A kind of chroococcidiopsis and preparation method and application in prevention and treatment of maize basal stem rot

Abstract

The application discloses a Talaromyces purpureogenitus and a preparation method and application in prevention and treatment of maize basal stem rot, and provides a new strain, Talaromyces purpureogenitus Jnf41. The greenhouse prevention and treatment experiment shows that the Talaromyces purpureogenitus Jnf41 can inhibit the lesion area and lesion length of maize basal stem rot in the greenhouse prevention and treatment experiment, can effectively inhibit the infection of maize basal stem rot, and the pathogenic bacteria are not easy to produce drug resistance. The prevention and treatment process implements green prevention and control, and the biological preparation against maize basal stem rot is prepared. The biological preparation has important significance for green prevention and control of maize basal stem rot.

Description

Technical Field

[0001] The invention provides a purple-blue fungus and a preparation method, and further discloses application of the purple-blue fungus in preventing and treating corn stalk rot, belonging to the field of agricultural pest and disease biotechnology. Background Art

[0002] Corn has the advantages of drought resistance, cold resistance and high adaptability to the natural environment. Therefore, the high quality and high yield of corn plays an extremely important role in ensuring important industries such as food, medicine, and light industry. However, the occurrence of corn stalk rot has seriously affected corn yield. Corn stalk rot mainly harms the leaves and stems, and in severe cases can cause the whole plant to die. The pathogens of corn stalk rot vary in different ecological regions. Fusarium graminearum ( Fusarium graminearum ) is the main pathogen. Currently, corn stalk rot is becoming increasingly serious in corn-producing areas around the world, causing great harm to the development of the corn industry.

[0003] Traditional methods for controlling corn stalk rot include agricultural control, chemical control, and biological control. Agricultural control primarily involves breeding highly resistant varieties and strengthening field management. Currently, Xianyu 335, Zhengdan 958, and their improved varieties often exhibit high yields, but their resistance to stalk rot is poor, leading to a risk of lodging in later stages. During field planting, appropriate planting density, timely drainage, and proper field hygiene are crucial. Post-harvest removal of diseased debris is crucial to reduce the initial source of infection. Chemical control is ineffective against stalk rot. Currently, chemical seed dressings containing ingredients such as metalaxyl-M are often used to prevent the disease. Based on the principle of "prevention first, integrated control," when using chemical pesticides to control the disease, greater attention should be paid to environmental pollution caused by pesticide residues and pesticide resistance. Overall, agricultural and chemical control methods are difficult to implement and generally ineffective. Therefore, biological control, using bacteria to combat bacteria, will be an important approach to controlling corn stalk rot. Summary of the Invention

[0004] The present invention provides a purple-blue fungus Jnf41 and a preparation method thereof. The novel biological strain can be used for the prevention and treatment of corn stalk rot, thereby solving the problems of low prevention and treatment efficiency of corn stalk rot and environmental pollution in the prior art.

[0005] The purple-producing tularensis Jnf41 of the present invention is named: purple-producing tularensis Talaromyces purpureogenus , deposited in the General Microbiology Center of China Culture Collection Administration, the deposit date is January 16, 2025, and the deposit number is: CGMCC NO.41757.

[0006] The present invention provides a spore suspension method for T. purpurogenum Jnf41. The spore suspension method comprises placing the T. purpurogenum Jnf41 in a PDB culture medium and rotating the culture medium at 25-28° C. and 150-180 rpm for 3-5 days.

[0007] The present invention further provides a spore suspension of T. purpurogenum Jnf41 obtained by applying the method.

[0008] The present invention provides the use of the purple-producing fungus Jnf41 or the spore suspension in inhibiting Fusarium graminearum.

[0009] Specifically, the purple-producing fungus Jnf41 or the spore suspension is used to prevent and control corn stalk rot.

[0010] Specifically, the spore number of the spore suspension of T. purpurogenum Jnf41 is 1×10 8 .

[0011] Specifically, the spore suspension of T. purpurogenum Jnf41 is applied to the roots of corn when the corn reaches the four-leaf stage.

[0012] The present invention provides a fungal agent for preventing and controlling corn stalk rot, wherein the fungal agent comprises the purple Talaromyces Jnf41 or a spore suspension of the purple Talaromyces Jnf41.

[0013] Specifically, the bacterial agent includes microbiologically acceptable excipients; optionally, the excipients include one or a combination of surfactants, stabilizers, antifreeze agents, thickeners, disintegrants, plant growth regulators, and carriers.

[0014] The present invention provides an effective prevention and control method for corn stalk rot. The plate confrontation test verifies that the purple-producing fungus Jnf41 provided by the present invention is effective against the pathogenic fungus Fusarium graminearum of corn stalk rot ( F. graminearum ) has an inhibitory effect, with an inhibition rate of more than 84.71%. The purple basket fungus Jnf41 provided by the present invention can prevent and control corn stalk rot by inhibiting Fusarium graminearum.

[0015] The present invention shows through greenhouse prevention experiments that the purple-producing fungus Jnf41 can inhibit the lesion area and lesion length of corn stalk rot in the greenhouse prevention effect determination, indicating that the purple-producing fungus Jnf41 can effectively inhibit the infection of corn stalk rot, which is of great significance for the green prevention and control of corn stalk rot.

[0016] The positive effects of the present invention are:

[0017] A new strain, the purple-producing fungus Jnf41, is provided. Greenhouse control experiments show that the purple-producing fungus Jnf41 can inhibit the lesion area and lesion length of corn base rot in greenhouse control tests, and can effectively inhibit the infection of corn base rot. The pathogen is not easy to develop drug resistance. Green control is implemented in the prevention and control process, and a biological agent against corn base rot is prepared, which is of great significance for the green control of corn base rot. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The morphological identification results of the purple-producing fungus Jnf41 provided in the embodiment of the present invention: A is a colony morphology on PDA culture medium, B is a colony morphology on OA culture medium, and C is a mycelium morphology of the purple-producing fungus Jnf41 on PDA;

[0019] Figure 2 Phylogenetic tree diagram based on DNA gene amplification by ITS1 and ITS4 primers provided for the implementation of the present invention;

[0020] Figure 3 Results of a plate confrontation experiment between the purple-producing fungus Jnf41 and Fusarium graminearum provided in an embodiment of the present invention: A is a colony morphology of Fusarium graminearum on a PDA culture medium, and B is a confrontation image of the purple-producing fungus Jnf41 and Fusarium graminearum on a PDA culture medium;

[0021] Figure 4 The results of the greenhouse control experiment of the purple-producing fungus Jnf41 on corn stalk rot provided in the embodiment of the present invention are as follows: CK is a PDB liquid culture medium used to treat corn roots, and Jnf41 is a fermentation liquid of the purple-producing fungus used to treat corn roots;

[0022] Figure 5 The statistical results of the lesion length of the greenhouse control experiment of the purple-producing fungus Jnf41 on corn stalk rot provided by the embodiment of the present invention are as follows: wherein the vertical axis represents the lesion length, and a and b represent significant differences between the lesion lengths. P <0.05. DETAILED DESCRIPTION

[0023] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0024] To solve the problem of low prevention efficiency of corn basal stem rot in the prior art, the present embodiment provides a Talaromyces purpureogenus Jnf41 and its application in prevention and treatment of corn basal stem rot. T. purpureogenus The Talaromyces purpureogenus Jnf41 is preserved in the China General Microbiological Culture Collection Center with a preservation number of CGMCC NO.: 41757. The present embodiment provides a new effective prevention method for corn basal stem rot, and the prevention process is safe and environmentally friendly, and the pathogenic bacteria are not prone to drug resistance.

[0025] The present embodiment provides a preparation method of Talaromyces purpureogenus Jnf41 spore suspension, and the Talaromyces purpureogenus Jnf41 is cultured in a PDB culture medium; the culture temperature is 25-28℃, and the culture is performed at a rotation speed of 150-180 rpm for 3-5 days to obtain the Talaromyces purpureogenus Jnf41 spore suspension.

[0026] The Talaromyces purpureogenus provided by the present embodiment can inhibit the growth of Fusarium graminearum, and has good bacteriostatic effect.

[0027] Preferably, the Talaromyces purpureogenus Jnf41 spore suspension has a spore concentration of 1×10 8 / mL, and is applied by root irrigation when the corn grows to the four-leaf stage. Experiments prove that the Talaromyces purpureogenus Jnf41 can effectively inhibit the infection of Fusarium graminearum on corn.

[0028] Experiments prove that the Talaromyces purpureogenus Jnf41 or the Talaromyces purpureogenus Jnf41 spore suspension provided by the present embodiment has a significant inhibitory effect on corn basal stem rot, provides materials for biological control of corn basal stem rot, and provides a new idea and theoretical basis for further development of biocontrol agents.

[0029] The technical solutions of the present application will be further described below in combination with specific embodiments. Embodiment 1

[0030] The present embodiment provides a strain separation and verification experiment of Talaromyces purpureogenus Jnf41. 2 g of soil (collected from a rice field in Wuhu County, Wuhu City, Anhui Province) is placed in a conical flask containing 98 mL of sterile water, shaken in a 180 rpm shaker for 30 min, and the supernatant is taken, gradient diluted with sterile water, and 200 μL of soil dilution liquid at gradients of 10 -2 , 10 -3 and 10 -4 is coated on PDA culture medium, placed in a 28℃ incubator for inverted culture for 5 days, and the color, gloss, size and type of different colonies on the plate are observed and marked, the marked colonies are picked with a puncher, and placed in PDA culture medium in the form of a bacterial cake for purification culture, and when single colonies grow on the plate, the single colonies are picked and placed in PDA slant culture medium and stored at 4℃.

[0031] For morphological identification, microscopic and macroscopic morphological analysis were performed. The isolated strains were cultured on PDA and oatmeal agar (OA) for 7 days. The morphological characteristics of strain Jnf41 are shown in Figure 2. Figure 1 As shown, after being cultured on PDA medium in a constant temperature box at 28°C for 7 days, the colony diameter was 38-40 mm, the mycelium was light orange, the texture was flocculent, and the density of conidia was moderate; after being cultured on OA medium in a constant temperature box at 28°C for 7 days, the colony diameter was 34-37 mm, the mycelium was white or bright orange, the texture was velvety or flocculent; the mycelium was broom-shaped, and the spherical conidia were connected to the top of the broom-shaped branches. Example 2

[0032] The method for extracting fungal DNA is as follows:

[0033] (1) Based on the antagonistic effect on the plate, the effective strains screened were sequenced to identify their species. First, the DNA of the biocontrol fungi group was extracted;

[0034] (2) Freeze the fungal sample in liquid nitrogen and then quickly take it out and grind it in a ball mill (25-30 Hz, 40-60 s).

[0035] (3) Add 400 µL of CTAB to each centrifuge tube and incubate in a 65°C water bath for 1 h, flipping every 20 min.

[0036] (4) After cooling, add an equal volume of chloroform:isoamyl alcohol (24:1) (400 μL), mix well, and centrifuge at 11,000 rpm for 10 min.

[0037] (5) Aspirate the supernatant, add 0.6 times the volume of isopropanol, mix gently, and place at -20°C for 30 minutes to 2 hours;

[0038] (6) Transfer it to a centrifuge and centrifuge at 11,000 rpm for 10 min. Pour off the supernatant and add 900 μL of 70% ethanol to the precipitate. Stir gently and then transfer it to a centrifuge and centrifuge at 11,000 rpm for 10 min.

[0039] (7) Pour off the supernatant, place in a centrifuge, centrifuge at 11000 rpm for 10 min, aspirate excess ethanol, and dry;

[0040] (8) Add 20-30 μL ddH2O to dissolve and place in a -20℃ refrigerator for later use.

[0041] The PCR method and procedure are as follows:

[0042] The universal primers ITS1 and ITS4 were used to amplify the ITS sequence of the fungal Jnf41. The universal primers were designed as follows:

[0043] The forward primer was ITS1: TCCGTAGGTGAACCTGCGG (SEQ ID NO: 1);

[0044] The reverse primer was ITS4: TCCTCCGCTTATTGATATGC (SEQ ID NO: 2);

[0045] Prepare the bacterial PCR solution according to the system in Table 1:

[0046] Table 1 PCR reaction system

[0047]

[0048] According to the system shown in Table 1 above, the mixed reagents were placed into the PCR instrument. The PCR reaction conditions were as shown in Table 2:

[0049] Table 2 PCR reaction conditions

[0050]

[0051] The present invention uses agarose gel electrophoresis gel preparation method, and the specific operation is as follows:

[0052] (1) Add 1 g of agarose to 100 mL of 1×TAE electrophoresis buffer, mix well, and heat in a microwave oven until completely dissolved;

[0053] (2) Cool to 60°C, take out 1 μL of nucleic acid staining solution (4s Green Plus Acid Stain), shake it evenly, and then invert it on the plate and leave it for 20 minutes;

[0054] (3) Add 10 μL of DNA to an agarose gel and visualize it using a gel imager (Tanon 2500) under UV light.

[0055] The method for constructing a phylogenetic tree is as follows:

[0056] (1) The PCR products were sequenced by Sangon (Changchun) Co., Ltd.

[0057] (2) Submit the ITS sequencing results to the NCBI (National Center for Biotechnology Information Search database) website (http: / / www.ncbi.nlm.nih.gov / blast) for blast comparison;

[0058] (3) Use MEGA11.0 software to build a phylogenetic tree and determine the taxonomic status of the fungus;

[0059] The sequencing results of the isolated strain ITS DNA are shown as SEQ ID No. 3.

[0060] Based on Figure 2 As shown in the phylogenetic tree constructed with the closest homology relationship of ITS DNA gene pairs, the analysis showed that the bacteria isolated in this example belong to the same species as the purple-producing Talaromyces purpurogenus, and were named as the purple-producing Talaromyces purpurogenus Jnf41 ( Talaromyces purpureogenus ), deposited in the General Microbiology Center of China Culture Collection Administration, deposit date: January 16, 2025, deposit number: CGMCC NO.: 41757.

[0061] This experimental example provides a plate confrontation experiment between purple-producing fungus Jnf41 and Fusarium graminearum and a hyphae inhibition effect experiment:

[0062] Using the purple-producing fungus Jnf41 isolated in Example 1, a plate confrontation experiment was conducted using the pathogen of corn stalk rot, Fusarium graminearum, as the target pathogen. The specific steps were as follows: a 0.5 cm diameter Fusarium graminearum was placed in the middle of two groups of PDA culture media ( F. graminearum ) cakes, Jnf41 cakes of purple Talaromyces were placed at two symmetrical points around the cakes of PDA culture medium used for Jnf41 group, while no Jnf41 cakes of purple Talaromyces were placed at two symmetrical points around the cakes of PDA culture medium used for CK group. They were cultured at 28℃ for 4 days, and the inhibition zones and inhibition rates were measured.

[0063] The results of the plate confrontation experiment are as follows Figure 3 As shown in Table 1 of the specification, the antibacterial rate of the screened purple-producing fungus Jnf41 against Fusarium graminearum reached more than 84.71%, and the inhibitory effect was good.

[0064] The present invention provides a greenhouse control effect experiment of purple tularemia Jnf41:

[0065] After the activation of Fusarium graminearum on PDA solid medium, the edge hyphae were cut and inoculated into the prepared mung bean spore production medium. The spore suspension of Fusarium graminearum was obtained by shaking at room temperature, 120 r / min, and dark conditions for 3 days. The spore suspension was filtered and the concentration was adjusted to 10 using a hemocytometer. 8The seedling pot experiment was conducted in an artificial climate chamber at Jilin Agricultural University. Corn seeds (Zhengdan 958) were surface-sterilized and planted in plastic pots (12.8 cm × 11.8 cm) filled with a 3:1 mixture of culture medium and perlite. When the corn reached the four-leaf stage, each pot was treated with 10 mL of a spore suspension of the purple fungus Jnf41 (1 × 10 8 The control group was watered with an equal amount of PDB liquid fermentation solution. Seven days later, 1 mL of the prepared spore suspension of Fusarium graminearum was injected into the stem base using a syringe. After inoculation, the plants were placed in a plastic shed to create a high temperature and high humidity environment to facilitate disease development. Fifteen days later, the diseased stems were dissected and observed for stalk rot.

[0066] The results are as follows Figure 4 and Figure 5 As shown, Figure 4 There are three representative plants in each group. Figure 5 The statistical results are the average values ​​of the statistical results of 10 plants in each group. Figure 5 It can be seen that the lesion length of corn treated with the spore suspension of the purple Talaromyces strain Jnf41 was significantly shorter than that of the CK group, indicating that the purple Talaromyces strain Jnf41 can significantly inhibit the corn stalk rot caused by Fusarium graminearum infection.

[0067] Table 3 shows the statistical results of the antibacterial rate of the purple-producing fungus Jnf41 against Fusarium graminearum provided in the embodiment of the present invention, wherein the diameter of the fungus cake is 5 mm;

[0068] Table 3

[0069]

[0070] Although the preferred embodiments of the present invention have been described, those skilled in the art may make additional changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0071] Obviously, those skilled in the art may make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if such changes and modifications fall within the scope of the claims and their equivalents, the present invention is intended to include such changes and modifications.

Claims

1. A purple-producing fungus ( Talaromyces purpureogenus ) Jnf41, characterized in that: Deposited in the General Microbiology Center of China Culture Collection Administration, the deposit date is January 16, 2025, and the deposit number is: CGMCCNO.: 41757.

2. A method for preparing a spore suspension of T. purpurogenum Jnf41, characterized in that: The purple-producing fungus Jnf41 according to claim 1 is placed in a PDB culture medium and fermented at 25-30° C. and 120-180 rpm for 3-5 days to obtain the product.

3. The purple-producing fungus Jnf41 according to claim 1 or the spore suspension prepared by the method according to claim 2 is used in the preparation of a spore suspension for inhibiting Fusarium graminearum ( Fusarium graminearum ) in bacterial agents.

4. Use of the purple-producing fungus Jnf41 according to claim 1 or the spore suspension prepared by the method according to claim 2 in the preparation of a drug for preventing and treating corn stalk rot.

5. The use according to claim 3 or 4, characterized in that The number of spores in the spore suspension is 1×10 8 pieces / mL.

Images