Composite grapefruit enzyme as well as preparation method and application thereof

Abstract

The invention relates to the field of microbial fermentation, relates to preparation of a plant-based microbial directional fermentation agricultural plant enzyme, and in particular relates to a composite grapefruit enzyme combined with dominant strain fermentation and a preparation method of the composite grapefruit enzyme. The grapefruit defective products and grapefruit flowers are used as main raw materials, dominant bacteria are used for carrying out plant-based microorganism directional fermentation conversion to prepare the composite grapefruit enzyme, the fermentation time for preparing the composite grapefruit enzyme is greatly shortened, the time cost is reduced, and the efficiency is improved.

Description

Technical Field

[0001] The present invention relates to the field of microbial fermentation, and relates to the preparation of a plant-based microbe-directed fermented agricultural plant enzyme, and specifically relates to a composite pomelo enzyme fermented by combining dominant strains and a preparation method thereof. Background Art

[0002] At present, in China's crop planting industry, the methods of applying chemical fertilizers and spraying pesticides are generally adopted to maintain high yields of agricultural products and reduce insect pests. However, although this approach is effective in the short term, it has brought a series of problems. The extensive use of chemical fertilizers and pesticides easily causes soil compaction and acidification, destroys the microbial balance in the soil, and reduces the fertilizer supply capacity of the soil. At the same time, chemical pesticides are not easily decomposed and easily lead to excessive pesticide residues in crops. As an alternative, farmyard manure made by composting human and animal feces and urine is widely used, but such fertilizers not only have a cumbersome, dirty and tiring preparation process, but also have problems such as complex composition, unstable quality, large variation in fertilizer efficiency, difficulty in accurately controlling the amount of fertilizer applied, slow decomposition and late fertilizer efficiency. In the face of these problems, modern biotechnology provides new solutions. At present, there have been reports on the preparation of microbial bacterial fertilizers using plant fermentation products such as fruits and vegetables and traditional Chinese medicines. However, the nutrient components of such fertilizers are limited and cannot effectively promote plant growth.

[0003] Pomelo is a common fruit, and both pomelo fruits and pomelo flowers are rich in nutrients such as vitamin C, B vitamins, vitamin P, protein, carotene, flavonoids, sucrose, volatile oils, and trace elements such as calcium, iron, zinc, and potassium. However, only about 3% of pomelo flowers can form pomelos, and most flowers will naturally fall off, causing a certain amount of resource waste. Pomelo enzyme is a common natural fruit enzyme, rich in active substances such as beneficial bacteria, natural plant hormones, organic acids, enzymes, amino acids, vitamins, minerals, and microbial secondary metabolites, and has effects such as helping digestion, increasing metabolism, eliminating fatigue, and improving immunity. In recent years, there have also been reports on the insect repellent / insecticidal effects of pomelo enzyme in agriculture. However, on the one hand, traditional pomelo enzymes all use pomelo fruits as raw materials, and the utilization rate of pomelo flowers is relatively low, mainly because the traditional enzyme fermentation method has a relatively low utilization rate of pomelo flowers; in addition, the traditional enzyme fermentation method also has problems such as a long fermentation period and a low utilization rate of product nutrient components. Summary of the Invention

[0004] Therefore, the technical problem to be solved by the present invention is to provide a preparation method for fermenting a composite pomelo enzyme by combining dominant strains, so as to solve the problems of a long fermentation period and low nutrient components of pomelo enzyme in the prior art;

[0005] The second technical problem to be solved by the present invention is to provide a pomelo enzyme with higher nutrient components;

[0006] The third technical problem to be solved by the present invention is the use of a composite pomelo enzyme for preparing a biological fertilizer for pomelo cultivation, and the pomelo enzyme helps to improve the cracking rate of pomelo fruits during cultivation;

[0007] The fourth technical problem to be solved by the present invention is to provide a dominant strain for fermenting pomelo enzyme.

[0008] To solve the above technical problems, a preparation method of a composite pomelo enzyme according to the present invention includes the step of inoculating a dominant strain for enzyme fermentation into a pomelo enzyme fermentation medium for fermentation culture; wherein,

[0009] The dominant strain for enzyme fermentation includes the Pichia manshurica strain YA, which is classified and named as Pichia manshurica YA, and has been deposited in the Guangdong Provincial Microbial Culture Collection Center, with the deposit number GDMCC No. 65839 and the deposit date of January 21, 2025;

[0010] The pomelo enzyme fermentation medium includes the following components by mass content: 25 - 35% of pomelo secondary fruits, 0.5 - 1.5% of pomelo flowers, 5 - 15% of sucrose, 0.001 - 0.5% of composite active enzyme, and water is added to make up 100%.

[0011] Preferably, the fermentation medium includes the following components by mass content: 25 - 35% of pomelo secondary fruits, 0.5 - 1.5% of pomelo flowers, 5 - 15% of sucrose, 0.001 - 0.5% of composite active enzyme, and the balance is water.

[0012] Preferably, the fermentation medium includes the following components by mass content: 30% of pomelo secondary fruits, 1.0% of pomelo flowers, 10% of sucrose, 0.01% of composite active enzyme, and the balance is water.

[0013] Specifically, for the preparation method of the composite pomelo enzyme, the composite active enzyme includes one or a combination of several of cellulase, pectinase or protease;

[0014] Preferably, the composite active enzyme includes a combination of cellulase and pectinase.

[0015] Specifically, for the preparation method of the composite pomelo enzyme, the preparation step of the pomelo enzyme fermentation medium includes the step of mixing the pomelo secondary fruits, pomelo flowers, sucrose and composite active enzyme, and adding water to make up the volume, then the medium is obtained.

[0016] Preferably, the preparation step of the pomelo enzyme fermentation medium includes:

[0017] (1) Enzymatic hydrolysis of pomelo flowers: Take a selected amount of pomelo flowers, soak them in water, and then add a selected amount of the composite active enzyme for enzymatic hydrolysis. Collect the enzymatic hydrolysate of pomelo flowers; preferably, carry out enzymatic hydrolysis at 35°C - 45°C for 2 - 5 hours;

[0018] (2) Crushing of pomelo secondary fruits: Take a selected amount of the pomelo secondary fruits and crush them with water; preferably, add 1 - 3 times the weight of water to the pomelo secondary fruits for crushing;

[0019] (3) Mix the enzymatic hydrolysate of pomelo flowers, pomelo secondary fruits, and a selected amount of the sucrose, and make up with water to obtain the product.

[0020] Specifically, for the preparation method of the composite pomelo enzyme, the fermentation and culture step includes an aerobic fermentation stage and an anaerobic fermentation stage; among them,

[0021] The aerobic fermentation stage includes the step of intermittent aeration fermentation within 8 - 12 days at the start of fermentation; preferably, sterile air is introduced once every 2 - 3 days, with a flow rate of 0.03 - 0.20 VVm and an aeration time of 3 - 5 minutes;

[0022] The anaerobic fermentation stage includes the step of static fermentation within 8 - 30 days of fermentation; preferably, the fermentation temperature is 28 - 32°C.

[0023] Specifically, for the preparation method of the composite pomelo enzyme, the method further includes the step of expanding the culture of the enzyme fermentation dominant strain in a shake flask seed liquid medium and a seed tank; among them,

[0024] The medium for the shake flask seed liquid culture step includes components with the following mass contents: yeast powder 8 - 12 g / L, peptone 18 - 22 g / L, glucose 18 - 22 g / L, pH 5.8 - 6.2; preferably, the medium for the shake flask seed liquid culture step includes components with the following mass contents: yeast powder 10 g / L, peptone 20 g / L, glucose 20 g / L, and the balance is water; pH 6.0; and / or,

[0025] The temperature for the shake flask seed liquid culture step is 28 - 32°C, and the rotation speed is 150 - 200 r / min for 20 - 40 hours; and / or,

[0026] The medium for the seed tank expansion culture step includes components with the following mass contents: pomelo secondary fruits 25 - 35%, pomelo flowers 0.5 - 1.5%, sucrose 5 - 15%, composite active enzyme 0.001 - 0.5%, and add water to 100%; preferably, the medium for the seed tank expansion culture step includes components with the following mass contents: pomelo secondary fruits 25 - 35%, pomelo flowers 0.5 - 1.5%, sucrose 5 - 15%, composite active enzyme 0.001 - 0.5%, and the balance is water; and / or,

[0027] The temperature in the seed tank expansion culture step is 26-35°C, continuously cultured for 3-8 days, and the pH value is 3.5-4.5.

[0028] Preferably, in the preparation method of the compound pomelo enzyme, the dominant strain is inoculated into the culture medium for shaking flask seed liquid culture at 0.1-0.3% for dominant bacterial liquid culture; the dominant bacterial liquid is transferred into the culture medium for seed tank expansion culture at an inoculation amount of 0.1-5.0% for expansion culture; the expanded seed liquid is inoculated into the fermentation medium according to a ratio of 5-50% for enzyme fermentation preparation.

[0029] Specifically, in the preparation method of the compound pomelo enzyme, the method further includes the steps of collecting the fermentation product for filtration and collecting the clear and transparent compound pomelo enzyme.

[0030] Preferably, the filtration step includes plate and frame filtration or membrane filtration.

[0031] The present invention also discloses the compound pomelo enzyme prepared by the above method.

[0032] The present invention also discloses the application of the compound pomelo enzyme in the field of pomelo cultivation; preferably, the compound pomelo enzyme is used for preparing biological fertilizers for pomelo cultivation, especially biological fertilizers for inhibiting pomelo fruit cracking.

[0033] The present invention also discloses the use of the compound pomelo enzyme for preparing a pathogenic bacteria inhibitor.

[0034] The pathogenic bacteria include at least one of Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa, Candida albicans or Malassezia furfur.

[0035] The present invention also discloses a dominant strain for pomelo enzyme fermentation, which is the Pichia manshurica strain YA, and its taxonomic name is Pichia manshurica YA, which has been deposited in the Guangdong Provincial Microbial Culture Collection Center, with the deposit number GDMCC No. 65839 and the deposit date of January 21, 2025.

[0036] The present invention uses defective pomelos and pomelo flowers as the main raw materials, and utilizes its own dominant bacteria to carry out directional fermentation and transformation of plant-based microorganisms to prepare compound pomelo enzyme. This not only rapidly decomposes or transforms waste crops to release a large amount of nutrients, turning waste into treasure, but also avoids environmental pollution caused by waste crops, achieving the effect of pollution control and emission reduction. At the same time, the preparation and fermentation time of the compound pomelo enzyme is significantly shortened, reducing the time cost and improving efficiency. The prepared compound pomelo enzyme contains a variety of beneficial microbial flora and bioactive functional groups, has strong fermentation and decomposition capabilities, has good antibacterial effects, and significantly reduces plant oxidative damage. When used as a microbial fermentation fertilizer and returned to the field for agricultural ecological planting, it can provide the enzyme system and sufficient nutrients required for crop growth, effectively improve the disease resistance and immunity of the organism, increase crop yields, reduce the use of pesticides and fertilizers, reduce the incidence of crop infections, and build a virtuous ecological cycle in agricultural production.

[0037] The present invention provides a method for preparing a plant-based microbial directional fermentation agricultural plant enzyme, and its raw material composition is: 25-35% of defective pomelos, 0.5-1.5% of pomelo flowers, 5-15% of sucrose, 0.001-0.5% of compound active enzyme, and 2-5% of microbial dominant bacteria. The compound pomelo enzyme of the present invention uses defective pomelos and pomelo flowers as the main raw materials, and utilizes the screened dominant strains for directional fermentation. It can not only effectively utilize pomelo flowers, but also the compound pomelo enzyme formed by microbial hierarchical fermentation contains a variety of beneficial microbial flora, has strong fermentation and decomposition capabilities, is rich in specific bioactive components such as various enzymes, organic acids, amino acids, polysaccharides, and minerals. When used as a microbial fermentation fertilizer to replace pesticides and fertilizers and returned to the field for agricultural ecological planting, it can provide the enzyme system and sufficient nutrients required for crop growth, effectively increase crop yields, reduce the disease infection rate of crops, and achieve the effects of reducing fertilizer use, reducing pesticides, improving quality, and increasing efficiency.

[0038] The present invention applies modern biotechnology, uses defective pomelos and pomelo flowers as the main raw materials, utilizes its own dominant bacteria for directional and effective fermentation and transformation of plant-based agricultural waste, an environmental protection way of turning waste into treasure, and returns it to the field for agricultural ecological planting to replace pesticides and fertilizers, achieving the green and low-carbon goals of reducing fertilizer use, reducing pesticides, improving quality, and increasing efficiency. In this way, the waste in agricultural production can be recycled, forming a virtuous ecological cycle model. Description of the Drawings

[0039] In order to make the content of the present invention easier to be clearly understood, the following further details the present invention according to specific embodiments of the present invention and in combination with the drawings, wherein,

[0040] Figure 1 It is a phylogenetic evolution tree diagram of the dominant strains of the pomelo enzyme. Detailed Description of the Invention

[0041] To better understand the present invention, the following further elaborates the present invention through several specific embodiments, but does not constitute any limitation to the protection scope of the present invention.

[0042] In the following embodiments of the present invention, the pomelo fermentation medium and the medium for seed tank expansion culture involved therein include the following components by mass content: 25-35% of pomelo secondary fruits, 0.5-1.5% of pomelo flowers, 5-15% of sucrose, 0.001-0.5% of composite active enzyme, and water is added to 100%.

[0043] In the following embodiments of the present invention, the preparation steps of the pomelo enzyme fermentation medium and the medium for seed tank expansion culture include:

[0044] (1) Enzymolysis of pomelo flowers: Take a selected amount of pomelo flowers, soak them in water, then add a selected amount of the composite active enzyme and mix, and carry out enzymolysis at 40°C for 3 h, and collect the pomelo flower enzymolysis product;

[0045] (2) Crushing of pomelo secondary fruits: Take a selected amount of the pomelo secondary fruits and crush them with water according to a mass ratio of 1:2;

[0046] (3) Mix the pomelo flower enzymolysis product, pomelo secondary fruits and a selected amount of the sucrose, and make up the water to obtain the product.

[0047] Example 1

[0048] In this example, the isolation and identification of the dominant bacteria for pomelo enzyme fermentation are carried out.

[0049] Take the pomelo enzyme fermentation broth and dilute it with physiological saline to 10 -4 , 10 -5 , 10 -6 , coat it evenly on the PDA medium, and culture it at room temperature for 2-3 d to isolate a strain of YA dominant bacteria.

[0050] Extract genomic DNA with a genomic DNA extraction kit, perform PCR amplification, sequence it after purification, analyze the strain phylogenetic evolution, and compare the 26S rDNA sequence measured by splicing sequencing with the BLAST nucleic acid database in the NCBI library, and perform homology analysis.

[0051] In this example, the 26S rDNA sequencing results of the YA strain are as follows:

[0052] ACTGCGGAAGGATCATTACTGTGAATATAACTTCCACACATGCGTGAGCGCACAAAACACACAAACCGTGAGTATTTCTAGTCGAAAACAAAACAAAAAATACAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACCTAGTGTGAATTGCAGCCATCGTGAATCATCGAGTTCTTGAACGCACATTGCGCCCGTCGGTATTCCGGCGGGCATGCCTGTCTGAGCGTCGTTTCCTTCTTGGAACTTTTGTTAAAGAAAGATCCAGAGCTGGCCGTGCCACTGGCCCGGCCGAAAAGAAACGTTGCGGACGAAGCGAACTACATCGGGACGCTTTGGCCGCCGAGCGAAAATATATCATTGAGCTCGACCTCAGATCAGGTAGGAGTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAA。

[0053] The phylogenetic status evolutionary tree is shown in the appendix Figure 1 and the results are shown in Table 1.

[0054] Table 1 Analysis of the morphology, culture characteristics and sequence homology of dominant bacteria

[0055]

[0056] Based on the comprehensive analysis of morphology, culture characteristics and gene identification, YA belongs to the genus Saccharomyces, and its taxonomic name is Pichia manshurica YA. This strain has been deposited in the Guangdong Provincial Microbial Culture Collection Center, located on the 5th floor of Building 59, No. 100 Compound, Xianlie Middle Road, Yuexiu District, Guangzhou, Guangdong Province. The deposit number is GDMCC No. 65839, and the deposit date is January 21, 2025.

[0057] Example 2

[0058] In this example, 10 L tank compound pomelo enzyme was prepared based on the Pichia manshurica YA.

[0059] The isolated dominant bacterium YA was cultured on a PDA slant medium at 28 °C for 5 days to obtain a fresh slant of YA.

[0060] Under aseptic conditions, wash the bacterial lawn on the fresh slant of the above-mentioned dominant bacteria with N.S., inoculate it into a shake flask of YEPD medium at a ratio of 0.2%, and culture it at 28 - 32°C with a controlled rotation speed of 150 - 200 r / min for 20 - 40 h to obtain the shake flask dominant bacteria culture solution. Among them, the preparation method of the YEPD medium: 10 g of yeast powder, 20 g of peptone, 20 g of glucose, 1 L of tap water, adjust the pH value to 6.0.

[0061] Inoculate the cultured shake flask dominant bacteria culture solution into a 5.0 L seed tank medium at an inoculation amount of 2%, and culture it at 30°C for 4 d to obtain the seed expansion culture solution. Among them, the preparation method of the seed medium: 900 g of secondary pomelos, 30 g of pomelo flowers, 300 g of sucrose, 0.3 g of cellulase, 0.3 g of pectinase, 3 L of tap water, and the specific preparation steps are as described in the previous record method.

[0062] Transfer and inoculate the cultured seed culture solution into a 10 L fermentation tank medium at a ratio of 25%, mix well, carry out intermittent aeration fermentation for the first 10 d, introduce sterile air once every 2 - 3 d, with a flow rate of 0.10 VVm and an aeration time of 3 - 5 min, controlled so that only bubbles overflow from the top of the fermentation broth. In the middle and later stages, carry out static fermentation, with a fermentation temperature of 30°C, and terminate the fermentation after 30 d to obtain the enzyme fermentation broth. Among them, the preparation method of the fermentation medium: 1800 g of secondary pomelos, 60 g of pomelo flowers, 600 g of sucrose, 0.6 g of cellulase, 0.6 g of pectinase, 6 L of tap water, and the specific preparation steps are as described in the previous record method.

[0063] Comparative Example 1

[0064] The preparation method of the pomelo enzyme in this comparative example is the same as that in Example 2, and the only difference is that the dominant strain, pomelo flowers, and composite active enzyme are not added to the seed tank expansion culture and fermentation medium.

[0065] Wash the secondary cracked pomelos, dry them in the air, cut them into pieces, and prepare a fermentation medium in a 10 L tank with 1800 g of secondary pomelos, 600 g of sucrose, and 6 L of tap water according to the ratio, mix well, carry out static fermentation, at a temperature of 28 - 32°C, and terminate the fermentation after 3 months to obtain the enzyme fermentation broth.

[0066] Respectively collect the fermentation broths obtained in the schemes of Example 2 and Comparative Example 1, filter them through a plate filter, and then sub-pack them to obtain pomelo enzyme.

[0067] For the enzymes obtained from the 10 L tank fermentation in the above Example 2 and Comparative Example 1, their relevant physical and chemical properties and antioxidant activities were measured respectively, and the results are shown in Table 2 below.

[0068] Table 2 Comparison of the physical and chemical properties and antioxidant activities of the enzymes from the 10 L tank fermentation in the example and the comparative example

[0069] Item Example 2 Comparative Example 1 pH value 3.33 3.42 Total acid 11.65 11.02 Organic acid / g / L 7.59 6.33 Organic matter / g / L 8.62 6.86 Effective viable count / cfu / mL <![CDATA[7.26*10 10 > <![CDATA[2.59*10 8 > Polysaccharide / g / L 45.3 28.1 β-glucanase activity / U / L <![CDATA[2.80*10 3 > <![CDATA[2.25*10 3 > Protease activity / U / L <![CDATA[1.13*10 4 > <![CDATA[8.51*10 3 > SOD enzyme activity / U / L <![CDATA[1.15*10 5 > <![CDATA[7.26*10 4 > Polyphenol / g / L 1.13 0.75 ABTS free radical scavenging rate / % 86.5 60.3

[0070] As shown in Table 2, the test results show that the physicochemical properties of the composite pomelo enzyme prepared under the scheme of the present invention and the pomelo enzyme prepared by conventional fermentation in the comparative example both meet the requirements of the plant enzyme industry standard. Moreover, the physicochemical properties and antioxidant activity of the composite pomelo enzyme are significantly superior to those of the conventionally prepared pomelo enzyme, with better quality, stronger ability to reduce plant oxidative damage, and better improvement of the disease resistance and immunity of the body. In addition, the fermentation time of the example is only 30 days, while the fermentation time of the conventional preparation is 90 days, and the fermentation time is significantly shortened.

[0071] Example 3

[0072] In this example, based on the Pichia manshurica YA, the preparation of 100 L tank composite pomelo enzyme was carried out.

[0073] The obtained dominant strain YA was cultured on a PDA slant medium at 28 °C for 5 days to obtain a fresh YA slant.

[0074] Under sterile conditions, the bacterial colonies on the fresh slant of the dominant strain were washed off with N.S. and inoculated into a shake flask of YEPD medium at a ratio of 0.2%. The culture was carried out at 28 - 32 °C with a controlled rotation speed of 150 - 200 r / min for 20 - 40 h to obtain a shake flask dominant strain culture solution. Among them, the preparation method of the YEPD medium is as follows: 10 g of yeast powder, 20 g of peptone, 20 g of glucose, 1 L of tap water, and the pH value is adjusted to 6.0.

[0075] The cultured shake flask dominant strain culture solution was inoculated into a 50 L seed tank medium at an inoculation amount of 2% and statically cultured at 30 °C for 4 days to obtain a seed expanded culture solution. Among them, the preparation method of the seed medium is as follows: 6 kg of pomelo secondary fruits, 200 g of pomelo flowers, 2 kg of sucrose, 2 g of cellulase, 2 g of pectinase, 20 L of tap water. The specific preparation method is the same as that in Example 2.

[0076] The cultured seed culture solution was transferred and inoculated into a 100 L fermentation tank medium at a ratio of 30%, and mixed evenly. In the initial 10 days, intermittent aeration fermentation was carried out, and sterile air was introduced once every 2 - 3 days. The flow rate was 0.15 VVm, and the aeration time was controlled at 3 - 5 min so that only bubbles overflowed from the top of the fermentation broth. In the middle and late stages, static fermentation was carried out. The fermentation temperature was 28 - 32 °C, and the fermentation was terminated after 30 days to obtain an enzyme fermentation broth.

[0077] The preparation method of the fermentation medium is as follows: 18 kg of pomelo secondary fruits, 600 g of pomelo flowers, 6 kg of sucrose, 6 g of cellulase, 6 g of pectinase, 60 L of tap water. The specific preparation method is the same as that in Example 2.

[0078] Comparative Example 2

[0079] The preparation method of the composite pomelo enzyme in this comparative example is the same as that in Example 3, except that the dominant strain, pomelo flowers and composite active enzyme are not added to the seed tank for expansion culture and fermentation medium.

[0080] Wash the secondary cracked pomelos, dry them in the air and cut them into pieces. Then, in a 100L tank, prepare the fermentation medium by mixing 18kg of secondary pomelo fruits, 6kg of sucrose and 60L of tap water in proportion, stir well, let it stand for fermentation at a temperature of 28 - 32°C, and terminate the fermentation after 3 months to obtain the enzyme fermentation broth.

[0081] Collect the fermentation broths obtained in Example 3 and Comparative Example 2 respectively, and filter them through plate and frame filtration and membrane filtration until they are clear and transparent, then subpackage them to obtain pomelo enzymes.

[0082] For the enzymes obtained from the 100L tank fermentation in the above Example 3 and Comparative Example 2, their relevant physical and chemical properties and antioxidant activities were measured respectively, and the results are shown in Table 3.

[0083] Table 3 Comparison of physical and chemical properties and antioxidant activities of enzymes fermented in 100L tanks in Examples and Comparative Examples

[0084]

[0085]

[0086] As shown in the test results in Table 3, the physical and chemical properties and antioxidant activities of the composite pomelo enzyme prepared under the scheme of the present invention are significantly better than those of the pomelo enzyme prepared by conventional fermentation in the comparative example, with better quality. Moreover, the fermentation time in the example is only 30 days, while the fermentation time for conventional preparation is 90 days, and the fermentation time is significantly shortened. Therefore, it is proved that the preparation method of the present invention is significantly better than the conventional preparation.

[0087] Example 4

[0088] Based on the Pichia manshurica YA, this example prepares 1t of composite pomelo enzyme.

[0089] Culture the isolated dominant strain YA on a PDA slant medium at 28°C for 5 days to obtain a fresh YA slant.

[0090] Under aseptic conditions, wash the bacterial colonies on the fresh slant of the above dominant strain with N.S., inoculate them into a shake flask of YEPD medium at a ratio of 0.2%, and culture them at 28 - 32°C with a controlled rotation speed of 150 - 200r / min for 20 - 40h to obtain the shake flask dominant strain culture solution. Among them, the preparation method of the YEPD medium is: 50g of yeast powder, 100g of peptone, 100g of glucose, 5L of tap water, and adjust the pH value to 6.0.

[0091] The cultured shake flask dominant bacteria culture solution was inoculated into the 200L seed tank medium at an inoculation amount of 2%, and statically cultured at 30°C for 4 days to obtain the seed expanded culture solution. Among them, the preparation method of the seed medium: 36 kg of secondary pomelos, 1.2 kg of pomelo flowers, 12 kg of sucrose, 12 g of cellulase, 12 g of pectinase, 120 L of tap water, and the preparation method is the same as that in Example 2.

[0092] The cultured seed culture solution was transferred and inoculated into the 1t fermenter medium at a ratio of 20%. Intermittent aeration fermentation was carried out for the first 10 days. Sterile air was introduced from the bottom of the fermenter once every 2 - 3 days, with an aeration time of 3 - 5 minutes and an aeration volume of 0.03 - 0.20 VVm, controlled so that only bubbles overflowed from the top of the fermentation broth. In the middle and later stages, static fermentation was carried out at a fermentation temperature of 28 - 32°C, and the fermentation was terminated after 30 days to obtain the enzyme fermentation broth. Among them, the preparation method of the fermentation medium: 180 kg of secondary pomelos, 6 kg of pomelo flowers, 60 kg of sucrose, 60 g of cellulase, 60 g of pectinase, 600 L of tap water, and the specific preparation method is the same as that in Example 2.

[0093] Comparative Example 3

[0094] The preparation method of the composite pomelo enzyme in this comparative example is the same as that in Example 3, and the difference is only that the dominant strain, pomelo flowers, and composite active enzyme are not added to the seed tank expanded culture and fermentation medium.

[0095] The secondary cracked pomelos were washed, dried, and chopped, and then 180 kg of secondary pomelos, 60 kg of sucrose, and 600 L of tap water were proportionally prepared into the fermentation medium in a 1t tank, stirred evenly, and statically fermented at a temperature of 28 - 32°C. The fermentation was terminated after 3 months to obtain the enzyme fermentation broth.

[0096] The fermentation broths obtained in Example 4 and Comparative Example 3 were respectively collected and filtered through a plate and frame filter and a membrane filter until clear and transparent, and then sub-packed to obtain pomelo enzyme.

[0097] The enzymes obtained by fermentation in Example 4 and Comparative Example 3 above were respectively measured for their relevant physical and chemical properties and antioxidant activities, and the results are shown in Table 4.

[0098] Table 4 Comparison of the physical and chemical properties and antioxidant activities of the enzymes fermented in the examples and comparative examples in a 1t tank

[0099] Item Example 4 Comparative Example 3 pH value 3.36 3.47 Total acid 12.09 11.56 Organic acid / g / L 7.69 6.47 Organic matter / g / L 7.26 6.13 Effective viable count / cfu / mL <![CDATA[8.79*10 10 > <![CDATA[3.17*10 8 > Polysaccharide / g / L 46.2 28.5 β-glucanase activity / U / L <![CDATA[2.83*10 3 > <![CDATA[2.31*10 3 > Protease activity / U / L <![CDATA[1.29*10 4 > <![CDATA[9.02*10 3 > SOD enzyme activity / U / L <![CDATA[1.19*10 5 > <![CDATA[8.28*10 4 > Polyphenol / g / L 1.22 0.85 ABTS free radical scavenging rate / % 88.8 61.2

[0100] The above results show that the fermentation time required by the method of the present invention is only 30 days, while the conventional preparation fermentation time is 90 days, and the fermentation time is significantly shortened. Moreover, the physical and chemical properties and antioxidant activities of the composite pomelo enzyme prepared in the examples are significantly better than those of the pomelo enzyme prepared by conventional fermentation in the comparative examples, and the quality is better, as shown in Table 4. It further proves that the preparation method of the present invention is superior to the conventional preparation.

[0101] Example 5

[0102] In this example, the antibacterial effects of the compound pomelo enzyme on pathogenic bacteria were verified respectively.

[0103] Taking the compound pomelo enzyme prepared by fermentation in Example 4 and the pomelo enzyme prepared by fermentation in Comparative Example 3 as the research objects, and Pseudomonas aeruginosa (ATCC9027), Escherichia coli (ATCC25922), Staphylococcus aureus (ATCC25923), Candida albicans (ATCC10231) and Malassezia furfur (ATCC44344) as the test bacteria, their antibacterial activities were measured, and the antibacterial rate results are shown in Tables 5 and 6 respectively.

[0104] Table 5 Results of the antibacterial rate (%) of the fermented enzymes in Example 4 and Comparative Example 3 against the pathogenic bacterium Pseudomonas aeruginosa

[0105]

[0106] Table 6 Results of the antibacterial rate (%) of the fermented enzymes in Example 4 and Comparative Example 3 against 4 kinds of pathogenic bacteria

[0107]

[0108] The results showed that enzymes at different concentrations had certain inhibitory effects on the Gram-positive bacterium Staphylococcus aureus, the Gram-negative bacteria Escherichia coli and Pseudomonas aeruginosa, and the fungi Candida albicans and Malassezia furfur. The higher the enzyme content, the better the antibacterial effect. Moreover, the antibacterial activity of the compound pomelo enzyme in this example was significantly higher than that of the pomelo enzyme in the comparative example. Among them, the compound pomelo enzyme had the best inhibitory effect on Pseudomonas aeruginosa in the antibacterial effect against bacteria, and the antibacterial rate of 5% compound pomelo enzyme was as high as 98%. In the antibacterial effect against fungi, the inhibitory effect on Malassezia furfur was better than that on Candida albicans, and the antibacterial rate of 100% compound pomelo enzyme was as high as 98%, while the antibacterial rate against Candida albicans was about 49%.

[0109] In summary, this example confirmed that the compound pomelo enzyme had certain inhibitory effects on both fungi and bacteria and had stronger antibacterial activity than the conventionally prepared pomelo enzyme by detecting the antibacterial activity.

[0110] Example 6

[0111] This example verified the inhibitory effect of the compound pomelo enzyme on fruit cracking in pomelo cultivation.

[0112] In this embodiment, the pomelo fruit tree is taken as the research object. Two adjacent areas in the planting base of Xianyou Chuanyang Agricultural Science and Technology Co., Ltd. are respectively set as the experimental area and the control area. Enzyme is sprayed in the experimental area, and conventional cultivation is carried out in the control area. The conventional operations in the experimental area and the control area are the same, including pruning, flower thinning, fruit thinning, and mowing the grass twice a year. Among them, in the pomelo planting in the control area, 6 kg / plant of compound fertilizer and urea are applied every year, and herbicide is used to weed 5-6 times; in the experimental area, enzyme is used to replace compound fertilizer, urea and herbicide. In principle, it is irrigated at the root with a ratio of 1:100 before the fruit tree blossoms every year, and sprayed on the leaf surface at a ratio of 1:200 during the fruit swelling period, twice a month, and the spraying is stopped 20 days before picking.

[0113] The results show that the cracking rates of the fruits planted in the experimental area for three consecutive years from 2022 to 2024 are 5%, 8% and 5% respectively, while the cracking rates of the fruits planted in the control area are 35%, 53% and 15% respectively, which proves that the cracking rate of the compound pomelo enzyme prepared and applied to the ecological planting of pomelo is significantly lower than that of conventional planting, effectively solving the technical bottleneck of the high cracking rate in pomelo planting.

[0114] To sum up, the present invention provides a preparation method of a plant-based microorganism-directed fermentation agricultural plant enzyme. The preparation process of its compound pomelo enzyme is simple, the preparation and fermentation time is short, and the product quality is stable, which can be applied to its industrial production. Applying the compound pomelo enzyme to the ecological planting of pomelo can effectively reduce the cracking rate of pomelo and significantly improve the cracking phenomenon of pomelo.

[0115] Obviously, the above embodiments are only examples for clear illustration and not limitations on the implementation manners. For those of ordinary skill in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to enumerate all the implementation manners here. And the obvious changes or modifications derived therefrom are still within the protection scope of the present invention.

Claims

1. A method for preparing a composite grapefruit enzyme, characterized in that: The method comprises the steps of inoculating the dominant enzyme fermentation strain into the grapefruit enzyme fermentation medium for fermentation culture; wherein, The enzyme fermentation dominant strain includes the Pichia manshurica strain YA, which is classified and named as Pichia manshurica YA, and has been deposited in the Guangdong Microbiological Culture Collection Center with a deposit number of GDMCC No. 65839 and a deposit date of January 21, 2025; The grapefruit enzyme fermentation medium comprises the following components by mass content: 25-35% of secondary grapefruit fruit, 0.5-1.5% of grapefruit flower, 5-15% of sucrose, 0.001-0.5% of composite active enzyme, and water is added to 100%.

2. The method for preparing the composite grapefruit enzyme according to claim 1, characterized in that: The composite active enzyme includes one or a combination of cellulase, pectinase or protease; Preferably, the composite active enzyme comprises a combination of cellulase and pectinase.

3. The method for preparing the composite grapefruit enzyme according to claim 1 or 2, characterized in that: The preparation step of the grapefruit enzyme fermentation medium comprises the steps of mixing the grapefruit secondary fruits, grapefruit flowers, sucrose and composite active enzymes, and then adding water to make up the mixture. Preferably, the steps of preparing the grapefruit enzyme fermentation medium include: (1) Enzymatic hydrolysis of grapefruit flowers: taking a selected amount of grapefruit flowers and soaking them in water, then adding a selected amount of the composite active enzyme for enzymatic hydrolysis, and collecting the grapefruit flower hydrolysate; preferably, enzymatic hydrolysis is carried out at 35° C. to 45° C. for 2 to 5 hours; (2) crushing the secondary grapefruit: taking a selected amount of the secondary grapefruit, adding water and crushing the selected amount of the secondary grapefruit; preferably, adding 1 to 3 times the weight of the secondary grapefruit with water and crushing the selected amount of the secondary grapefruit; (3) Mixing the pomelo flower enzymatic hydrolysate, secondary pomelo fruit and a selected amount of sucrose, and adding water to make up the amount.

4. The method for preparing the composite grapefruit enzyme according to any one of claims 1 to 3, characterized in that: The fermentation and culturing step includes an aerobic fermentation stage and an anaerobic fermentation stage; wherein, The aerobic fermentation stage includes the step of intermittent aeration fermentation within 8-12 days after the start of fermentation; preferably, sterile air is introduced once every 2-3 days, with a flow rate of 0.03-0.20VVm and a ventilation time of 3-5min; The anaerobic fermentation stage includes a step of static fermentation within 8 to 30 days of fermentation; the preferred fermentation temperature is 28 to 32°C.

5. The method for preparing the composite grapefruit enzyme according to any one of claims 1 to 4, characterized in that: The method also includes the step of carrying out expansion cultivation of the enzyme fermentation dominant strain in a shake flask seed liquid culture medium seed tank; wherein, The culture medium of the shake flask seed liquid culture step comprises the following components by mass content: 8-12 g / L yeast powder, 18-22 g / L peptone, 18-22 g / L glucose, pH 5.8-6.2; and / or, The temperature of the shake flask seed solution culture step is 28-32°C, the rotation speed is 150-200r / min, and the culture is carried out for 20-40h; and / or, The culture medium in the seed tank expansion step comprises the following components by mass content: 25-35% of secondary grapefruit, 0.5-1.5% of grapefruit flower, 5-15% of sucrose, 0.001-0.5% of composite active enzyme, and water is added to 100%; and / or, The temperature of the seed tank expansion step is 26-35° C., the continuous cultivation is 3-8 days, and the pH value is 3.5-4.

5.

6. The method for preparing the composite grapefruit enzyme according to claims 1-5, characterized in that: The method further comprises the steps of collecting the fermentation product, filtering it, and collecting the clear and transparent composite grapefruit enzyme; Preferably, the filtration step comprises plate and frame filtration or membrane filtration.

7. The composite grapefruit enzyme prepared according to the method according to any one of claims 1 to 6.

8. Use of the composite grapefruit enzyme according to claim 7 in the field of grapefruit cultivation; preferably, the composite grapefruit enzyme is used to prepare a grapefruit cultivation biofertilizer, especially a biofertilizer for inhibiting grapefruit cracking.

9. Use of the composite grapefruit enzyme according to claim 7 for preparing an antibacterial agent for pathogenic bacteria; The pathogenic bacteria include at least one of Staphylococcus aureus, Escherichia coli, Bacillus aeruginosa, Candida albicans or Malassezia furfur.

10. A grapefruit enzyme fermentation dominant strain, characterized in that: The strain is the Pichia manshurica strain YA, which is classified and named Pichia manshurica YA. It has been deposited in the Guangdong Provincial Microbiological Culture Collection Center with a deposit number of GDMCC No.65839 and a deposit date of January 21, 2025.

Images