Radish aphid sirt1 gene and application and method for preventing and treating radish aphid

By isolating the SIRT1 gene of the radish aphid and using dsRNA interference technology, the mortality rate of radish aphid larvae was significantly increased and the proportion of winged larvae was reduced. This solved the problem of regulating the growth, development and wing differentiation of the radish aphid, and achieved effective control and green pest control of the radish aphid population.

CN120041418BActive Publication Date: 2025-12-30HUAZHONG AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510200698.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-02-24
Publication Date
2025-12-30
Estimated Expiration
2045-02-24

AI Technical Summary

Technical Problem

Existing technologies lack effective means to control the radish aphid, especially in regulating its growth, development, and wing differentiation, making it difficult to control its population spread and virus transmission.

Method used

By isolating and utilizing the SIRT1 gene of the radish aphid, specific primers were designed to synthesize dsRNA to interfere with SIRT1 gene expression. The gene silencing effect was detected using a green fluorescent protein control group. Further research was conducted on its impact on the growth and development of the radish aphid. At the same time, dsRNA was encapsulated in droplet chitosan nanocarriers for targeted interference.

Benefits of technology

It significantly increased the mortality rate of radish aphid larvae, reduced the proportion of winged adults, and suppressed the development and large-scale spread of radish aphid populations, providing a foundation for the development of green and environmentally friendly insect-resistant plants and biological pesticides.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120041418B_ABST
    Figure CN120041418B_ABST
Patent Text Reader

Abstract

The present application relates to the field of insect control, and particularly relates to a SIRT1 gene of Rhopalosiphum padi and application thereof and a method for controlling Rhopalosiphum padi. The gene encodes a protein with an amino acid sequence as shown in SEQ ID NO: 2. The present application finds that the SIRT1 gene plays a role in the growth and development of Rhopalosiphum padi. Inhibition of the expression of SIRT1 can significantly increase the mortality rate of Rhopalosiphum padi nymphs, significantly reduce the proportion of winged aphids, and ultimately cause the population to decline and the toxin transmission ability to weaken. By using RNA interference technology, it is found that inhibition of the expression of the SIRT1 gene of Rhopalosiphum padi can significantly increase the mortality rate of the nymphs, and significantly reduce the proportion of winged adults after development. In addition, by spraying dsRNA of the SIRT1 gene interference sequence of Rhopalosiphum padi encapsulated by a nano material, the mortality rate of the Rhopalosiphum padi nymphs is significantly increased.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of insect control, specifically to the SIRT1 gene of the radish aphid, its application, and methods for controlling the radish aphid. Background Technology

[0002] The turnip aphid (Lipaphis erysimi Kaltenbach) belongs to the family Aphididae in the order Hemiptera and is distributed throughout China. Also known as the cabbage aphid or cabbage tube aphid, it often occurs in combination with the peach aphid. It primarily damages cruciferous vegetables such as cabbage, turnip, mustard greens, kale, cauliflower, and turnips, with a particular preference for cabbage and mustard greens.

[0003] The technique of using in vitro synthesized double-stranded RNA (dsRNA) to inhibit the expression of specific genes in cells is characterized by specificity, high efficiency, position effect, ATP dependence, and transmissibility. RNAi, by introducing double-stranded RNA (dsRNA) into cells to induce gene silencing, has been widely used in pest control. Studies have shown that most agricultural pests exhibit a death phenotype after interference with specific target genes, which makes the widespread use of dsRNA as an insecticide in the field possible.

[0004] SIRT1, a protein deacetylase, participates in various cellular functions and has been extensively studied in recent years. It can influence nutrient and energy metabolism, aging, regulate inflammation, circadian rhythms, and the development of related diseases. SIRT1 has been extensively studied in tumors, playing an important role in various cancers.

[0005] Studies have shown that overexpression of SIRT1 in Drosophila can prolong lifespan. In Sarcophaga bullata, diapause induction significantly reduces histone H3 acetylation levels, but paradoxically, it downregulates the expression of genes such as SIRT1 and SIRT2. In Culexpipiens, FOXO, a key factor involved in diapause regulation, has its downstream target Pax involved in the localization of Sirt1 / Sirt2 and related proteins regulating lifespan extension. These studies suggest that SIRT1 may regulate the diapause process in insects. Currently, the regulatory role of SIRT1 in the growth and development of the turnip aphid and its wing differentiation has not been reported. Summary of the Invention

[0006] The purpose of this invention is to provide an isolated SIRT1 gene from the radish aphid.

[0007] Another object of the present invention is to provide the application of the SIRT1 gene of the radish aphid.

[0008] Another object of the present invention is to provide a method for controlling radish aphids.

[0009] The SIRT1 gene of the radish aphid according to the present invention encodes a protein with the amino acid sequence shown in SEQ ID NO: 2, encoding 585 amino acid residues.

[0010] The SIRT1 gene of the radish aphid according to the present invention has the nucleotide sequence shown in SEQ ID NO: 1, with a full length of 1758 bp.

[0011] SEQ ID NO: 1:

[0012] ATGCGTGCAATGGCGTCCGACGACAACGGTGACTTCGACACGGATCTCTCTGC

[0013] GGCACCAGCTAAACGCATGCGGTACTCGTTCGCCGATGAGATTGCCCAAAGTT

[0014] CGCATTTTGAAGCTTTTGGACAGCGATTCACCGGGTTCCCGTCCGGCGAATGTT

[0015] ACGCCAACAATTTGTACCAGCAATCATACAAATCTTTGGATACTCTATCACCAAA

[0016] TTATTTACAACCAAATTCACCAACTCCTCCATTAACAATGTCTTCAAGTTTACCT

[0017] GAATCTCCAGAAGACTCGAGTATATTTGACGAAAGTTCTGACACTAAAGAAGA

[0018] ACCTGAGGACGATGATTCAACTTCCACATCCAGTTCAGAATCCAGCACACATTC

[0019] TGAGAATGCAGATTCTGAAAAAGGAGTACCTGGTTCAATGAACTGGGTGCAGC

[0020] GACAAATTATGGGTGGTATTAATCCGAGACGTTTGTTACATCAAGTGTTTGGTGC

[0021] TTCTGTTCCATCTCAGTTAGAAGATATAACATTATGGAGGATAATCATGAGTATG

[0022] ACAGATGATTCTCCAATACGAAATCGTTTACGTAGTGTTAGTTCACTAGATGATG

[0023] TTGTTAGGTTATTGAAAACAAGCAATCGTATTATGGTTCTAACTGGAGCAGGTG

[0024] TCTCTGTTTCTTGTGGAATACCGGATTTTCGAAGTCATAATGGAGTTTATGCTAG

[0025] ACTAGCAACAGAATTTCCTGACTTACCTGATCCCCAATCTATGTTTTGTATAGATT

[0026] ATTTCACTAAAGACCCTAGGCCATTTTTTAAATTTGCTAGAGAAATTTATCCAGG

[0027] GCAATTTAAGCCATCACCATCCCACCAATTTATTAAACTCTTAGAAAAAAGG

[0028] ACGACTCTTACGTAATTACACTCAAAATATAGATACACTGGAACAAGTTGTTGG

[0029] TATCAATAATGTTATTGAATGTCATGGATCTTTTGCTACTGCATCATGTACTCAGT

[0030] GTGGACACAAAGTATCAGCAGAAACTATAAAGACCTGATGTATTCGACCAACGA

[0031] ATTCCTCGTTGCCCAATATGTATCAATAGTACTGGTATTATGAAACCAGACATTGT

[0032] TTTTTTTGGAGAAGGTCTTCCAGACAGTTTCCATAAAGCAATTGAAGATGACAA

[0033] AAATAATTGTGATTTGTTGATAGTAATTGGATCGTCTTTGAAAGTTCGACCAGTG

[0034] GCTCGTATACCTAATATGTTGGACAAACATGTTCCACAAATATTAATAAACCGAG

[0035] AAAGACTTCCGCATATGAATTTTGATGTTGAACTTCTTGGTGACAGTGATGTTAT

[0036] CGTGGATCACCTCTGTCGCATGCTAGGTTCAGATTGGACTGAGCTATGCTGGTG

[0037] CAAAGAAGAGTTGACCGAAACTAAAACTTTAAATACTCCTATGTCATCACCAAG

[0038] GTCTAATGTTGCTATAAGTGAAACTGTGGAAGGTGAAATGTCTACTGAATCTAC

[0039] AAGAGATAGTGCTAACAGTATGTCACCACCACTTGGTGATGATAGGTTCACCCC

[0040] AGGTACTTCAGGCGAACAACGAAATTTATCAACAGACTCTACAAGAGATAGTG

[0041] GTATTGACCCAGATGATCCTCAAAAGTCTAGTTTAGCTGCGTATTTACCATTTAA

[0042] TAAATATTACATGTTGAAAAAAAGAAGGTACATGTTTTCTGGTGCAGAAGTAGA

[0043] TTTAAATGACATGAATGATGACAGTGAAACCGAATCAGACTCAAGTGAAAAATCTGAAACTCCGTTACAATAA。

[0044] SEQ ID NO:2

[0045] .

[0046] According to the method for controlling the radish aphid of the present invention, dsRNA of the SIRT1 gene was synthesized using specific primers. The dsRNA containing the SIRT1 gene interference sequence was fed to radish aphids, with a green fluorescent protein (GFP) control group. Gene expression levels were detected by real-time quantitative PCR after 72 hours of feeding, and the mortality rate of radish aphids after 7 days of feeding was recorded. The results showed that this sequence significantly inhibited the expression of the SIRT1 gene. Further investigation into the effect of silencing the SIRT1 gene on the growth and development of radish aphid larvae revealed that inhibiting SIRT1 gene expression significantly increased larval mortality and suppressed population growth. Simultaneously, silencing SIRT1 gene expression significantly reduced the proportion of winged radish aphids among emerging adults, thus reducing the aphids' ability to spread widely and transmit viral diseases.

[0047] According to the method for controlling radish aphids of the present invention, the sequences of the synthesized dsRNA-specific primers are as follows:

[0048] Upstream primer dsSIRT1-F: 5'ATCAAGCTTGCGAATGTTACGCC3',

[0049] Downstream primer dsSIRT1-R: 5'CGCGGTACCGAATCATCTGTCATACTCATG3',

[0050] Upstream primer dsSIRT1-2F: 5'CGCAAGCTTCACTAAAGACCCTAGGC3',

[0051] Downstream primer dsSIRT1-2F: 5'ATAGGTACCCTGTCTGGAAGACCTT3'.

[0052] According to the method for controlling radish aphids of the present invention, a gene silencing method using dsRNA encapsulated by drop chitosan nanocarriers is employed to target the SIRT1 gene. Results showed that the SIRT1 gene dsRNA encapsulated by drop chitosan nanomaterials significantly increased the mortality rate of radish aphid larvae and reduced the proportion of winged adults after emergence, adversely affecting the population development and large-scale spread of radish aphids. This is the first verification of the role of SIRT1 in the growth and development of radish aphids. The SIRT1 gene can serve as a candidate gene for the cultivation of transgenic radish aphid plants, developing green and environmentally friendly insect-resistant plants. It can also serve as a target gene for sprayable RNA biopesticides, developing novel biopesticides, ultimately achieving the goal of green pest control.

[0053] The positive and beneficial effects of this invention are as follows:

[0054] (1) This invention is the first to discover that the SIRT1 gene is involved in the growth and development of the turnip aphid. The loss of SIRT1 expression significantly increases the mortality rate of turnip aphid larvae, reduces the proportion of winged adults, and ultimately inhibits population growth and large-scale dispersal. This gene can be used to develop products for the control of turnip aphids.

[0055] (2) This invention provides an interference sequence for the SIRT1 gene of the radish aphid. This sequence can significantly inhibit the expression of the SIRT1 gene. By interfering with the expression of the SIRT1 gene using this sequence, the growth of the radish aphid can be inhibited, the proportion of winged aphids can be reduced, and ultimately, its population development and dispersal ability can be controlled. This can be used to develop green and environmentally friendly insect-resistant plants, ultimately achieving the goal of green pest control.

[0056] (3) Using genetic engineering technology, foreign genes can be introduced into plant expression vectors and then introduced into plant cells to obtain insect-resistant transgenic cells and transgenic plants.

[0057] (4) Using genetic engineering technology, dsRNA can be coupled with chitosan nanomaterials to obtain a nanocarrier-dsRNA spray for controlling radish aphids. Attached Figure Description

[0058] Figure 1 The silencing efficiency of the SIRT1 gene is shown after feeding SIRT1 gene interference sequence dsRNA for 72 h. "*" represents p<0.05, "dsSIRT1-1" represents the treatment group fed SIRT1 gene dsRNA fragment 1, "dsSIRT1-2" represents the treatment group fed SIRT1 gene dsRNA fragment 2, and "dsGFP" represents the control group fed GFP gene dsRNA.

[0059] Figure 2 The effect of feeding SIRT1 gene interference sequence dsRNA on the growth and development of radish aphid is shown, where "*" represents p<0.05, "dsSIRT1-1" represents the treatment group fed SIRT1 gene dsRNA fragment 1, "dsSIRT1-2" represents the treatment group fed SIRT1 gene dsRNA fragment 2, and "dsGFP" represents the control group fed GFP gene dsRNA.

[0060] Figure 3 The effect of feeding SIRT1 gene interference sequence dsRNA on the proportion of winged adults after emergence of the turnip aphid is shown. "*" represents p<0.05, "dsSIRT1-1" represents the treatment group fed SIRT1 gene dsRNA fragment 1, "dsSIRT1-2" represents the treatment group fed SIRT1 gene dsRNA fragment 2, and "dsGFP" represents the control group fed GFP gene dsRNA.

[0061] Figure 4 This figure shows the effect of dsRNA containing SIRT1 gene interference sequence encapsulated by drop chitosan nanomaterials on the growth and development of the radish aphid. Different lowercase letters in the figure indicate significant differences at the P=0.05 level according to Tukey's HSD multiple comparisons. "DEPC+CS" represents the control group of drop chitosan nanomaterials, "dsGFP+CS" represents the control group of GFP gene dsRNA encapsulated by drop chitosan nanomaterials, and "dsSIRT1-2+CS" represents the treatment group of SIRT1 gene dsRNA fragment 2 encapsulated by drop chitosan nanomaterials. Detailed Implementation

[0062] The techniques used in the following examples, including RNA extraction, cDNA synthesis, PCR amplification and detection, and dsRNA synthesis, are all conventional techniques known to those skilled in the art, unless otherwise specified. The instruments, equipment, and reagents used, unless specifically stated in this specification, are all obtainable through public or commercial means by those skilled in the art.

[0063] Example 1: Cloning and Analysis of the SIRT1 Gene in Radish Aphid

[0064] RNA was extracted from radish aphid samples using the TRIzol method and stored at -80℃. The extracted total RNA was used to synthesize a cDNA template (see kit instructions for specific steps). Primers were designed as follows:

[0065] Upstream primer SIRT1-1F: 5'TAAATAAACGCGGCGAAAGGGAA3';

[0066] Downstream primer SIRT1-1R: 5'TTTCTGCTGATACTTTGTGTCCACAC3';

[0067] Upstream primer SIRT1-2F: 5'GCCATCACCATCCCACCAATT3';

[0068] Downstream primer SIRT1-2R: 5'CCCCATTAAAACATACAATAGTCAGT3';

[0069] Using radish aphid cDNA as a template, PCR amplification was performed using the primers described above. After amplification, the fragment was identified by 1% agarose gel electrophoresis and purified. The recovered product was ligated into the pEASY-Blunt vector, and the recombinant vector was transformed into competent T1 cells. The cells were cultured overnight at 37°C in ampicillin-resistant LB medium, and positive clones were screened for sequencing. Sequencing results showed that the sequence of the PCR amplification product was as shown in SEQ ID NO: 1, and the amino acid sequence encoding the protein was as shown in SEQ ID NO: 2. The results showed that the SIRT1 gene open reading frame was 1758 bp in length, encoding 585 amino acid residues, with a predicted molecular weight of approximately 64 kDa and a theoretical isoelectric point of 4.55. Further comparison with the SIRT1 amino acid sequences of other insects confirmed that the protein isolated in this invention possesses a typical conserved domain of the SIRT2 superfamily.

[0070] Example 2: Feeding interference experiment of SIRT1 gene fragment of radish aphid.

[0071] 1. dsRNA prokaryotic induction expression

[0072] (1) Preparation of dsRNA template

[0073] Based on the SIRT1 gene sequence obtained in Example 1, specific amplification primers (with appropriate restriction sites added to the 5' end) were designed for the amplification of the two dsRNA fragments of the SIRT1 gene. The designed specific primers are as follows:

[0074] Upstream primer dsSIRT1-F: 5' ATCAAGCTT GCGAATGTTACGCC3',

[0075] Downstream primer dsSIRT1-R: 5' CGCGGTACC GAATCATCTGTCATACTCATG3',

[0076] Upstream primer dsSIRT1-2F:5' CGCAAGCTT CACTAAAGACCCTAGGC3',

[0077] Downstream primer dsSIRT1-2F: 5' ATAGGTACC CTGTCTGGAAGACCTT3'.

[0078] Note: The underlined parts are the enzyme cleavage sites and protective base sequences.

[0079] Using radish aphid cDNA as a template, PCR amplification was performed using the primers dsSIRT1-F+dsSIRT1-R and dsSIRT1-2F+dsSIRT1-2R. PCR products were detected by 1.5% agarose gel electrophoresis, stained with ethidium bromide (EB), and observed under UV light. The gel was excised, and the target fragment was purified and recovered using an AxyGen DNA gel extraction kit. The PCR products were ligated into the pEASY-T vector. Single colonies that tested positive by PCR were then picked and sequenced, and sequence alignment was performed to verify their accuracy.

[0080] (2) Construction of expression vector

[0081] Plasmids containing the target fragment were extracted using the AxyGen AxyPrep PlasmidMiniprep kit and digested with enzymes. The reaction was terminated by incubation at 37°C for 30 min and then at 95°C for 5 s. The target fragment was excised by 1.5% agarose gel electrophoresis and recovered. The digested target fragment was then ligated into the pET-2P vector.

[0082] The process of transforming the recombinant vector into competent HT115 cells. 100 μL of bacterial culture was evenly spread onto Kansas cells. + Incubate overnight at 37°C upside down on LB agar plates. The next day, pick a single colony and incubate on Kansas... +The culture was expanded in LB liquid medium, and the fresh bacterial culture was stored at -80°C in 30% sterilized glycerol for later use.

[0083] (3) dsRNA-induced expression

[0084] The validated bacterial culture was diluted 1:100. 100 μL of the culture was inoculated into 10 mL of LB broth containing kanamycin and incubated overnight at 37°C and 200 rpm for 12–14 h. The overnight culture was then inoculated into 1 L of LB broth containing kanamycin at a 1:100 ratio and incubated until the OD reached 600 to 0.5–0.8. 1 mL of this culture was used as a control. 4 mL of 100 mM IPTG was added, and the culture was incubated for another 4 h at 37°C. 1 mL of this culture was then used to assess the expression. The expressed bacterial culture was centrifuged at 5000 g at 4°C for 10 min. The supernatant was discarded, and the bacterial pellet was resuspended in 10 mL of 1 M CH3COONH4 + 1 mM EDTA solution and transferred to a sterile 50 mL centrifuge tube. 1 μL of dsRNA extracted with chloroform-isoamyl alcohol was diluted 10-fold. 2 μL was used for concentration testing, and 2 μL was used for electrophoresis. If the digested dsRNA showed a single bright band on electrophoresis with the following OD values: A260 / 280: 1.80-2.00; A260 / 230: 1.80-2.00, it indicated that the purified dsRNA was of good quality and could be used as dsRNA for feeding radish aphids. The purified dsRNA was aliquoted and stored at -80℃ for later use.

[0085] 2. Feeding interference of dsRNA in the SIRT1 gene fragment of the radish aphid.

[0086] The radish aphids tested were second-instar nymphs, fed with cabbage and radish. The specific rearing process is as follows:

[0087] The test insects used in the experiment were reared under the same conditions for at least three generations before the experiment. First, 3-5 adult radish aphids were transferred to cabbage plants. After 12 hours of laying eggs, the adults were removed, leaving 15-20 nymphs on each plant. Once all the nymphs had developed into adults, they were transferred to fresh, detached plant leaves to lay eggs again. After 12 hours, all the adults were transferred to another set of fresh, detached leaves to await another round of laying eggs. The nymphs from the previous round were allowed to molt to the second instar before RNAi bioassay. Both the rearing of the radish aphids and the cultivation of the plants were conducted indoors at a temperature of 24±1℃, a photoperiod of 16L-8D, and a relative humidity of 75±5%.

[0088] Bioassay apparatus: The bioassay is conducted using a glass tube 30mm high, 25mm outer diameter, and 21mm inner diameter. One side of the glass tube has an opening that simulates a plant leaf. M+ Artificial Liquid Feed+ The M-shaped feeding membrane contained dsRNA of the target gene mixed into the middle layer of artificial liquid feed, with 300 μL of artificial feed per tube for the test insects to consume. The other side was a 200-mesh breathable filter. The experiment included a control group (dsGFP) and an interference group, with 5 tubes treated in each group. Each tube contained 25 test insects, and 300 μL of artificial liquid feed with a dsRNA concentration of 0.75 μg / μL was added to each tube. During the interference period, the feed was replaced with fresh feed every 48 hours, and dead test insects were removed and their numbers recorded. After 72 hours of interference, a portion of the interfered larvae were collected as quantitative samples to determine the interference efficiency. Seven days later, the mortality rate and the proportion of winged aphids were statistically analyzed. The experiment was repeated three times, and the data were analyzed using independent samples t-tests for statistical significance.

[0089] 3. Detection of the silencing efficiency of the SIRT1 gene in the radish aphid.

[0090] Radish aphid larvae were collected 72 hours after feeding, RNA was extracted and reverse transcribed into cDNA, and then used... Premix ExTaq TM II. The Bio-Rad Detection iQ2 System was used to detect the silencing effect of the SIRT1 gene. qRT-PCR results showed that, compared with the control group fed dsGFP, feeding with both dsRNA fragments of the SIRT1 gene significantly inhibited SIRT1 silencing in the radish aphid. Figure 1 The expression of SIRT1 gene was inhibited. Therefore, it can be seen that both interference sequences of the SIRT1 gene from the radish aphid can significantly suppress SIRT1 gene expression.

[0091] 4. Statistics on the mortality of radish aphid larvae after feeding with dsRNA.

[0092] In the laboratory, the growth of turnip aphids was observed after 7 days of feeding treatment, and the mortality rate was recorded. The results showed that compared with the control group dsGFP, the mortality rate of turnip aphids in the dsSIRT1-1 treatment group increased by approximately 27%, and the mortality rate in the dsSIRT1-2 treatment group increased by approximately 35%. Figure 2 Inhibiting the expression of the SIRT1 gene significantly increased the mortality rate of radish aphid larvae, ultimately affecting the growth and population development of radish aphids. Therefore, the interference sequence provided by this invention can be applied to the development of transgenic radish aphid-resistant plants, developing green and environmentally friendly insect-resistant and virus-resistant plants, and achieving the goal of green pest control.

[0093] 5. Statistics on the proportion of winged adult radish aphids after feeding with dsRNA.

[0094] In the laboratory, the proportion of winged aphids in the carrot aphid group was counted after 7 days of feeding treatment. The results showed that compared with the control group dsGFP, the proportion of winged aphids in the dsSIRT1-1 treatment group decreased by approximately 19%, and the proportion of winged aphids in the dsSIRT1-2 treatment group also decreased by approximately 19%. Figure 3 Inhibiting the expression of the SIRT1 gene significantly reduced the proportion of winged adults in the radish aphid, ultimately affecting its widespread dispersal and viral transmission capabilities. Therefore, the interference sequence provided in this invention can be applied to the development of transgenic radish aphid-resistant plants, enabling the creation of green, environmentally friendly, insect-resistant, and virus-resistant plants, thus achieving the goal of green pest control.

[0095] Example 3: Effects of spraying dsRNA of the SIRT1 gene encapsulated with nanomaterials on the growth and development of the radish aphid.

[0096] 1. dsRNA preparation.

[0097] Prepare dsSIRT1-2 according to Example 2, and dilute it to a concentration of 20 μg / μL for later use.

[0098] 2. SIRT1 gene dsRNA encapsulated in droplet nanomaterials.

[0099] The dsRNA concentration was diluted to 20 μg / μL with DEPC-concentrated water. Chitosan nanocarrier reagent, DEPC-concentrated water, and dsRNA were mixed 1:1, inverted, and incubated at room temperature for 30 min. After diluting DEPC-concentrated water 1.5 times, 0.2 μL was pipette-dropped onto the dorsal plate of 3rd instar radish aphids. Fresh radish leaves were provided for the aphids to feed on daily for 3 consecutive days, and the lethality was observed. Each replicate consisted of 30 aphids, with 4 replicates. Three treatments were included: DEPC / CS, dsGFP / CS, and dsSIRT1-2 / CS. Statistical analysis was performed using SPSS Statistic 27 software. One-way ANOVA and the Duncan test were used to test the significance of differences in means. Error bars represent the standard errors of independent biological replicates.

[0100] 3. Statistics on the mortality of radish aphid larvae after encapsulating SIRT1 gene dsRNA with droplet nanomaterials.

[0101] In the laboratory, the growth of radish aphids was observed after 7 days of feeding treatment, and the mortality rate was recorded. The results showed that compared with the DEPC / CS control group and the dsGFP / CS control group, the mortality rate of the dsSIRT1 treatment group coated with CS nanomaterials was significantly increased, by approximately 31% and 20%, respectively. Figure 4This indicates that spraying the dsRNA of the SIRT1 gene encapsulated by chitosan nanomaterials significantly increased the mortality rate of radish aphid larvae, inhibited their growth and development, and ultimately affected the development of the radish aphid population. Therefore, the interference sequence provided by this invention can be applied to the development of sprayable RNA biopesticides, creating novel pesticides and achieving the goal of green pest control.

[0102] This invention is the first to discover the role of the SIRT1 gene in the growth and development of the turnip aphid. Inhibiting SIRT1 expression significantly increases the mortality rate of turnip aphid larvae, reduces the proportion of winged aphids, and ultimately leads to population decline, reduced large-scale dispersal ability, and decreased ability to transmit viral diseases. This provides a new approach to controlling the turnip aphid population and lays the foundation for green control of turnip aphids and other hemiptera insects. Using RNA interference technology, dsRNA of the turnip aphid SIRT1 gene was synthesized. Then, by feeding the turnip aphids with the dsRNA, it was found that inhibiting the expression of the turnip aphid SIRT1 gene significantly increased the larval mortality rate. Furthermore, by encapsulating the turnip aphid SIRT1 gene interference sequence with droplet chitosan nanomaterials, it was found that compared with the control group, the droplet-encapsulated dsRNA significantly increased the larval mortality rate of turnip aphids.

[0103] The above embodiments are only used to understand the technical solutions of this application and do not limit the scope of protection of this application.

Claims

1. A method for controlling the radish aphid, comprising, The method comprises interfering with the expression of the gene in the aphid SIRT1 a step of gene expression, wherein, The said aphid SIRT1 The gene encodes a protein with an amino acid sequence as shown in SEQ ID NO:

2. dsRNA fragments of the gene were amplified from cDNA of the aphid using the following primer pairs SIRT1 dsRNA fragments of the gene were amplified from cDNA of the aphid using the following primer pairs SIRT1 dsRNA fragments of the gene were amplified from cDNA of the aphid using the following primer pairs Primer pair 1 : comprises the following primers: upstream primer SIRT1 -1F: 5' TAAATAAACGCGGCGAAAGGGAA 3', Downstream primer SIRT1 -1R: 5' TTTCTGCTGATACTTTGTGTCCACAC 3'; or Primer pair 2: comprises the following primers: upstream primer SIRT1 -2F: 5' GCC ATC ATC ATC CCA CCA ATT 3'; Downstream primer SIRT1 -2R: 5' CCCCATTAAAACATACAATAGTCAGT 3'.

2. The method for controlling the lettuce root aphid according to claim 1, characterized by, The said aphids are fed with the dsRNA fragments of the genes SIRT1 The dsRNA fragments of the genes are encapsulated in chitosan nanomaterials.

3. A method of reducing the proportion of winged forms of adults of Rhopalosiphum maidis (Pergande) comprising, The method comprises interfering with the expression of a gene in the aphid SIRT1 a step of gene expression, wherein the aphid SIRT1 the gene encodes a protein having an amino acid sequence as set forth in SEQ ID NO: 2, dsRNA fragments of the gene were amplified from cDNA of the aphid using the following primer pair SIRT1 dsRNA fragments of the gene were amplified from cDNA of the aphid using the following primer pair SIRT1 dsRNA fragments of the gene were amplified from cDNA of the aphid using the following primer pair Primer pair 1 : comprises the following primers: upstream primer SIRT1 -1F: 5' TAAATAAACGCGGCGAAAGGGAA 3', Downstream primer SIRT1 -1R: 5' TTTCTGCTGATACTTTGTGTCCACAC 3'; or Primer pair 2: comprises the following primers: upstream primer SIRT1 -2F: 5' GCC ATC ATC ATC CCA CCA ATT 3'; Downstream primer SIRT1 -2R: 5' CCCCATTAAAACATACAATAGTCAGT 3'.