Application of G protein coupled receptor 68 as tumor target and tumor treatment drug

By targeting G-protein-coupled receptor 68 (GPR68), antagonists or antibodies are developed to solve the problems of high recurrence rates and low chemotherapy sensitivity in AML therapy, and the inhibition of AML cell proliferation and enhancement of chemotherapy sensitivity are achieved, providing a cost-effective treatment plan.

CN120053646APending Publication Date: 2025-05-30何晓飞
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411232291.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-09-04
Publication Date
2025-05-30

AI Technical Summary

Technical Problem

The current treatment status of acute myeloid leukemia (AML) is characterized by low five-year survival rate, high recurrence rate, expensive treatment cost and difficult matching, and an economical and effective treatment method is urgently needed.

Method used

Taking G protein-coupled receptor 68 (GPR68) as a target, its antagonists or antibodies are developed to interfere with the gene expression of GPR68 through gene knockout technology or shRNA, inhibit the proliferation and metastasis of AML cells, and improve chemotherapy sensitivity.

Benefits of technology

Effectively inhibit the proliferation of AML cells in vitro and in vivo, improve the sensitivity of AML cells to chemotherapy drugs, and prolong the survival cycle of mice, providing a potentially economical and effective AML treatment method.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120053646A_ABST
    Figure CN120053646A_ABST
Patent Text Reader

Abstract

The invention belongs to the field of biological medicine, and particularly relates to application of a G protein coupled receptor 68 (GPR68) serving as a tumor (acute myelogenous leukemia (AML)) target and application of the GPR68 serving as a tumor treatment medicine. The antagonist of the G protein coupled receptor 68 gene (GPR68) or the antagonist of the G protein coupled receptor 68 protein is applied to preparation of drugs for preventing or treating tumors. The relation between the GPR68 gene and tumors is proved, the GPR68 gene can be used as a target spot for diagnosing and treating leukemia, and proliferation and metastasis of leukemia cells can be effectively inhibited by interfering GPR68 gene expression or intervening the effect of GPR68 through any technology; and a basis is provided for prevention, diagnosis and treatment of diseases.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field:

[0001] The present invention belongs to the field of biomedicine, and particularly relates to the application of G protein-coupled receptor 68 (GPR68) as a target for tumors (acute myeloid leukemia (AML)) and its application as an anti-tumor therapeutic drug. Background Art:

[0002] Acute myeloid leukemia (AML) is a hematological malignancy caused by abnormal differentiation of myeloid hematopoietic stem and progenitor cells, accounting for about 31% of adult leukemias and 80% of acute leukemia patients. Although the progress of diagnostic methods, the emergence of new chemotherapy drugs, and the maturity of stem cell transplantation CAR-T technology have improved the treatment status of AML, its five-year survival rate is only 30.5%. More than 70% of patients are likely to relapse with drug resistance, and recurrent AML is difficult to treat, and even there is no available drug. In addition, problems such as high treatment costs and difficult matching continuously trigger social discussions on economic and ethical issues. Currently, there is an urgent need for an economical and effective method to relieve the clinical treatment pressure of AML.

[0003] The G protein-coupled receptor family (GPCRs) has attracted much attention due to its strong druggability, and about 50% of drugs globally mainly target GPCRs. Among them, proton-sensing receptors, such as G protein-coupled receptor 68 (GPR68), after high expression or activation by protons, participate in physiological and pathological processes such as bone development, inflammation, and metabolism through the release of second messengers such as calcium ions (Ca 2+ ) or cyclic adenosine monophosphate. GPR68 has a 7-transmembrane helix structure, is located on chromosome 14q32.11, is widely expressed in the spleen, testis, small intestine, peripheral blood leukocytes, etc., and was first cloned from an ovarian cancer cell line. It mainly regulates the differentiation and survival of osteoclasts, and its mutation leads to imperfect amyloid development. In addition, GPR68 also stimulates the production of various mediators, resulting in specific cell responses under different conditions, such as the release of inositol phosphate and prostaglandin I2 in aortic smooth muscle cells, connective tissue growth factor in airway smooth muscle cells, insulin secretion in pancreatic β cells, and pain mediator prostaglandin E2 in osteoblasts. However, the role of GPR68 in tumor cells is not yet clear.

[0004] The process by which tumor cells rely on anaerobic glycolysis to produce energy and produce metabolites such as lactic acid under sufficient oxygen conditions is called the Warburg effect. The accumulation of lactic acid is an important cause of the acidic microenvironment of tumors. As an acid-responsive receptor, GPR68 has the biological potential to regulate the occurrence and development of tumors. Therefore, this patent takes GPR68 as the target and AML as the representative tumor to confirm the potential of GPR68 in tumor diagnosis and tumor treatment, indicating that targeting GPR68 to screen new polypeptide drugs and humanized antibodies against cancer has important social significance and a broad economic market. Summary of the Invention:

[0005] The object of the present invention is to provide an application of GPR68 as a target for tumors (acute myeloid leukemia (AML)) and its application as a tumor therapeutic drug.

[0006] To achieve the above object, the technical solution adopted by the present invention is:

[0007] An application of a G protein-coupled receptor 68 as a tumor therapeutic drug.

[0008] An application of an antagonist of the G protein-coupled receptor 68 gene (GPR68) or an antagonist of the G protein-coupled receptor 68 protein in the preparation of a drug for preventing or treating tumors.

[0009] An application of an antagonist of the GPR68 gene or an antagonist of the GPR68 protein in the preparation of a drug for preventing or treating tumor proliferation, metastasis and recurrence.

[0010] The GPR68 (G Protein-Coupled Receptor 68) is one of the proton-sensing receptors and belongs to the G protein-coupled receptor family.

[0011] The GPR68 gene described is a known gene in the prior art and is the only sequence, with GeneID: 8111 in NCBI. The specific CDS sequence is as follows:

[0012] atggggaacatcactgcagacaactcctcgatgagctgtaccatcgaccataccatccaccagacgctggccccg

[0013] gtggtctatgttaccgtgctggtggtgggcttcccggccaactgcctgtccctctacttcggctacctgcagatcaag

[0014] gcccggaacgagctgggcgtgtacctgtgcaacctgacggtggccgacctcttctacatctgctcgctgcccttct

[0015] ggctgcagtacgtgctgcagcacgacaactggtctcacggcgacctgtcctgccaggtgtgcggcatcctcctgta

[0016] cgagaacatctacatcagcgtgggcttcctctgctgcatctccgtggaccgctacctggctgtggcccatcccttcc

[0017] gcttccaccagttccggaccctgaaggcggccgtcggcgtcagcgtggtcatctgggccaaggagctgctgacc

[0018] agcatctacttcctgatgcacgaggaggtcatcgaggacgagaaccagcaccgcgtgtgctttgagcactacccc

[0019] atccaggcatggcagcgcgccatcaactactaccgcttcctggtgggcttcctcttccccatctgcctgctgctggc

[0020] gtcctaccagggcatcctgcgcgccgtgcgccggagccacggcacccagaagagccgcaaggaccagatcca

[0021] gcggctggtgctcagcaccgtggtcatcttcctggcctgcttcctgccctacc

[0022] acgtgttgctgctggtgcgcagcgtctgggaggccagctgcgacttcgccaagggcgttttcaacgcctaccactt

[0023] ctccctcctgctcaccagcttcaactgcgtcgccgaccccgtgctctactgcttcgtcagcgagaccacccaccgg

[0024] gacctggcccgcctccgcggggcctgcctggccttcctcacctgctccaggaccggccgggccagggaggcct

[0025] acccgctgggtgcccccgaggcctccgggaaaagcggggcccagggtgaggagcccgagctgttgaccaagc

[0026] tccacccggccttccagacccctaactcgccagggtcgggcgggttccccacgggcaggttggcctag

[0027] The antagonist of the GPR68 gene or the antagonist of the GPR68 protein is selected from GPR68 antibodies, GPR68 receptor antibodies, modified GPR68, partial peptides of GPR68, siRNAs, shRNAs, antisense molecules and DNA enzymes targeting the GPR68 gene sequence, or expression vectors containing siRNAs, shRNAs, antisense molecules.

[0028] The expression vector is a vector containing a promoter and a nucleic acid insert operably linked to the promoter, and the insert is shRNA.

[0029] The shRNA is

[0030] shGPR68-1: CCTGTACGAGAACATCTACAT;

[0031] shGPR68-2: CGAGCTGTTGACCAAGCTCCA.

[0032] The terms "antagonist" and "inhibitor" have the same meaning and refer to any reagent that targets GPR68 and can reduce the expression level of GPR68, antagonize the function of GPR68, or inhibit the binding of GPR68 to a ligand. Such antagonists achieve this effect in various ways. One class of antagonists binds to the GPR68 protein with sufficient affinity and specificity to neutralize the biological effects of the GPR68 protein. Such molecules include antibodies and antibody fragments. Another class of antagonists includes fragments of proteins, mutant proteins, or organic small molecules, i.e., mimetic peptides, which will bind to GPR68 or GPR68 binding partners, such as compounds or small polypeptides that block the binding of chemerin to GPR68, thereby inhibiting the biological activity of GPR68. The GPR68 antagonist can be any of these classes as long as it is a substance that inhibits the biological activity of GPR68. GPR68 antagonists include GPR68 antibodies, GPR68 receptor antibodies, modified GPR68, and partial peptides of GPR68. Another class of GPR68 antagonists includes siRNAs, shRNAs, antisense molecules, and DNA enzymes targeting the GPR68 gene sequence that are well known in the art and disclosed herein. Such reagents can be obtained by those skilled in the art according to the prior art and can be any antagonist known in the prior art that can reduce the expression level of GPR68 and / or antagonize the function of GPR68, or a reagent that still has the function of reducing the expression level of GPR68 and / or antagonizing the function of GPR68 after modification and modification based on this molecular formula.

[0033] In a preferred specific embodiment of the present invention, the antagonist against GPR68 is a small molecule antagonist, such as shRNA, etc. More preferably, the shRNA is

[0034] shGPR68-1: CCTGTACGAGAACATCTACAT;

[0035] shGPR68-2: CGAGCTGTTGACCAAGCTCCA.

[0036] The tumor is one or more of leukemia, lymphoma, multiple myeloma, choriocarcinoma, placental choriocarcinoma, ovarian cancer, breast cancer, uterine cancer, cervical cancer, endometrial cancer, prostate cancer, liver cancer, pancreatic cancer, skin cancer, malignant melanoma, head and neck cancer, sarcoma, cholangiocarcinoma, bladder cancer, kidney cancer, colon cancer, testicular cancer, lung cancer, gastric cancer.

[0037] Use of G protein-coupled receptor 68 as a tumor target.

[0038] Use of the G protein-coupled receptor 68 as a leukemia target.

[0039] A method for preventing and treating tumors, tumor proliferation and migration, by regulating G protein-coupled receptor 68, thereby achieving prevention and treatment of tumors, tumor proliferation and migration.

[0040] The regulation is to interfere with the gene expression of GPR68 by using gene knockout technology or shRNA method, or to interfere with the function of GPR68 receptor by using specific antibodies, which can effectively inhibit the in vitro proliferation and in vivo expansion of AML cells and improve the chemosensitivity of AML cells.

[0041] Furthermore, the regulation includes the steps of knocking out or knocking down the GPR68 gene, or reducing the expression level of GPR68; preferably, this step is achieved by a GPR68 antagonist.

[0042] Furthermore, targeting GPR68, reducing the expression level of GPR68 and / or antagonizing the function of GPR68 to prevent and / or treat tumors. Specifically, it can be to use an antagonist against GPR68 to reduce the expression level of GPR68 (knock out the GPR68 gene or knock down the expression level of the GPR68 gene) and / or antagonize the function of GPR68.

[0043] In the specific experiments of the present invention, an AML cell line Molm-13 with weakened GPR68 gene expression by shRNA interference was established using shRNA sequences specifically interfering with GPR68 gene expression. In vitro cell growth, apoptosis, and colony proliferation experiments showed that compared with the control group, the proliferation of AML cells with weakened GPR68 gene was significantly inhibited. Further, through in vivo expansion experiments, it was found that compared with the control group, the in vivo expansion ability of AML cells with weakened GPR68 gene was significantly inhibited. In addition, after weakening the GPR68 gene or antagonizing the GPR68 receptor with a polyclonal antibody, the chemosensitivity of AML cells to BCL-2 inhibitors and cytarabine was significantly enhanced.

[0044] Beneficial effects

[0045] The present invention confirms the connection between the GPR68 gene and tumors, which can be used as a target for the diagnosis and treatment of leukemia. Interfering with GPR68 gene expression or intervening in the function of GPR68 using any technology can effectively inhibit the proliferation and metastasis of leukemia cells, providing a basis for the prevention, diagnosis, and treatment of diseases. Brief description of the drawings:

[0046] Figure 1 For the embodiment of the present invention, GPR68 is highly expressed in AML, and its expression is correlated with the prognosis of AML patients after chemotherapy. Among them, GPR68 is abnormally highly expressed in adult and pediatric AML patients, and high expression of GPR68 predicts a poor survival period for patients after chemotherapy treatment.

[0047] Figure 2 For the embodiment of the present invention, after knocking down GPR68 expression by shRNA, the in vitro proliferation ability and colony formation of AML cells are inhibited, and AML cell apoptosis is induced. Among them, knocking out GPR68 effectively inhibits the growth and colony formation of AML cells and induces AML cell apoptosis.

[0048] Figure 3 For the embodiment of the present invention, after knocking down GPR68 expression by shRNA, the in vivo expansion of AML cells is inhibited. Among them, knocking out GPR68 can extend the survival period of AML mice and inhibit the in vivo expansion of AML cells.

[0049] Figure 4 For the embodiment of the present invention, knocking down GPR68 expression by shRNA or GPR68 polyclonal antibody can improve the drug sensitivity of AML cells and enhance the AML cell apoptosis effect diagram. Detailed implementation manners:

[0050] To better understand the present invention, the present invention will be further described below with reference to the following embodiments and accompanying drawings. The embodiments are for explanation only and do not limit the present invention in any way. In the embodiments, all original reagent materials are commercially available, and the experimental methods without specific conditions are conventional methods and conventional conditions well-known in the art, or the conditions recommended by the instrument manufacturer.

[0051] Example 1: By analyzing public databases and clinical data, the differential expression and prognostic correlation of GPR68 in AML were clarified.

[0052] In this example, by performing differential expression analysis on the GSE13159 database, it was found that GPR68 was abnormally highly expressed in various subtypes of AML ( Figure 1 A, *p < 0.05, **p < 0.01).

[0053] According to the clinical pathological examination, 25 cases of pediatric clinical AML data were collected. Through differential expression analysis of the collected data, it was found that GPR68 was also abnormally highly expressed in refractory pediatric AML ( Figure 1 B). Based on the data of 80 elderly patients (>60 years old) after chemotherapy in TCGA_LAML, Kaplan-Meier analysis found that the expression level of GPR68 was negatively correlated with the prognosis of AML patients after chemotherapy ( Figure 1 C).

[0054] Example 2: Interfering with the gene expression of GPR68 or antagonizing the function of GPR68 can effectively inhibit the in vitro proliferation ability and colony formation of human AML cells and induce apoptosis of AML cells.

[0055] In this example, it was verified that interfering with the gene expression of GPR68 or antagonizing the function of GPR68 can effectively inhibit the in vitro proliferation ability and colony formation of AML cells and induce apoptosis of AML cells. Among them, by designing shRNA sequences specific for interfering with the gene expression of GPR68, the expression of the GPR68 gene in the AML cell line was knocked down by shRNA interference. The results showed that after GPR68 was inhibited or knocked out, the growth of AML cells was inhibited ( Figure 2 A), the colony formation ability was inhibited ( Figure 2 B), apoptosis increased ( Figure 2 C), but it did not affect normal CD34 + UCB cells ( Figure 2 C).

[0056] Specific method:

[0057] 1. Establish an AML cell line with knocked-down GPR68 gene.

[0058] The human GPR68 gene shRNA used in this experiment was pMDLg / p-pCMV-G-pRSV-Rev-shGPR68-GFP, (shGPR68#1: CCTGTACGAGAACATCTACAT and shGPR68#2: CGAGCTGTTGACCAAGCTCCA) small hairpin sequence. The control group was pMDLg / p-pCMV-G-pRSV-Rev-scramble shRNA + (shCTL: CAACAAGATGAAGAGCACCAA).

[0059] ① On the first day, plate 2 × 10 5 cells / ml of 293T cells, 2 ml, in a 6-well plate.

[0060] ② On the second day, add plasmid pMDLg / p (0.65 μg), pCMV-G (0.35 μg), pRSV-Rev (0.25 μg) and shGPR68-GFP (1 μg) to transfect the cells by TransIT, and collect the lentivirus 48 h later.

[0061] ③ On the fourth day, take AML cells Molm-13, Kasumi-1 and THP-1 (chemotherapy-insensitive) with strong growth, 1 × 10 5 cells / ml, inoculate in a 6-well plate, inoculate 1.5 ml of lentivirus, and add 8 μg / ml of polybrene.

[0062] ④ On the sixth day, perform GFP determination. After more than 90% of the cells show GFP expression, extract RNA for qRT-PCR verification and conduct various experiments.

[0063] RNA was extracted using Quick RNAMiniPrep (Zimo Research, R1055). cDNA was synthesized using a high-capacity RNA-to-cDNA kit (Invitrogen, 4387406). Quantitative PCR was performed using SYBR Green PCR Master Mix (Fisher, 4309155), and the probes were ACTIN (Applied Biosystems, 4453320, Assay ID Hs03023943_g1) and GPR68 (Applied Biosystems, 4453320, Assay ID Hs00268858_s1). Compared with AML cells transfected with pMDLg / p-pCMV-G-pRSV-Rev-scramble-GFP shRNA (i.e., the AML cell line transfected with the empty vector), the GPR68 gene expression level was only 40%-60% of it. As an AML cell line with the GPR68 gene knocked down, it was named Molm-13-shGPR68, Kasumi-1-shGPR68, or THP-1-shGPR68; and it could be used in subsequent experiments.

[0064] 2. In vitro proliferation, colony formation, and apoptosis experiments of AML cell lines with the GPR68 gene knocked down.

[0065] (1) MTS proliferation assay:

[0066] 1) The AML cells Molm-3-shGPR68 and Kasumi-1-shGPR68 with the GPR68 gene knocked down obtained above were seeded in a 96-well cell culture plate at a density of 10,000 cells / well, and the volume of the medium in each well was 100 μL, and cultured for 72 hours; at the same time, the AML cell line transfected with the empty vector was set as a negative control. According to the manufacturer's instructions, CellTiter 96AQ ueous Non-radioactive cell proliferation assay reagent (Promega, G1112) was used to detect the growth of AML cells after lentiviral transduction. Before analysis, the cells 5 days after lentiviral transduction were treated with 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt (MTS, 333 mg / mL) and phenazine methosulfate (PMS, 25 mM) at 37 °C and 5% CO2 for 2-3 hours, and the absorbance was measured at a wavelength of OD490 nm.

[0067] The test results are shown in the appendix Figure 2A. The experimental results showed that compared with the AML cell line transfected with the empty vector, the cell proliferation rate of the human AML cell line with the GPR68 gene knocked down was significantly decreased. The experimental results proved that when the GPR68 gene was inhibited, the corresponding AML cell proliferation rate would also decrease, that is, by inhibiting the GPR68 gene or its expression, the proliferation of AML cells could be effectively inhibited.

[0068] (2) Colony formation assay

[0069] AML cells were transduced with lentivirus encoding shGPR68. Two days after transduction, 1×10 3 to 1×10 4 GFP-expressing shGPR68 + AML cells were seeded in 1 mL methylcellulose (MethoCultTM H4434 Classic, StemCell Technologies, 04434). Colonies were counted after 7 days.

[0070] The experimental results are shown in Appendix Figure 2 B. Among the Molm-13-shGPR68 and Kasumi-1-shGPR68 groups, the number of colony formations was significantly lower compared with the control group.

[0071] (3) Apoptosis assay

[0072] To detect cell death and apoptosis, AML cells transduced for 5 days and expressing shGPR68#1 were stained with Annexin V-APC according to the manufacturer's instructions. Annexin V+ cells were detected using a NovoCyte flow cytometer.

[0073] The experimental results are shown in Appendix Figure 2 C. Among the groups with GPR68 gene knockdown, the apoptosis ratio of cells was significantly higher compared with the control group.

[0074] As can be seen from the above, in vitro cell proliferation experiments showed that compared with the control group, the proliferation of AML cells with the GPR68 gene knocked down was significantly inhibited. Further, through colony formation experiments, it was found that compared with the control group, the colony formation ability of AML cells with the GPR68 gene knocked down was significantly inhibited. Apoptosis experiments confirmed that compared with the control group, knocking down the GPR68 gene induced apoptosis of AML cells.

[0075] Example 3. Interfering with the gene expression of GPR68 or antagonizing the function of GPR68 can effectively inhibit the in vivo expansion of AML cells.

[0076] This example verifies that interfering with the gene expression of GPR68 or antagonizing the function of GPR68 can effectively inhibit the in vivo amplification ability of AML cells. Among them, through the shRNA sequence (shGPR68#1) that specifically interferes with the gene expression of GPR68, the gene expression of GPR68 in the AML cell line was knocked down by shRNA interference. The results showed that after knocking down or inhibiting GPR68, the survival period of NSG mice could be effectively prolonged ( Figure 3 A), and the amplification of the AML cell line in the blood, spleen and bone marrow of mice was inhibited ( Figure 3 B,C).

[0078] One day before xenotransplantation, NOD.Cg-Prkdcscid Il2rgtm1Wjl / SzJ (NSG) immunocompromised mice were intraperitoneally injected with busulfan (Sigma, B2635) (30 mg / kg). 1×10 6 Molm-13 cells expressing shGPR68#1 (2 days after transduction) were intravenously injected into NSG mice. To detect the engraftment of Molm-13 cells, we collected peripheral blood (PB) cells, femoral bone marrow (BM) cells and spleen cells from the retro-orbital venous sinus of recipient mice 4-5 weeks after xenotransplantation, and detected Molm-13 cells based on the expression of human CD45 and GFP.

[0079] The test results are shown in the appendix Figure 3 , in the Molm-13-shGPR68#1 group, the in vivo amplification of AML cells was significantly lower than that of the control group. Furthermore, the survival period showed that compared with the control group, the survival period of NSG mice inoculated with AML cells with knocked-down GPR68 gene was significantly prolonged compared with the control group. Further, flow cytometry technology confirmed that the amplification of AML cells in peripheral blood, bone marrow and spleen was lower than that of the control group.

[0080] Example 4: Interfering with the gene expression of GPR68 or antagonizing the function of GPR68 can effectively enhance the drug sensitivity of AML cells and enhance AML cell apoptosis.

[0081] This example verifies that interfering with the gene expression of GPR68 or using polyclonal antibodies to antagonize the function of GPR68 can enhance the drug sensitivity of AML cells to BCL-2 inhibitors (ABT-199 and ABT-263) and cytarabine (Ara-C). Among them, an shRNA sequence that specifically interferes with the gene expression of GPR68 was designed, and the gene expression of GPR68 in the AML cell line was knocked down by shRNA interference. shGRP68#2 was used. The expression of GPR68 was neutralized with polyclonal antibodies.

[0082] Specific method

[0083] To study the dose response, AML cells or CD34 + UCB cells were treated with ABT-199 (MedicalChemExpress, HY-15531), ABT-263 (MedicalChemExpress, HY-10087) or Ara-C (Sigma, PHR1787) containing the specified antibody concentration for 3 days, and then cell growth was examined. Among them, the above culture medium was set with or without antibody, and the added concentration of the antibody was 4 μg / mL of GPR68 neutralizing antibody (ExAlpha Biologicals, X1600P; LSBio, LS-C349084).

[0084] AML cells expressing shCTL or shGPR68 (shGPR68#2) were treated with Ara-C (1 mM) for 2 days, and apoptosis was analyzed.

[0085] AML cells were treated with Ara-C (0.1 mM) and GPR68 neutralizing antibody (4 μg / mL) or C-C motif chemokine ligand 5 (CCL5) neutralizing antibody (4 μg / mL, Peprotech, 500-P36) for 3 days, and apoptosis was analyzed.

[0086] Cell proliferation experiments showed that antagonizing GPR68 with polyclonal antibodies increased the drug sensitivity of AML cells compared with the control group. Further, apoptosis experiments confirmed that polyclonal antibodies antagonizing GPR68 effectively enhanced the ability of drugs to induce apoptosis in AML cells.

[0087] Although the present invention has been illustrated and described with reference to certain specific embodiments above, it is not intended to limit the present invention to the details shown. More precisely, the present invention relates to the GPR68 antagonist polypeptides, polynucleotides, antibodies, devices and kits disclosed herein and their uses, as well as controlling GPR68 levels, and various modifications can be made according to the details, and these modifications are within the scope of the claims and the scope of equivalent claims, without departing from the spirit of the present invention.

Claims

1. A use of G protein coupled receptor 68 as a tumor treatment drug.

2. The use according to claim 1, characterized in that: The invention relates to the use of the antagonist of the G protein coupled receptor 68 gene (GPR68) or the antagonist of the G protein coupled receptor 68 protein in the preparation of a drug for preventing or treating tumors.

3. The use according to claim 2, characterized in that: The GPR68 gene antagonist or the GPR68 protein antagonist is used in the preparation of drugs for preventing or treating tumor proliferation, metastasis and recurrence.

4. The use according to claim 2 or 3, characterized in that: The GPR68 gene antagonist or GPR68 protein antagonist is selected from GPR68 antibodies, GPR68 receptor antibodies, modified GPR68, partial peptides of GPR68, siRNAs, shRNAs, antisense molecules and DNA enzymes targeting GPR68 gene sequences, or expression vectors containing siRNAs, shRNAs and antisense molecules.

5. The use according to claim 4, characterized in that: The expression vector contains a promoter and a nucleic acid insert operably connected to the promoter, and the insert is shRNA.

6. The use according to any one of claims 1 to 5, characterized in that: The tumor is one or more of leukemia, lymphoma, multiple myeloma, choriocarcinoma, placental choriocarcinoma, ovarian cancer, breast cancer, uterine cancer, cervical cancer, endometrial cancer, prostate cancer, liver cancer, pancreatic cancer, skin cancer, malignant melanoma, head and neck cancer, sarcoma, bile duct cancer, bladder cancer, kidney cancer, colon cancer, testicular cancer, lung cancer, and gastric cancer.

7. A use of G protein coupled receptor 68 as a tumor target.

8. The use according to claim 7, characterized in that: The use of the G protein coupled receptor 68 as a leukemia target.

9. A method for preventing and treating tumors, tumor proliferation and migration, characterized in that: Regulate G protein-coupled receptor 68, thereby preventing and treating tumors and inhibiting tumor proliferation and migration.