KRT31 gene knockout cell line and application of KRT31 gene knockout cell line in promotion of small RNA viridae virus replication and / or production of small RNA viridae virus vaccine

Abstract

The invention provides a KRT31 gene knockout cell line and application of the KRT31 gene knockout cell line in promotion of small RNA viridae virus replication and / or production of small RNA viridae virus vaccines, and belongs to the technical field of gene engineering. The invention provides an application of a KRT31 gene or an encoded protein thereof as a target spot in preparation of a product for regulating and controlling virus replication of a small RNA viridae and / or vaccine production. The up-regulation of the expression level of the KRT31 gene can inhibit the virus replication of the small RNA viridae, and the reduction of the expression level of the KRT31 gene can promote the virus replication of the small RNA viridae. According to the invention, the sgRNA knockout KRT31 gene is adopted to prepare a cell line with lost gene coding protein function, so that the replication of small RNA viridae viruses is promoted, the virus titer and the antigen yield are improved, and the efficient preparation of small RNA viridae virus vaccines is facilitated.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and particularly relates to a cell line with KRT31 gene knockout and its application in promoting the replication of Picornaviridae viruses and / or producing Picornaviridae virus vaccines. Background Art

[0002] Foot-and-mouth disease virus (FMDV) belongs to the genus Aphthovirus of the family Picornaviridae and is the pathogen causing foot-and-mouth disease (FMD), which seriously endangers cloven-hoofed animals such as pigs, cattle, and sheep. FMDV has 7 serotypes: O, A, C, SAT1, SAT2, SAT3, and Asia1. There is no cross-immune protection among different serotypes. Developing an efficient vaccine is still the most effective measure for preventing and controlling this disease. Screening cell lines for efficient virus propagation helps to prepare efficient vaccines, and relevant work is urgently needed.

[0003] Senecavirus A (SVA) also belongs to the family Picornaviridae and the genus Senecavirus, and is a pathogenic factor causing swine vesicular disease and acute death of neonatal piglets. Currently, there is no commercial SVA vaccine on the market.

[0004] KRT31 (Keratin 31) is a keratin gene belonging to the type I acidic keratin family and is an important component of intermediate filament proteins, participating in the formation of the cytoskeleton and maintaining the mechanical strength and integrity of epithelial cells. However, so far, there has been no report on the role of the KRT31 gene in regulating the replication of Picornaviridae viruses. Summary of the Invention

[0005] In view of this, the purpose of the present invention is to provide the application of the KRT31 gene or its encoded protein as a target in the preparation of products for regulating the replication of Picornaviridae viruses and / or vaccine production. Upregulating the expression level of the KRT31 gene can inhibit the replication of Picornaviridae viruses, and downregulating the expression level of the KRT31 gene can promote the replication of Picornaviridae viruses. Using sgRNA to knockout the KRT31 gene to prepare a cell line with loss of function of the gene-encoded protein can be used for the production of Picornaviridae viruses and their vaccines, promote the replication of Picornaviridae viruses, and increase the virus titer and antigen yield.

[0006] To achieve the above purpose, the present invention provides the application of the KRT31 gene or its encoded protein as a target in the preparation of products for regulating the replication of Picornaviridae viruses and / or vaccine production.

[0007] Preferably, the nucleotide sequence of the KRT31 gene is as shown in SEQ ID NO.1; the amino acid sequence of the protein encoded by the KRT31 gene is as shown in SEQ ID NO.2; the regulation is promotion or inhibition; upregulating the expression level of the KRT31 gene can inhibit the replication of Picornaviridae viruses, and downregulating the expression level of the KRT31 gene can promote the replication of Picornaviridae viruses.

[0008] Preferably, the products for upregulating the expression level of the KRT31 gene include plasmids or cell lines overexpressing the KRT31 gene; the products for downregulating the expression level of the KRT31 gene include reagents for interfering with or knocking out the KRT31 gene.

[0009] Preferably, the reagent for knocking out the KRT31 gene includes sgRNA; the sgRNA includes KRT31-sgRNA1 and / or KRT31-sgRNA2; the targeting sequence of the KRT31-sgRNA1 is as shown in SEQ ID NO.3; the targeting sequence of the KRT31-sgRNA2 is as shown in SEQ ID NO.4.

[0010] Preferably, the Picornaviridae viruses include foot-and-mouth disease virus and / or Seneca virus.

[0011] The present invention also provides an sgRNA for knocking out the KRT31 gene, and the sgRNA includes KRT31-sgRNA1 and / or KRT31-sgRNA2;

[0012] The targeting sequence of the KRT31-sgRNA1 is as shown in SEQ ID NO.3;

[0013] The targeting sequence of the KRT31-sgRNA2 is as shown in SEQ ID NO.4.

[0014] Preferably, the KRT31-sgRNA1 is a double-stranded fragment formed by annealing KRT31-sgRNA1-F and KRT31-sgRNA1-R; the KRT31-sgRNA2 is a double-stranded fragment formed by annealing KRT31-sgRNA2-F and KRT31-sgRNA 2-R;

[0015] The sequence of the KRT31-sgRNA1-F is as shown in SEQ ID NO.5;

[0016] The sequence of the KRT31-sgRNA1-R is as shown in SEQ ID NO.6;

[0017] The sequence of the KRT31-sgRNA2-F is as shown in SEQ ID NO.7;

[0018] The sequence of the KRT31-sgRNA2-R is shown in SEQ ID NO.8.

[0019] The present invention also provides an expression vector containing the sgRNA.

[0020] The present invention also provides a method for preparing the expression vector, comprising the following steps: ligating the sgRNA to a Cas9 vector plasmid to obtain an expression vector plasmid containing the sgRNA.

[0021] The present invention also provides the use of the sgRNA, the expression vector, and the expression vector obtained by the preparation method in the preparation of a cell line with loss of function of the protein encoded by the KRT31 gene.

[0022] The present invention also provides a cell line with KRT31 gene knockout, which is obtained by knocking out the KRT31 gene in a host cell using the sgRNA, the expression vector, or the expression vector obtained by the preparation method.

[0023] The present invention also provides the use of any one of the following S1-S4 in promoting the replication of Picornaviridae viruses or producing Picornaviridae virus vaccines:

[0024] S1. The sgRNA;

[0025] S2. The expression vector;

[0026] S3. The expression vector obtained by the preparation method;

[0027] S4. The cell line.

[0028] Preferably, the Picornaviridae viruses include foot-and-mouth disease virus and / or Seneca virus.

[0029] Compared with the prior art, the present invention has the following beneficial effects:

[0030] The present invention provides an application of the KRT31 gene or its encoded protein as a target in the preparation of products for regulating the replication of Picornaviridae viruses and / or vaccine production. Overexpression of KRT31 in host cells can inhibit the replication of picornaviruses, while inhibition of the expression of the KRT31 gene in host cells can promote virus replication. A sgRNA targeting the KRT31 gene is provided. The sgRNA can target the KRT31 gene, and an expression vector containing the sgRNA constructed by combining with the CRISPR / Cas9 technology can achieve knockout of the KRT31 gene in host cells with accurate targeting and high knockout efficiency. The cell line with knockout of the KRT31 gene prepared by the present invention can significantly promote the replication of Picornaviridae viruses, thereby increasing the virus titer and antigen yield, and can be used as a production cell line for Picornaviridae viruses or virus vaccines to produce highly efficient vaccines, with broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 It is the Western-blot analysis result of the effect of overexpressing KRT31 on FMDV replication in Example 1.

[0032] Figure 2 It is a schematic diagram of the sgRNA targeting the genomic region of KRT31 in Example 2.

[0033] Figure 3 It is the result of detecting the expression of KRT31 in knockout cells by Westernblot in Example 2.

[0034] Figure 4 It is the result of detecting the viability of KRT31-KO cells in Example 3, where ns represents no significant difference.

[0035] Figure 5 It is the result of detecting the difference in viral protein levels between FMDV-infected KRT31-KO cells and control cells by Westernblot in Example 4.

[0036] Figure 6 It is the result of detecting the difference in mRNA levels between FMDV-infected KRT31-KO cells and control cells by RT-qPCR in Example 4, where ** represents P < 0.01 and *** represents P < 0.001.

[0037] Figure 7 It is the result of detecting the virus titers of FMDV-infected KRT31-KO cells and control cells in Example 4, where * represents P < 0.05 and ** represents P < 0.01.

[0038] Figure 8 It is the fluorescence analysis result of SVA-infected KRT31-KO cells and control cells in Example 5. Detailed implementation manners

[0039] The present invention provides an application of a KRT31 gene or its encoded protein as a target in the preparation of products for regulating the replication of viruses in the family Picornaviridae and / or vaccine production. In the present invention, the nucleotide sequence of the KRT31 gene is as shown in SEQ ID NO.1; the amino acid sequence of the protein encoded by the KRT31 gene is as shown in SEQ ID NO.2. In the present invention, the regulation is promotion or inhibition; up-regulating the expression level of the KRT31 gene can inhibit the replication of viruses in the family Picornaviridae, and down-regulating the expression level of the KRT31 gene can promote the replication of viruses in the family Picornaviridae. In the present invention, the products for up-regulating the expression level of the KRT31 gene include plasmids or cell lines overexpressing the KRT31 gene. The plasmid preferably includes the pcDNA3.1 / myc vector plasmid. The present invention has no special limitation on the source of the pcDNA3.1 / myc vector plasmid, and a known preparation method in the art or a commercially available product can be used.

[0040] In the present invention, the products for down-regulating the expression level of the KRT31 gene include reagents for interfering with or knocking out the KRT31 gene. In the present invention, the reagent for knocking out the expression level of the KRT31 gene preferably includes sgRNA and a Cas9 vector plasmid; the sgRNA includes KRT31-sgRNA1 and / or KRT31-sgRNA2; the targeting sequence of the KRT31-sgRNA1 is as shown in SEQ ID NO.3; the targeting sequence of the KRT31-sgRNA2 is as shown in SEQ ID NO.4. In the present invention, the interference uses RNAi technology to interfere with the expression of the KRT31 gene, and the knockout uses gene editing technology to silence the expression of the KRT31 gene. The gene editing technology preferably includes CRISPR, and more preferably CRISPR / Cas9 technology. In the present invention, the viruses in the family Picornaviridae are preferably foot-and-mouth disease virus and / or Seneca virus.

[0041] In the present invention, the preparation of products for regulating the replication of viruses in the family Picornaviridae includes the preparation of products for inhibiting the replication of viruses in the family Picornaviridae and the preparation of products for promoting the replication of viruses in the family Picornaviridae. The products for inhibiting the replication of viruses in the family Picornaviridae include overexpressing cell lines of the KRT31 gene or the protein encoded by the KRT31 gene and / or anti-picornavirus drugs or inhibitors. The products for promoting the replication of viruses in the family Picornaviridae include cell lines with loss or inhibition of the function of the protein encoded by the KRT31 gene.

[0042] The present invention provides an sgRNA for knocking out the KRT31 gene, and the sgRNA includes KRT31-sgRNA1 and / or KRT31-sgRNA2; the targeting sequence of KRT31-sgRNA1 is: TTGGGCAGGCAGAAGCTGTA (SEQ ID NO.3); the targeting sequence of KRT31-sgRNA2 is: CCAGCTGGAGCGGGACAACG (SEQ ID NO.4). In the present invention, KRT31-sgRNA1 is a double-stranded fragment formed by annealing KRT31-sgRNA1-F and KRT31-sgRNA1-R; KRT31-sgRNA2 is a double-stranded fragment formed by annealing KRT31-sgRNA2-F and KRT31-sgRNA2-R; KRT31-sgRNA1-F: 5’-CACCGTTGGGCAGGCAGAAGCTGTA-3’ (SEQ ID NO.5); KRT31-sgRNA1-R: 5’-AAACTACAGCTTCTGCCTGCCCAAC-3’ (SEQ ID NO.6); KRT31-sgRNA2-F: 5’-CACCGCCAGCTGGAGCGGGACAACG-3’ (SEQ ID NO.7); KRT31-sgRNA2-R: 5’-AAACCGTTGTCCCGCTCCAGCTGGC-3’ (SEQ ID NO.8). The sgRNA of the present invention can specifically target the KRT31 gene, and combined with the CRISPR / Cas9 technology, the knockout of the KRT31 gene in host cells can be achieved, resulting in the loss of the function of the protein encoded by the KRT31 gene.

[0043] The present invention provides an expression vector containing the sgRNA. In the present invention, the expression vector containing the sgRNA is prepared by ligating the sgRNA to a Cas9 vector plasmid. The expression vector of the present invention has the effect of causing the loss of the function of the protein encoded by the KRT31 gene in host cells. Preferably, the Cas9 vector plasmid includes the PX459 vector plasmid. The present invention has no special limitation on the source of PX459, and it can be prepared by a method known in the art or a commercially available product.

[0044] The present invention provides a method for preparing the expression vector, comprising the following steps: ligating the double-stranded sgRNA to a Cas9 vector plasmid to obtain an expression vector plasmid containing the sgRNA. As an implementable embodiment, the expression vector is obtained by annealing the sgRNA to form a double strand and ligating it to the PX459 plasmid. The expression vector plasmid can simultaneously express the Cas9 protein and the targeting sgRNA sequence. In the present invention, when preparing the expression vector, the PX459 vector plasmid is linearized by digestion with a restriction endonuclease to obtain a linearized PX459 fragment; the restriction endonuclease is preferably Bbs I enzyme. In the present invention, when annealing and ligating the sgRNA to the PX459 plasmid, the linearized PX459 fragment and the annealed double-stranded sgRNA are ligated with T4 ligase.

[0045] The present invention provides the use of the sgRNA, the expression vector or the expression vector obtained by the preparation method in the preparation of a KRT31 gene knockout cell line.

[0046] The present invention provides a KRT31 gene knockout cell line, which is obtained by knocking out the KRT31 gene in a host cell using the sgRNA, the expression vector or the expression vector obtained by the preparation method. As an implementable embodiment, the host cell preferably includes PK-15 cells. As an implementable embodiment, the cell line is a KRT31 gene knockout PK-15 cell line. Knocking out the KRT31 gene can cause the loss of the function of the protein encoded by the KRT31 gene in the host cell, and can promote the replication of picornaviridae viruses or the production of picornaviridae virus vaccines. As an implementable embodiment, the construction method of the KRT31 gene knockout PK-15 cell line includes the following steps: (1) preparing an sgRNA for knocking out the KRT31 gene; (2) annealing and ligating the sgRNA prepared in step (1) to the PX459 plasmid to obtain a recombinant vector that simultaneously expresses the Cas9 protein and the targeting sgRNA sequence; (3) transfecting the recombinant vector prepared in step (2) into PK-15 cells and screening with puromycin antibiotic to obtain a KRT31 gene knockout PK-15 cell line.

[0047] The present invention provides the use of any one of the following S1-S4 in promoting the replication of picornaviridae viruses and / or the production of picornaviridae virus vaccines:

[0048] S1. The sgRNA;

[0049] S2. The expression vector;

[0050] S3. The expression vector obtained by the preparation method;

[0051] S4. The cell line.

[0052] In the present invention, the picornavirus is preferably foot-and-mouth disease virus and / or Seneca virus.

[0053] In the present invention, the expression vector obtained by using the sgRNA, the expression vector, the preparation method or the cell line can inhibit the expression of the KRT31 gene in host cells, can significantly promote the replication of picornaviruses such as foot-and-mouth disease virus and Seneca virus, thereby increasing the virus titer and antigen yield, and can be used as a production cell line for picornaviruses and picornavirus vaccines.

[0054] In the present invention:

[0055] The term "protein function loss" refers to that by knocking out, mutating the gene encoding the protein or inserting a partial gene into the gene fragment encoding the protein, a frameshift mutation occurs in the gene-encoded protein, resulting in the inability of the gene-encoded protein to normally exert its biological function. In the present invention, by targeting the knockout of the KRT31 gene in host cells, the function of the protein encoded by the KRT31 gene is lost, and then a cell line with the loss of the function of the protein encoded by the KRT31 gene is constructed and used for the production of vaccines against viruses such as FMDV and SVA. However, the present invention is not limited to the knockout of the KRT31 gene, and other technical means can also be used to cause the loss of the function of the protein encoded by the KRT31 gene and used to construct a cell line with the loss of the function of the protein encoded by the KRT31 gene.

[0056] The term "gene editing" refers to a directed transgenic technology that uses DNA site-specific homologous recombination to direct the change of genetic information of cells or biological individuals, mainly including gene knockout, gene inactivation, gene knock-in, point mutation, deletion mutation, and large fragment deletion of the chromosome set, etc. Among them, "gene knockout" refers to specifically deleting or inactivating a specific gene in the genome of an organism through experimental means, so that it cannot express or produce a functional protein. In the present invention, through the gene knockout technology, the KRT31 gene in host cells is knocked out, and the monoclonal cell line with the loss of the function of the protein encoded by the KRT31 gene obtained can promote the replication level of viruses such as FMDV and SVA; the present invention can also mutate the KRT31 gene in host cells or insert a gene fragment, resulting in a frameshift mutation in the protein encoded by the KRT31 gene, and construct a cell line with the loss of the function of the protein encoded by the KRT31 gene.

[0057] The term "sgRNA" is single guide RNA, which is a key component in the CRISPR / Cas9 gene editing system. Through its specific sequence, it guides the Cas9 nuclease to locate to the target site in the genome to achieve precise gene editing.

[0058] The present invention utilizes the CRISPR / Cas9 gene editing technology to specifically knockout the KRT31 gene by designing sgRNA targeting the KRT31 gene. Taking PK-15 cells as an example, the method for knocking out the KRT31 gene is described in detail. Although the present invention only knocks out the KRT31 gene in PK-15 cells to obtain KRT31 gene knockout cells, the method described in the present invention can be inferred and extended to the knockout of the KRT31 gene in other host cells, and a gene knockout cell line with enhanced replication and antigen expression of viruses such as FMDV and SVA can be constructed.

[0059] The directional recognition and cleavage of genes by the CRISPR / Cas9 gene editing technology are achieved by sgRNA and Cas9. sgRNA determines the targeting of Cas9 and also determines the cleavage activity of Cas9. By designing sgRNA targeting specific genes, the Cas9 protein is guided to bind to specific sequence positions of specific genes, and the DNA double strand is cleaved, causing double strand breaks in the gene. Under the action of the cell's own repair mechanism, random mutations occur. Mutations such as nucleotide deletions or insertions will cause changes in the reading frame of the gene, ultimately achieving the purpose of loss of the function of the gene-encoded protein, and obtaining a cell line with loss of the function of the gene-encoded protein. The present invention adopts the CRISPR / Cas9 gene editing technology to screen the sgRNA sequence targeting the KRT31 gene in vivo and in vitro, realize the accurate and efficient knockout of the KRT31 gene, and obtain a KRT31 gene knockout cell line that can promote the replication and antigen expression of viruses such as FMDV and SVA, thereby providing new strategies and material support for the production of vaccines against small RNA viruses such as FMDV.

[0060] In the following embodiments of the present invention, the FMDV (O / BY / CHA / 2010 strain) used is preserved by the National Foot-and-Mouth Disease Reference Laboratory designated by the Ministry of Agriculture and Rural Affairs; the recombinant Seneca virus Re-SVA-EGFP labeled with EGFP is constructed and preserved by the Foot-and-Mouth Disease and Emerging Disease Epidemiology Team of the Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences; the preparation method is as follows: using gene synthesis technology, the EGFP gene is fused with the Teschovirus 2A gene (T2A) to obtain an EGFP-T2A gene fragment, and the EGFP-T2A fusion gene is inserted between the Seneca virus genes 2A and 2B of the eukaryotic transcription plasmid prSVV / FJ-M (the eukaryotic transcription plasmid prSVV / FJ-M used is disclosed in the authorized invention patent "A Recombinant Nucleic Acid, Recombinant Vaccine Strain of Seneca Virus and Its Preparation Method and Application", ZL202010212460.6), and the detailed preparation method is obtained according to the corresponding preparation method in the reference: Chen Z. et al (2016). "Construction and characterization of a full-length cDNA infectious clone of emerging porcine Senecavirus A". Virology. 2016, 497: 111-124)

[0061]

[0062] Unless otherwise specified, the test methods used in the following examples are all conventional test methods; the materials, reagents, etc. used are, unless otherwise specified, reagents and materials that can be obtained from commercial channels.

[0063] The following will clearly and completely describe the technical solutions in the present invention in conjunction with the embodiments in the present invention.

[0064] Example 1 Effect of overexpressing KRT31 on FMDV replication

[0065] 1.1 Construction of eukaryotic expression plasmid of KRT31

[0066] Query the KRT31 gene sequence in the NCBI database and design primers: KRT31-NheI-F (SEQ ID NO.11): CGTCTA GCTAGC ATGCCTTACAGCTTCTGCCTGCCC (the underlined part is the NheI restriction site); KRT31-HindIII-R (SEQ ID NO.12): CCC AAGCTT GCGCACAAAGGAGCTGCAGGG (the underlined part is the HindIII restriction site). Extract the RNA of PK-15 cells, reverse transcribe it into cDNA, and use it as a template to amplify the KRT31 gene (the nucleotide sequence is as shown in SEQ ID NO.1, and the amino acid sequence is as shown in SEQ ID NO.2). Recover the amplified fragment by nucleic acid electrophoresis, perform double digestion with NheI and HindIII restriction endonucleases, and at the same time perform double digestion on the pcDNA 3.1 / myc vector plasmid with the same restriction endonucleases. Purify and recover the KRT31 gene and the linearized vector fragment of pcDNA3.1 / myc respectively, connect them overnight at 4°C with T4 ligase, transform DH5α competent cells, extract the plasmid and sequence it, and name the successfully constructed plasmid KRT31-Myc.

[0067] 1.2 Effect of overexpressing KRT31 on FMDV replication

[0068] Inoculate PK-15 cells into a 6-well plate and culture them in a cell culture incubator at 37°C and 5% CO 2 until the cell density reaches about 70%. Transfect different doses of the successfully constructed KRT31 eukaryotic expression plasmid KRT31-Myc (0 μg, 1 μg, 2 μg) in 1.1 above. After culturing for 24 h, infect with FMDV and perform Western-blot analysis. The results show that overexpressing KRT31 on PK-15 cells will inhibit the viral protein abundance of FMDV in a dose-dependent manner ( Figure 1 ).

[0069] Construction of KRT31 Gene-Deleted PK-15 Cell Line in Example 2

[0070] 2.1 Design of sgRNA Target Sites

[0071] According to the KRT31 gene sequence in the NCBI database, two sgRNA sequences, KRT31-sgRNA1 and KRT31-sgRNA2, were designed at positions 117 and 335 in the first exon region of the KRT31 gene. The schematic diagram is shown in Figure 2 .

[0072] The targeting sequence of KRT31-sgRNA1 is: TTGGGCAGGCAGAAGCTGTA (SEQ ID NO.3);

[0073] According to the targeting sequence of KRT31-sgRNA1, KRT31-sgRNA1-F: 5’-CACCGTTGGGCAGGCAGAAGCTGTA-3’ (SEQ ID NO.5) and KRT31-sgRNA1-R: 5’-AAACTACAGCTTCTGCCTGCCCAAC-3’, (SEQ ID NO.6) were synthesized;

[0074] The targeting sequence of KRT31-sgRNA2 is: CCAGCTGGAGCGGGACAACG (SEQ ID NO.4);

[0075] According to the targeting sequence of KRT31-sgRNA2, KRT31-sgRNA2-F: 5’-CACCGCCAGCTGGAGCGGGACAACG-3’ (SEQ ID NO.7) and KRT31-sgRNA2-R: 5’-AAACCGTTGTCCCGCTCCAGCTGGC-3’ (SEQ ID NO.8) were synthesized;

[0076] 2.2 Construction of PX459-KRT31-sgRNA Recombinant Plasmid

[0077] Dilute the upstream and downstream sequences of the synthesized sgRNA to 10 μmol / L, take 22.5 μL each, and add 5 μL of 10×PCR buffer to prepare a 50 μL system. Anneal at 95 °C for 5 min to form double-stranded upstream and downstream primers. Digest the PX459 vector plasmid with the restriction enzyme Bbs I. After 1% agarose gel electrophoresis, cut and recover the linearized vector fragment. Ligate it with the double-stranded sgRNA using T4 ligase, transform Escherichia coli DH5α competent cells, pick a single colony for shaking culture, extract the plasmid, and send it to Xi'an Qingke Biotechnology Co., Ltd. for sequencing. Name the positive recombinant plasmids identified by sequencing as PX459-KRT31-sgRNA1 and PX459-KRT31-sgRNA2 respectively.

[0078] 2.3 Cell Transfection and Screening

[0079] According to the Polyplus transfection reagent instructions, transfect the sgRNA recombinant plasmids PX459-KRT31-sgRNA1 and PX459-KRT31-sgRNA2 into PK-15 cells respectively. After transfection for 24 h to 48 h, when the cells grow to a monolayer, digest them with trypsin for subculture, and add puromycin with a final concentration of 2 μg / mL for continuous screening for 3 days. Then replace the complete medium. When the cells grow to about 70%, digest the cells with trypsin and count them. Dilute the cells with the complete medium containing puromycin and inoculate them into a 96-well cell culture plate so that there is 1 cell in each well. Continue to culture in an incubator at 37 °C and 5% CO 2 for 7 d, observe and mark the monoclonal cell wells with good growth status, and passage them to 48-well plates and 24-well plates for expansion culture.

[0080] 2.4 Identification of Monoclonal Cell Lines

[0081] Collect different cell clones and identify them at the gene level and protein level respectively. Extract the DNA of the monoclonal cell line to be identified according to the instructions of the genomic DNA extraction kit. Use the identification primers: KRT31-F: 5’-TATAAATGCTCCCTAGAAGCT-3’ (SEQ ID NO.9); KRT31-R: 5’-GACATATAAAGGCATTGACT-3’ (SEQ ID NO.10); Amplify the fragment containing the sgRNA target site. After 1% agarose gel electrophoresis, recover the amplified product from the gel, send it to Xi'an Qingke Biotechnology Co., Ltd. for sequencing, and analyze the sequencing results. Mark the cell lines with frameshift mutations such as deletion and insertion in the gene sequence as PK-15-KRT31-KO, named PK-15-KRT31-KO-1, PK-15-KRT31-KO-3, PK-15-KRT31-KO-4, PK-15-KRT31-KO-5 (marked as KRT31-KO-1, KRT31-KO-3, KRT31-KO-4, KRT31-KO-5, obtained by transfection with the recombinant plasmid PX459-KRT31-sgRNA2), and PK-15-KRT31-KO-2 (marked as KRT31-KO-2, obtained by transfection with the recombinant plasmid PX459-KRT31-sgRNA1). Identify at the protein level by Western blot to confirm the knockout effect of KRT31 in the cell line. The rabbit anti-KRT31 polyclonal antibody was purchased from Abmart Company. The results are as Figure 3 shown. No protein expression of KRT31 was detected in PK-15-KRT31-KO cells. The above results indicate that the KRT31 gene knockout PK-15 cell line was successfully constructed.

[0082] Example 3 Viability detection of KRT31-KO cell line

[0083] Digest the KRT31 gene knockout PK-15 cells PK-15-KRT31-KO-1, PK-15-KRT31-KO-2 prepared in Example 2 and wild-type control cells (PK-15-KRT31-WT) with trypsin respectively, adjust the cell suspension density, and inoculate them into a 96-well cell culture plate, 100 μL / well, and place them in a 37°C, 5% CO 2 cell incubator for 8 h; then add 10 μL of CCK-8 solution to each well, continue to culture for 4 h, and measure the OD value at 450 nm with an enzyme-labeled instrument and analyze the data. The results are as Figure 4As shown, there was no significant difference in cell viability between the KRT31 gene knockout PK-15 cells PK-15-KRT31-KO-1, PK-15-KRT31-KO-2 and the wild-type control cells, indicating that the knockout of the KRT31 gene did not affect the normal growth characteristics of the cells.

[0084] Example 4 Effect of KRT31 Gene Knockout on FMDV Replication

[0085] An experiment on the effect of KRT31 gene knockout on FMDV replication was carried out using the KRT31 gene knockout PK-15 cell line PK-15-KRT31-KO-2 prepared in Example 2:

[0086] 4.1 Western blot analysis

[0087] FMDV was used to infect the KRT31 gene knockout PK-15 cell line KRT31-KO and the wild-type control cells (PK-15-KRT31-WT) respectively. Protein samples were collected from the cells at 7 h and 14 h respectively to prepare protein samples. Rabbit anti-KRT31 antibody, rabbit anti-FMDV type O antibody and mouse anti-β-Actin antibody were used as primary antibodies, and HRP-labeled goat anti-rabbit IgG and HRP-labeled goat anti-mouse IgG antibodies were used as secondary antibodies for Western blot analysis. The results showed that the abundance of FMDV viral proteins in the KRT31 knockout cells was significantly higher than that in the wild-type control cells ( Figure 5 ).

[0088] 4.2 RT-qPCR detection and analysis

[0089] FMDV was used to infect the KRT31 gene knockout PK-15 cell line KRT31-KO and the wild-type control cells (PK-15-KRT31-WT) respectively. Cell samples were collected at 7 h and 14 h. Total RNA was extracted with Trizol and then reverse transcribed. Using GAPDH as an internal reference gene, the relative mRNA level of FMDV was quantitatively detected by qPCR method. The results showed that at different time points after FMDV infection, the mRNA level of FMDV in the KRT31 knockout cells was significantly increased compared with that in the wild-type control cells ( Figure 6 ).

[0090] 4.3 TCID 50 Determination

[0091] FMDV was used to infect KRT31 gene knockout PK-15 cells and wild-type control cells (PK-15-KRT31-WT) respectively. Viral fluids were collected at 7 h and 14 h, frozen and thawed three times repeatedly, and the samples were serially diluted 10-fold with DMEM medium and inoculated into a 96-well culture plate of BHK-21 cells grown to confluence. There were 8 wells for each dilution, and the plate was placed in an incubator at 37 °C and 5% CO 2 2 incubator for 3 days to observe the cytopathic effect, and the TCID 50 of the virus was calculated according to the Reed-Muench method. Figure 7 The results showed that at different time points, the virus titers of FMDV in KRT31 gene knockout PK-15 cells (KRT31-KO) were significantly higher than those in wild-type control cells, indicating that compared with wild-type cells, the replication level of FMDV in cells with the KRT31 gene knocked out was significantly increased.

[0092] All of the above results indicated that knocking out the KRT31 gene could significantly promote the replication level of FMDV.

[0093] Example 5 Effect of knocking out the KRT31 gene on the replication of SVA

[0094] The recombinant Seneca virus Re-SVA-EGFP with EGFP fluorescence label was used to infect the KRT31 gene knockout PK-15 cell line PK-15-KRT31-KO-2 and wild-type control cells (PK-15-KRT31-WT) prepared in Example 2 respectively, and observed under a fluorescence microscope. The results showed that after infection with Re-SVA-EGFP, the green fluorescence in KRT31 gene knockout PK-15 cells (KRT31-KO) was significantly more than that in wild-type control cells ( Figure 8 ), indicating that compared with wild-type cells, the replication of SVA in cells with the KRT31 gene knocked out was significantly increased.

[0095] In summary, the above results indicated that the KRT31 gene knockout cell line could significantly promote the replication of picornavirus family viruses FMDV and SVA, and could be used for the production of picornavirus family virus vaccines.

[0096] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, not all of them. People can also obtain other embodiments according to these embodiments without creative efforts, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A use of a KRT31 gene or its encoded protein as a target in the preparation of products regulating the replication of Picornaviridae viruses and / or in vaccine production.

2. The use according to claim 1, characterized in that: The nucleotide sequence of the KRT31 gene is shown in SEQ ID NO.1; the amino acid sequence of the protein encoded by the KRT31 gene is shown in SEQ ID NO.2; the regulation is promotion or inhibition; increasing the expression level of the KRT31 gene can inhibit the replication of Picornaviridae viruses, and decreasing the expression level of the KRT31 gene can promote the replication of Picornaviridae viruses.

3. The use according to claim 2, characterized in that: Products that increase the expression level of the KRT31 gene include plasmids or cell lines that overexpress the KRT31 gene; products that reduce the expression level of the KRT31 gene include reagents that interfere with or knock out the KRT31 gene; Preferably, the reagent for knocking out the KRT31 gene includes sgRNA; the sgRNA includes KRT31-sgRNA1 and / or KRT31-sgRNA2; the targeting sequence of the KRT31-sgRNA1 is shown as SEQ ID NO.3; the targeting sequence of the KRT31-sgRNA2 is shown as SEQ ID NO.

4.

4. The use according to any one of claims 1 to 3, characterized in that: The Picornaviridae virus includes foot-and-mouth disease virus and / or Seneca virus.

5. A sgRNA for knocking out the KRT31 gene, characterized in that: The sgRNA includes KRT31-sgRNA1 and / or KRT31-sgRNA2; The targeting sequence of KRT31-sgRNA1 is shown in SEQ ID NO.3; The targeting sequence of the KRT31-sgRNA2 is shown in SEQ ID NO.

4. Preferably, the KRT31-sgRNA1 is a double-stranded fragment formed by annealing KRT31-sgRNA1-F and KRT31-sgRNA1-R; the KRT31-sgRNA2 is a double-stranded fragment formed by annealing KRT31-sgRNA2-F and KRT31-sgRNA 2-R; The sequence of the KRT31-sgRNA1-F is preferably as shown in SEQ ID NO.5; The sequence of the KRT31-sgRNA1-R is preferably as shown in SEQ ID NO.6; The sequence of KRT31-sgRNA2-F is preferably as shown in SEQ ID NO.7; The sequence of the KRT31-sgRNA2-R is preferably as shown in SEQ ID NO.

8.

6. An expression vector comprising the sgRNA according to claim 5.

7. The method for preparing the expression vector according to claim 6, characterized in that: The method comprises the following steps: connecting the sgRNA described in claim 5 to the Cas9 vector plasmid to obtain an expression vector plasmid containing the sgRNA.

8. Use of the sgRNA according to claim 5, the expression vector according to claim 6, and the expression vector obtained by the preparation method according to claim 7 in preparing a cell line with loss of function of the protein encoded by the KRT31 gene.

9. A KRT31 gene knockout cell line, characterized in that: The cell line is obtained by knocking out the KRT31 gene in the host cell using the sgRNA according to claim 5, the expression vector according to claim 6 or the expression vector obtained by the preparation method according to claim 7.

10. Use of any one of the following S1-S4 in promoting the replication of Picornaviridae viruses and / or producing Picornaviridae virus vaccines: S1. The sgRNA of claim 5; S2. The expression vector according to claim 6; S3. The expression vector obtained by the preparation method according to claim 7; S4. The cell line according to claim 9. Preferably, the Picornaviridae virus comprises foot-and-mouth disease virus and / or Seneca virus.

Images