. The results of GO and KEGG enrichment analysis of ATF3-related genes showed that ATF3-related genes were mainly enriched in 4 terms in biological process (BP); ATF3-related genes were mainly enriched in 3 terms in cellular component (CC); ATF3-related genes were mainly enriched in 5 terms in molecular function (MF). KEGG pathway analysis found that candidate genes were mainly enriched in the IL-17 signaling pathway term.

[0086] To explore which immune cells are regulated by the IL-17 signaling pathway during the development of breast cancer, differential analysis was performed on the GSE61725 dataset in the GEO database. Figures 25 - 26 It was found that there were differences in the proportions of various types of cells in the tumor group. Further differential analysis of immune cell components in the normal group and the tumor group found that CD8 + T cells had a significantly lower proportion in triple-negative breast cancer tumor samples than in normal breast samples. Figure 27 )

[0087] Thus, by detecting the expressions of miR-654-5p and ATF3, the development of triple-negative breast cancer tumors in patients can be inferred, providing a new direction for the detection of triple-negative breast cancer tumors. When the expression of miR-654-5p is low and the expression of ATF3 is high, the development of triple-negative breast cancer tumors is better.

[0088] The following in vitro experiments of Example 5 show that circular RNA Circ_0079985 can be used as an inhibitory target for triple-negative breast cancer cells. Among them, the circ_0079985 / miR-654-5p / ATF3 axis can promote the proliferation, migration and invasion of triple-negative breast cancer cells, and knocking down circ_0079985 can inhibit the proliferation, migration and invasion of triple-negative breast cancer cells.

[0089] Example 5:

[0090] Knock down circ_0079985 in the MDA-MB-231 cell line, and verify the knockdown efficiency by qRT-PCR. The knockdown efficiency of si-circ_0079985#1 is good. Compared with the si-NC group, the expression of miR-654-5p in the si-circ_0079985#1 group of cells is significantly up-regulated. Select si-circ_0079985#1 for subsequent experiments.

[0091] Then, MDA-MB-231 cells were treated with miR-654-5p mimic. It was detected by qRT-PCR that, compared with the NC mimic group, the expression of miR-654-5p in the miR-654-5p mimic group of cells was significantly increased ( Figure 28 ), while the expression of ATF3 was significantly decreased ( Figure 29 ).

[0092] ELISA was used to detect the ATF3 protein level and it was found that: compared with the NC mimic group, the ATF3 protein level in the miR-654-5p mimic group of cells was significantly decreased ( Figure 30 ).

[0093] qRT-PCR detection showed that: compared with the NC group, the expressions of circ_0079985 and ATF3 in the si-circ_0079985 group cells were significantly decreased, while the expression of miR-654-5p was significantly increased; compared with the si-circ_0079985 group, the expression of circ_0079985 in the si-circ_0079985 + miR-654-5p inhibitor group cells had no significant change, the expression of ATF3 was significantly increased, and the expression of miR-654-5p was significantly decreased; the expressions of circ_0079985 and miR-654-5p in the si-circ_0079985 + oe-ATF3 group cells had no significant change, while the expression of ATF3 was significantly increased. ELISA detection of the protein level of ATF3 found that: compared with the NC group, the protein level of ATF3 in the si-circ_0079985 group cells was significantly decreased; compared with the si-circ_0079985 group, the protein level of ATF3 in the si-circ_0079985 + miR-654-5p inhibitor group cells was significantly increased.

[0094] Cell proliferation, migration and invasion were detected by CCK-8 and Transwell assays, and the results showed that: compared with the NC group, the abilities of cell proliferation, migration and invasion in the si-circ_0079985 group cells were significantly decreased; compared with the si-circ_0079985 group, the abilities of cell proliferation, migration and invasion in the si-circ_0079985 + miR-654-5p inhibitor group and si-circ_0079985 + oe-ATF3 group cells were significantly enhanced( Figure 31 ).

[0095] Thus, increasing the expression of miR-654-5p can inhibit the abilities of cell proliferation, migration and invasion. Circular RNA Circ_0079985 inhibits the expression of miR-654-5p. By knocking down circular RNA Circ_0079985, the expression of miR-654-5p can be increased, and the abilities of cell proliferation, migration and invasion can be decreased.

[0096] The following Example 6 illustrates that circ_0079985 / miR-654-5p / ATF3 promotes CD8 + T cell apoptosis by activating IL-17A, thereby promoting the progression and immune escape of triple-negative breast cancer cells.

[0097] Example 6:

[0098] The results of qRT-PCR and ELISA showed that: compared with the NC group, the expression level of IL-17A in the si-circ_0079985 group was significantly decreased; while compared with the si-circ_0079985 group, the expression levels of IL-17A in the si-circ_0079985 + miR-654-5p inhibitor group and the si-circ_0079985 + oe-ATF3 group were significantly increased( Figures 32 - 33 ).

[0099] It can be seen that knocking down circ_0079985 can inhibit ATF3 by promoting the expression of miR-654-5p, thereby inhibiting the expression of IL-17A.

[0100] While knocking down circ_0079985 in MDA-MB-231 cells, the cells were treated with recombinant IL-17A protein. To simulate the tumor microenvironment, MDA-MB-231 cells were co-cultured with CD8 + T cells. The results of flow cytometry showed that: compared with the si-NC group, the apoptosis of CD8 + T cells in the si-circ_0079985 group was reduced; while compared with the si-circ_0079985 group, the apoptosis of CD8 + T cells in the si-circ_0079985 + IL-17A group was increased( Figure 34 ).

[0101] It can be seen that knocking down circ_0079985 can reduce the apoptosis of CD8 + T cells by inhibiting the expression of IL-17A.

[0102] Detection of the proliferation, migration and invasion of triple-negative breast cancer cells in each group showed that: compared with the si-NC group, the proliferation, migration and invasion abilities of MDA-MB-231 cells in the si-circ_0079985 group were significantly decreased; while compared with the si-circ_0079985 group, the proliferation, migration and invasion abilities of MDA-MB-231 cells in the si-circ_0079985 + IL-17A group were significantly enhanced( Figures 35 - 36 ).

[0103] The above results indicate that knocking down circ_0079985 may inhibit the progression and immune escape of triple-negative breast cancer by inhibiting the expression of ATF3, inhibiting the activation of IL-17A, and reducing the apoptosis of CD8 + T cells.

[0104] The application of circular RNA Circ_0079985 in the identification and inhibition of triple-negative breast cancer cells according to this embodiment can provide new molecular markers and therapeutic targets for triple-negative breast cancer cells. After knocking down circular RNA Circ_0079985, the proliferation, migration and invasion abilities of triple-negative breast cancer cells can be inhibited, thereby realizing the rapid discovery and inhibition of triple-negative breast cancer cells, and providing new ideas for the prevention, examination and treatment of triple-negative breast cancer.

[0105] The above embodiments are only exemplary embodiments of the present application and are not used to limit the present application. The protection scope of the present application is defined by the claims. Those skilled in the art can make various modifications or equivalent replacements within the essence and protection scope of the present application, and such modifications or equivalent replacements should also be regarded as falling within the protection scope of the present application.

Claims

1. A use of circular RNA Circ_0079985 as a target in inhibiting triple-negative breast cancer, characterized in that: The nucleotide sequence of the circular RNA Circ_0079985 is shown in SEQ ID No: 1; The circular RNA Circ_0079985 is a specific therapeutic target for breast cancer. By knocking down the circular RNA Circ_0079985, the proliferation, migration and invasion ability of breast cancer cells can be inhibited.

2. The use of circular RNA Circ_0079985 in inhibiting triple-negative breast cancer cells according to claim 1, characterized in that: It includes si-RNA for knocking out the circular RNA Circ_0079985, wherein the si-RNA forward primer (5-3) is shown in SEQ ID No: 2, and the reverse primer (5-3) is shown in SEQ ID No:

3.

3. The use of a circular RNA Circ_0079985 as a target in inhibiting triple-negative breast cancer according to claim 1, characterized in that: Including the application of Circ_0079985 / miR-654-5p / ATF3 axis in regulating triple-negative breast cancer progression and immune escape; Among them, blocking the Circ_0079985 / miR-654-5p / ATF3 axis can block the effect of IL-17A on CD8 + Promotion of T cell apoptosis.

4. Use of circular RNA Circ_0079985 as a marker in triple-negative breast cancer cells, characterized in that: The nucleotide sequence of the circular RNA Circ_0079985 is shown in SEQ ID No:

1.

5. The use of a circular RNA Circ_0079985 as a marker in triple-negative breast cancer cells according to claim 3, characterized in that: The circular RNA Circ_0079985 is a molecular marker for breast cancer; The molecular marker is a specific diagnostic marker for breast cancer.

6. The use of a circular RNA Circ_0079985 as a marker in triple-negative breast cancer cells according to claim 5, characterized in that: The expression of miR-654-5p or ATF3 in cancer cells or cancer tissues was identified to determine the degree of proliferation, migration and invasion of triple-negative breast cancer cells.

Images