Lactobacillus reuteri ZY18 and application thereof as feed additive
Lactobacillus reuteri ZY18 obtained by isolating and screening from the feces of weaned piglets, the shortcomings of the prior art in improving intestinal inflammation and damage in animals and regulating intestinal flora are solved, and the effect of significantly improving intestinal health and growth of animals is achieved.
Patent Information
- Application Number
- CN202510502550.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-22
- Publication Date
- 2025-05-30
- Estimated Expiration
- 2045-04-22
AI Technical Summary
The existing Lactobacillus reuteri needs to be improved in improving intestinal inflammation and damage in animals, alleviating the reduction of intestinal flora diversity or regulating intestinal flora.
A strain of Lactobacillus reuteri was isolated and screened from the feces of weaned piglets. This strain has good acid production performance, acid-tolerant bile salt resistance, antibacterial ability, and promoting animal growth and intestinal health.
Lactobacillus reuteri ZY18 significantly improves intestinal inflammation and damage in animals, improves animal antioxidant ability, regulates animal intestinal flora, enhances intestinal barrier function, and promotes animal growth.
Smart Images

Figure CN120060080A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to Lactobacillus and its applications, in particular to a strain of Lactobacillus reuteri isolated from the feces of weaned piglets and its applications in aspects such as antibacterial activity, promoting animal growth, improving animal intestinal inflammation and injury, enhancing animal antioxidant capacity, and regulating animal intestinal flora, belonging to the field of Lactobacillus reuteri and its applications. Background Art
[0002] Lactobacillus reuteri ( Lactobacillus reuteri , L. reuteri ) is a kind of lactic acid bacteria (LAB), L. reuteri which is a heterofermentative strain and can ferment sugars to produce CO 2 , lactic acid, acetic acid and ethanol, and can colonize in the gastrointestinal tracts of humans and animals. It is reported that L. reuteri it has many functional characteristics, such as antibacterial effect, immunomodulatory effect, maintaining intestinal barrier function and regulating intestinal flora, etc. (Yu, Z.; Chen, J.; Liu, Y.; Meng, Q.; Liu, H.; Yao, Q.; Song, W.; Ren, X.; Chen, X. The Role of Potential Probiotic Strains Lactobacillus Reuteri in Various Intestinal Diseases: New Roles for an Old Player. Front. Microbiol. 2023, 14, 1095555). L. reuteri While colonizing in the gastrointestinal tract, it can produce a variety of antimicrobial substances, such as reuterin, lactic acid, acetic acid, ethanol, reutericyclin, etc., and reuterin is the most important one among them. L. reuteri It metabolizes glycerol to produce 3-HPA through the reaction mediated by coenzyme B12-dependent glycerol dehydratase, and 3-HPA interacts with the thiol groups in the cell to produce antibacterial activity (Schaefer, L.; Auchtung, T. A.; Hermans, K. E.; Whitehead, D.; Borhan, B.; Britton, R. A. The Antimicrobial Compound Reuterin (3-Hydroxypropionaldehyde) Induces Oxidative Stress via Interaction with Thiol Groups. Microbiology2010, 156 (6), 1589–1599). L. reuteri Utilize its acid resistance, bile salt resistance, and adhesion characteristics to colonize and survive in the gastrointestinal tract. Subsequently, it regulates the intestinal flora, enhances the intestinal mucosal barrier, regulates immune cells and inflammatory factors, produces tryptophan derivatives, secretes bioactive factors such as exopolysaccharides (EPS), increases the expression of tight junction proteins, regulates gene expression, improves antioxidant activity, and further regulates the host's immune system (Luo, Z.; Chen, A.; Xie, A.; Liu, X.; Jiang, S.; Yu, R. Limosilactobacillus Reuteri in Immunomodulation: Molecular Mechanisms and Potential Applications. Front. Immunol. 2023, 14, 1228754).
[0003] Limosilactobacillus reuteri ZY15 disclosed in CN118460435A (its microbial deposit number is: CGMCC No. 28937) has functions such as antibacterial, promoting animal growth, reducing animal diarrhea rate, increasing animal hormone levels, and improving animal antioxidant capacity. However, it still needs to be improved in terms of improving animal intestinal inflammation and injury, alleviating the reduction of intestinal flora diversity, or regulating animal intestinal flora. Summary of the Invention
[0004] One of the objectives of the present invention is to provide a Limosilactobacillus reuteri strain isolated from animals.
[0005] Another objective of the present invention is to apply the Limosilactobacillus reuteri to aspects such as antibacterial, promoting animal growth, improving animal intestinal inflammation and injury, increasing animal antioxidant capacity, and regulating animal intestinal flora.
[0006] To achieve the above objectives, the main technical solutions adopted in the present invention include: On the one hand, the present invention provides a Limosilactobacillus reuteri ( Lactobacillus reuteri ) ZY18, whose microbial deposit number is CGMCC No. 28938; its taxonomic name is: Limosilactobacillus reuteri Lactobacillus reuteri ; the deposit time is: November 10, 2023; the deposit unit is: China General Microbiological Culture Collection Center; the deposit address is: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Beichen West Road, Chaoyang District, Beijing 100101.
[0007] The colony and cell morphology of Lactobacillus reuteri described in the present invention are as follows: The colony of Lactobacillus reuteri ZY18 on the medium is nearly circular in shape, milky white in color, and shiny; after Gram staining and observation under a microscope, Gram-positive bacteria in the shape of rods can be seen.
[0008] The Lactobacillus reuteri ZY18 isolated in the present invention has the fastest growth rate after 3 h and enters the logarithmic growth phase. The growth of the strain slows down after 13 h and enters the plateau phase; it has good acid-producing performance; it has tolerance to the simulated gastrointestinal environment; it can tolerate acid or bile salt environment and has bile salt hydrolase activity; there is no hemolysis ring around it, which is γ-hemolysis and has good safety; it has good hydrophobic ability, self-aggregation ability and good adhesion ability. The Lactobacillus reuteri ZY18 also has excellent antibacterial ability and the ability to promote animal growth, improve animal intestinal inflammation and injury, enhance animal antioxidant ability, and regulate animal intestinal flora.
[0009] Another aspect of the present invention is to apply the above-mentioned Lactobacillus reuteri to the preparation of feed additives or drugs for antibacterial, promoting animal growth, improving animal intestinal inflammation and injury, enhancing animal antioxidant ability, regulating animal intestinal flora, etc.
[0010] In a preferred specific embodiment of the present invention, the Lactobacillus reuteri ZY18 is applied to the preparation of feed additives or drugs for inhibiting bacteria.
[0011] In a preferred specific embodiment of the present invention, the bacteria include but are not limited to Escherichia coli, Staphylococcus aureus or Salmonella.
[0012] In a preferred specific embodiment of the present invention, the Lactobacillus reuteri ZY18 is applied to the preparation of feed additives for promoting animal growth.
[0013] In a preferred specific embodiment of the present invention, the Lactobacillus reuteri ZY18 is applied to the preparation of feed additives or drugs for improving animal intestinal inflammation and injury.
[0014] In a preferred specific embodiment of the present invention, the improvement of animal intestinal inflammation is to reduce the pathological inflammation scores of the jejunum, ileum and colon; increase the relative expression levels of anti-inflammatory cytokine-related genes; and reduce the relative expression levels of pro-inflammatory cytokine-related genes.
[0015] In a preferred specific embodiment of the present invention, the improvement of animal intestinal injury is to increase the expression levels of intestinal barrier genes; increase the ileal villus height and the ratio of villus height to crypt depth.
[0016] In a preferred specific embodiment of the present invention, the Lactobacillus reuteri ZY18 is applied to the preparation of feed additives for enhancing animal antioxidant ability.
[0017] A preferred specific embodiment of the present invention is to apply the Lactobacillus reuteri ZY18 to the preparation of a feed additive or a drug for regulating the intestinal flora of animals.
[0018] A preferred specific embodiment of the present invention is that the animal is a pig or a mouse.
[0019] A strain of Lactobacillus reuteri ZY18 was isolated and screened from the feces of weaned piglets, and identified by morphology and molecular biology. The Lactobacillus reuteri ZY18 has the fastest growth rate after 3 h and enters the logarithmic growth phase. After 13 h, the growth of the strain slows down and enters the plateau phase; it has good acid-producing performance; it has tolerance to the simulated gastrointestinal environment; it can tolerate acid or bile salt environment and has bile salt hydrolase activity; there is no hemolytic ring around it, which is γ-hemolysis and has good safety; it has good hydrophobic ability, self-aggregation ability and good adhesion ability.
[0020] It has been experimentally proven that the Lactobacillus reuteri ZY18 has the abilities of antibacterial, promoting animal growth, improving animal intestinal inflammation and injury, enhancing animal antioxidant ability, and regulating animal intestinal flora. Therefore, Lactobacillus reuteri ZY18 has application prospects in the preparation of feed additives or drugs. Brief Description of the Drawings
[0021] Figure 1 It is the colony and cell morphology diagram of strain ZY18; among them, Figure 1 -A is the colony morphology of strain ZY18; Figure 1 -B is the cell morphology of strain ZY18 under the microscope (1000×).
[0022] Figure 2 It is the growth curve, the change of pH value of the bacterial liquid and the lactic acid content of the bacterial liquid of Lactobacillus reuteri ZY18; among them, Figure 2 -A is the growth curve of Lactobacillus reuteri ZY18; Figure 2 -B is the change of pH value of the bacterial liquid of Lactobacillus reuteri ZY18; Figure 2 -C is the lactic acid content of the bacterial liquid of Lactobacillus reuteri ZY18.
[0023] Figure 3 It is the tolerance of Lactobacillus reuteri ZY18 to simulated gastric / intestinal fluid; among them, Figure 3 -A is the tolerance of Lactobacillus reuteri ZY18 to simulated gastric fluid; Figure 3 -B is the tolerance of Lactobacillus reuteri ZY18 to simulated intestinal fluid.
[0024] Figure 4 It is the tolerance of Lactobacillus reuteri ZY18 to acidic environment and bile salts; among them,Figure 4 -A is the tolerance of Lactobacillus reuteri ZY18 to acidic environment; Figure 4 -B is the tolerance of Lactobacillus reuteri ZY18 to bile salts.
[0025] Figure 5 is the bile salt hydrolase activity of Lactobacillus reuteri ZY18.
[0026] Figure 6 is the antibacterial property of Lactobacillus reuteri ZY18.
[0027] Figure 7 is the hemolytic property of Lactobacillus reuteri ZY18; wherein, Figure 7 -A is the hemolysis of Escherichia coli K88 as a positive control; Figure 7 -B is the hemolysis of Lactobacillus reuteri ZY18.
[0028] Figure 8 is the surface hydrophobicity and self-aggregation ability of Lactobacillus reuteri ZY18; wherein, Figure 8 -A is the surface hydrophobicity of Lactobacillus reuteri ZY18; Figure 8 -B is the self-aggregation ability of Lactobacillus reuteri ZY18.
[0029] Figure 9 is the adhesion of Lactobacillus reuteri ZY18 to Caco-2 cells and IPEC-J2 cells.
[0030] Figure 10 is the effect of Lactobacillus reuteri ZY18 on the growth performance of mice and the populations of Lactobacillus and Escherichia coli in feces; wherein, Figure 10 -A is the effect of Lactobacillus reuteri ZY18 on the body weight of mice; Figure 10 -B is the effect of Lactobacillus reuteri ZY18 on the daily feed intake of mice; Figure 10 -C is the effect of Lactobacillus reuteri ZY18 on the populations of Lactobacillus and Escherichia coli in the feces of mice on the 14th day of the experiment; Figure 10 -D is the effect of Lactobacillus reuteri ZY18 on the populations of Lactobacillus and Escherichia coli in the feces of mice on the 21st day of the experiment.
[0031] Figure 11 is the effect of Lactobacillus reuteri ZY18 on the pathology, inflammation score of the ileum, colon and jejunum of mice and the effect on ileal mucin; wherein, Figure 11-A is the hematoxylin-eosin staining pathological section images of the jejunum, ileum and colon tissues of mice in the Con group, K88 group, ZY15-K88 group and ZY18-K88 group; the light blue arrow indicates the mucosal epithelium, the golden arrow indicates the crypt, the yellow arrow indicates the submucosa; the dark blue arrow indicates a large number of neutrophil infiltrations and monocyte infiltrations in the deep mucosa layer, serosa layer, and proliferation of small blood vessels in the lamina propria; the black arrow indicates a small amount of scattered neutrophil infiltration, monocyte infiltration, local crypt damage and loss in the local lamina propria; the red arrow indicates angiogenesis in the lamina propria; the green arrow indicates the proliferation of fibrous tissue in the lamina propria at the site with obvious inflammation; Figure 11 -B is the pathological inflammation score of the jejunum; Figure 11 -C is the pathological inflammation score of the ileum; Figure 11 -D is the pathological inflammation score of the colon; Figure 11 -E is the gene expression level of the mucin Mcu2 in the ileum; Figure 11 -F is the gene expression level of the zonula occludens protein ZO-1 in the ileum.
[0032] Figure 12 is the analysis of differentially expressed genes in the ileum; among them, Figure 12 -A is the differential expression of specific mRNA genes in the samples of the Con group and the K88 group; Figure 12 -B is the differential expression of specific mRNA genes in the samples of the K88 group and the ZY18-K88 group; Figure 12 -C is the differential expression of specific mRNA genes in the samples of the ZY18-K88 group and the ZY15-K88 group.
[0033] Figure 13 is the effect of Lactobacillus reuteri ZY18 on the intestinal permeability and antioxidant capacity of mice; among them, Figure 13 -A is the content level of serum diamine oxidase DAO; Figure 13 -B is the fluorescence intensity of serum reactive oxygen species ROS; Figure 13 -C is the content level of serum superoxide dismutase SOD.
[0034] Figure 14 is the effect of Lactobacillus reuteri ZY18 on the cecal flora of mice; among them, Figure 14 -A is the effect of Lactobacillus reuteri ZY18 on the phylum level of cecal bacteria in mice; Figure 14 -B is the effect of Lactobacillus reuteri ZY18 on the family level of cecal bacteria in mice; Figure 14 -C is the effect of Lactobacillus reuteri ZY18 on the genus level of cecal bacteria in mice. Detailed implementation manners
[0035] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description progresses. However, it should be understood that the described embodiments are merely exemplary and do not constitute any limitation to the scope of the present invention. Those skilled in the art should understand that modifications or substitutions can be made to the details and forms of the technical solutions of the present invention without departing from the spirit and scope of the present invention, but such modifications or substitutions all fall within the protection scope of the present invention.
[0036] Example 1 Isolation, purification and molecular biological identification of Lactobacillus reuteri ZY18 1 Experimental method 1.1 Isolation and purification of strain ZY18 Using sterile forceps, take 1 g of feces from weaned piglets, dilute and shake it in sterile physiological saline buffer in a serial dilution manner, and respectively pipette 100 μL of the bacterial suspensions with dilution factors of 10 -5 、10 -6 、10 -7 and spread them on MRS solid medium, and incubate in an incubator at 37 °C for 24 h. Pick single colonies for Gram staining and microscopic examination, pick single Gram-positive bacilli, and streak and purify them on MRS solid medium (Solarbio, Beijing, China, catalog number: M8330) more than 3 times. Select colonies with larger size and stronger reproductive ability.
[0037] 1.2 Molecular biological identification of strain ZY18 Extract the DNA of bacteria according to the instructions of the manual (TianGen Co., Ltd., Beijing, China, catalog number: DP302), and then amplify it with the universal primers 27F / 1492R for bacterial 16S rDNA. After PCR amplification, identify it by 2% agarose gel electrophoresis and then sequence it, and compare the results in the NCBI database.
[0038] 27F: AGAGTTTGATCCTGGCTCAG (SEQ ID NO.1); 1492R: GGTTACCTTGTTACGACTT (SEQ ID NO.2).
[0039] 2 Experimental results The colony and cell morphological characteristics of strain ZY18 are as Figure 1 shown. The colony shape of strain ZY18 on MRS solid medium is nearly round, the color is milky white and shiny ( Figure 1 -A); after Gram staining and observation under a microscope, Gram-positive bacteria in the shape of rods can be seen ( Figure 1 -B).
[0040] PCR amplification was carried out using universal primers for bacterial 16S rDNA. The obtained band was about 1400 bp in length. The PCR product was sent for sequencing. The sequencing results of 16S rDNA were used to search for similar sequences in the NCBI database (accession numbers: CP006011.1, MN537548.1, CP110802.1, MT707273.1, CP014786.1, KU754503.1), and the homology was above 99%. It was identified that the strain ZY18 was Lactobacillus reuteri ( Lactobacillus reuteri ).
[0041] Experimental Example 1 Growth characteristics and acid production characteristics of Lactobacillus reuteri ZY18 1 Experimental method The activated Lactobacillus reuteri ZY18 bacterial liquid for two generations was inoculated into 30 mL of MRS liquid medium at an inoculation amount of 1%, and cultured in a constant temperature incubator at 37 °C for 24 h. Starting from 0 h, the absorbance value (OD 600 ) was measured once every 1 h for 26 consecutive hours; the pH value was measured once every 24 h, and once at 24 h and 48 h respectively; the Lactobacillus reuteri ZY18 bacterial liquid cultured for 14 h was selected, and according to the method of Nanjing Jiancheng lactic acid kit, the lactic acid content (mmol / L) in the culture solution was measured.
[0042] 2 Experimental results The experimental results were as Figure 2 shown. After inoculation, Lactobacillus reuteri ZY18 continued to grow, and the growth rate was the fastest after 3 h, entering the logarithmic growth phase. After 13 h, the strain growth slowed down and entered the plateau phase ( Figure 2 -A); the pH value of the Lactobacillus reuteri ZY18 bacterial liquid gradually decreased after inoculation, and the change of the bacterial liquid pH value tended to be gentle after 24 h, and was basically stable at about 4.38 ( Figure 2 -B); the lactic acid concentration in the Lactobacillus reuteri ZY18 bacterial liquid after 14 h of culture was 56.37 mmol / L ( Figure 2 -C).
[0043] Experimental Example 2 Tolerance of Lactobacillus reuteri ZY18 to simulated gastrointestinal environment 1 Experimental method 1 mL of the activated Lactobacillus reuteri ZY18 bacterial liquid for two generations was inoculated into 9 mL of simulated gastric juice and simulated intestinal juice sterilized by filtration through a microporous membrane (0.22 μm), and cultured aerobically at 37 °C for 3 h. The OD values of the bacterial liquid were measured at 0 h, 0.5 h and 3 h respectively, and at the same time, plate colony counting was carried out to calculate the survival rate.
[0044] 2 Experimental results The experimental results were as Figure 3As shown, in the simulated gastric juice environment, the survival rate of Lactobacillus reuteri ZY18 was 24.00% at 0.5 h and 18.37% at 3.0 h ( Figure 3 -A); in the simulated intestinal juice environment, the survival rate of Lactobacillus reuteri ZY18 was 46.00% at 0.5 h and 15.31% at 3.0 h ( Figure 3 -B).
[0045] Test Example 3 Acid and Bile Salt Tolerance Tests of Lactobacillus reuteri ZY18 1 Test Method Adjust the pH of MRS liquid medium to 2.0, 3.0, 4.0, and 5.0 with 1 mol / L hydrochloric acid. Sterilize the MRS medium with different pH values at 121 °C for 15 min and cool for later use. Inoculate Lactobacillus reuteri ZY18 into MRS liquid medium with different pH values at an inoculation amount of 1% (v / v), culture at 37 °C for 24 h, and measure OD 600 , and use Lactobacillus reuteri ZY18 cultured in MRS without pH adjustment as the control CT. For the calculation of the survival ratio, the actual OD 600 value / OD of the corresponding CT 600 × 100%.
[0046] Add a certain amount of porcine bile salt to MRS liquid medium to adjust the final concentration of porcine bile salt in the MRS medium to 0 (control), 0.15%, 0.30%, and 0.60% respectively. Sterilize the above MRS culture media containing different concentrations of bile salt at 121 °C for 15 min and cool for later use. Inoculate Lactobacillus reuteri ZY18 into the above MRS liquid media containing different concentrations of porcine bile salt at an inoculation amount of 1% (v / v), use the medium without bile salt as the control, culture at 37 °C for 24 h, and evaluate the bile salt tolerance effect by measuring the OD 600 value. The calculation of the survival ratio: actual OD 600 value / OD of the corresponding CT 600 × 100%.
[0047] 2 Test Results The test results are as Figure 4 shown. In the simulated acidic environment, when the pH value was 2, the survival rate of Lactobacillus reuteri ZY18 was 11.61%; when the pH value was 3, the survival rate of Lactobacillus reuteri ZY18 was 11.48%; when the pH value was 4, the survival rate of Lactobacillus reuteri ZY18 was 54.85%; when the pH value was 5, the survival rate of Lactobacillus reuteri ZY18 was 85.04% ( Figure 4-A); In the simulated bile salt environment, in the 0.15% bile salt environment, the survival rate of Lactobacillus reuteri ZY18 was 2.85%. In the 0.30% bile salt environment, the survival rate of Lactobacillus reuteri ZY18 was 5.60%. In the 0.60% bile salt environment, the survival rate of Lactobacillus reuteri ZY18 was 19.74% ( Figure 4 -B).
[0048] Test Example 4: Bile salt hydrolase activity test of Lactobacillus reuteri ZY18 1 Test method Gently press the sterilized filter paper disc onto the solid medium for bile salt hydrolase (2.0 g of bovine bile salt, 2.0 g of sodium thioglycolate, 3.7 g of CaCl 2 3, and 20.0 g of agar powder dissolved in 1000 mL of MRS medium), add 20 μL of the activated Lactobacillus reuteri ZY18 bacterial solution to the filter paper disc, and culture it under anaerobic conditions at 37 °C for 72 h. Use the filter paper disc added with MRS liquid medium as a control, and observe whether there is a white precipitate around the filter paper disc after culture. If a white precipitate is produced, it can be preliminarily confirmed that Lactobacillus reuteri ZY18 has bile salt hydrolase activity.
[0049] 2 Test results The test results are as Figure 5 shown. Since lactic acid bacteria produce bile salt hydrolase (BSH) which can hydrolyze conjugated bile salts into unconjugated bile salts, and unconjugated bile salts can combine with Ca in the medium under acidic conditions 2+ to form a precipitate. Therefore, Lactobacillus reuteri ZY18 has strong BSH activity.
[0050] Test Example 5: Antibacterial test of Lactobacillus reuteri ZY18 1 Test method Inoculate pathogenic bacteria (Escherichia coli K88, Escherichia coli K99, Staphylococcus aureus, Salmonella) at an inoculation amount of one-thousandth, that is, 50 μL, into 50 mL of LB liquid medium respectively, and culture and activate them at 37 °C for 12 h. Cool the LB solid medium to about 50 °C, add pathogenic bacteria (10 6 CFU / mL) to the medium at an inoculation amount of one-thousandth, mix well and pour it into a petri dish to cool. Place 3 sterilized Oxford cups evenly in the petri dish, and then add 200 μL of the culture solution of Lactobacillus reuteri ZY18 and 200 μL of MRS liquid medium as a control to the Oxford cups respectively, and culture them at 37 °C for 24 h. Observe and measure the size of the antibacterial zone, and record the diameter of the antibacterial zone.
[0051] 2 Test results The test results are as follows Figure 6 shown. The diameter of the inhibition zone of Lactobacillus reuteri ZY18 against Escherichia coli K88 was 1.90 cm, the diameter of the inhibition zone against Escherichia coli K99 was 1.88 cm, the diameter of the inhibition zone against Staphylococcus aureus was 1.87 cm, and the diameter of the inhibition zone against Salmonella was 1.90 cm.
[0052] Test Example 6 Hemolysis test of Lactobacillus reuteri ZY18 1 Test method Lactobacillus reuteri ZY18 after two generations of activation was streaked and inoculated into Columbia blood agar medium (ThermoFisher Scientific, Waltham, USA, catalog number: CM0331B-A), and cultured at 37 °C for 48 h, with Escherichia coli K88 as the control strain.
[0053] 2 Test results The test results are as follows Figure 7 shown. A clear hemolysis ring appeared around Escherichia coli K88, which was β-hemolysis ( Figure 7 -A); no hemolysis ring appeared around Lactobacillus reuteri ZY18, which was γ-hemolysis and had safety ( Figure 7 -B).
[0054] Test Example 7 Test of surface hydrophobicity and self-aggregation ability of Lactobacillus reuteri ZY18 1 Test method The determination of surface hydrophobicity was carried out by the microbial adhesion to hydrocarbons method with appropriate modifications. After Lactobacillus reuteri ZY18 was statically cultured at 37 °C for 24 h, it was centrifuged at 4 °C and 5000 rpm for 10 min, the supernatant was discarded, and the precipitate was collected. The cells were washed twice with sterile PBS buffer and then resuspended in sterilized 0.1 M KNO 3 solution, and the concentration of the bacterial suspension was adjusted to 10 7 ~10 8 CFU / mL, and the OD 600 reached 0.5 ± 0.2 (A 0 ). 3 mL of the bacterial suspension was taken from it and 1 mL of xylene was added, vortexed for 3 min, and left to stand at room temperature for 20 min. The aqueous phase was aspirated, and the absorbance of the aqueous phase was measured at 600 nm (A 1 ). Surface hydrophobicity (%) = (1 - A 1 / A 0 ) × 100.
[0055] The method for measuring the self-aggregation ability was modified appropriately based on the reported method in the literature. Freshly cultured Lactobacillus reuteri ZY18 was centrifuged at 4 °C and 5000 rpm for 10 min, the supernatant was discarded, and the cells were collected. The cells were washed twice with sterile PBS buffer and resuspended with sterile PBS buffer, and the suspension concentration of Lactobacillus reuteri ZY18 was adjusted to 10 7 ~10 8 CFU / mL, and the OD 600 reached 0.5 ± 0.2 (A 0h ). 2 mL of the cell suspension was vortexed for 10 s and left standing at 37 °C for 2 h. 1 mL of the supernatant after standing was taken, and its absorbance at 600 nm (A 2h ) was measured. The self-aggregation ability (%) = 1 - (A 2h / A 0h ) × 100.
[0056] 2 Test results The hydrophobicity of the bacterial surface is widely used in basic experiments to reflect the adhesion of bacteria. The self-aggregation ability plays an important role in the formation of bacterial biofilms and also affects the colonization of lactic acid bacteria in the intestine. The test results are as Figure 8 shown. The surface hydrophobicity of Lactobacillus reuteri ZY18 is 81.81% ( Figure 8 -A), and the self-aggregation ability is 42.10% ( Figure 8 -B).
[0057] Test Example 8 Adhesion test of Lactobacillus reuteri ZY18 1 Test method The adhesion ability of Lactobacillus reuteri ZY18 to Caco-2 cells and IPEC-J2 cells was detected by microscopy. Caco-2 cells / IPEC-J2 cells were inoculated into 6-well plates and cultured in an incubator at 37 °C and 5% CO 2 . The culture medium was changed every other day. When the cells grew to a monolayer and the cell aggregation degree reached more than 80%, the culture medium was aspirated, washed twice with sterile PBS buffer, and 1 mL of Lactobacillus reuteri with the adjusted concentration (10 6 CFU / mL) or an equal amount of DMEM solution (Solarbio, Beijing, China, catalog number: 31600-20*500 mL) was added as a control. At 5% CO 2Incubate in an incubator at 37 °C for 2 h. Wash twice with sterile PBS solution to remove the unadhered Lactobacillus reuteri ZY18, fix with methanol for 30 min, perform Gram staining (0.5% crystal violet), and randomly observe 20 fields under an oil immersion microscope (1000×) to observe the adhesion of Lactobacillus reuteri ZY18 to Caco-2 cells / IPEC-J2 cells.
[0058] 2 Test results The test results are as Figure 9 shown. Lactobacillus reuteri ZY18 has a complete morphology, and it is also found that Lactobacillus reuteri ZY18 has good adhesion ability around Caco-2 cells and IPEC-J2 cells.
[0059] Test Example 9 Application test of Lactobacillus reuteri ZY18 1 Test design The test adopted a completely randomized design. Eighty 4-week-old C5BL / 6 mice were randomly divided into 4 treatment groups, with 20 mice in each treatment group. Each mouse was used as 1 replicate. The pre-feeding period was 1 week, and the formal test period was 21 days. During the test period, the diets of the control group and each test group were the same. During the test period, the mice in the ZY18-K88 group were intragastrically administered Lactobacillus reuteri ZY18 provided by the present invention every day, and the mice in the ZY15-K88 group were intragastrically administered Lactobacillus reuteri ZY15 disclosed in CN118460435A (its microbial preservation number is: CGMCC No. 28937) every day. The intragastric administration dose of both groups was 200 μL / mouse, and the bacterial concentration was 1.0×10 9 CFU / mL; the mice in the control group (Con) and the K88 group were intragastrically administered the same dose of MRS medium without Lactobacillus reuteri every day. On the 15th, 17th, 19th, and 21st days of the test, the mice in the K88 group, the ZY15-K88 group, and the ZY18-K88 group were challenged with enterotoxigenic Escherichia coli K88, and the intragastric administration dose was 200 μL / mouse, and the bacterial concentration was 1.0×10 9 CFU / mL; the mice in the Con group were intragastrically administered the same dose of LB medium without enterotoxigenic Escherichia coli K88 every day. During the test period, the mice were allowed to eat and drink freely, were kept in the same environment at a temperature of 25 °C, and were subjected to a 12-hour light / dark cycle. On the 22nd day of the test, the mice were sacrificed after collecting blood from the eyeballs.
[0060] 2 Sample collection and index determination 2.1 Growth performance Weigh once a week during the test period, record the body weight of each mouse in each group, record the feed intake, and calculate the average daily feed intake.
[0061] 2.2 Detection of lactic acid bacteria and Escherichia coli flora in feces On the 14th and 21st days of the experiment, feces of mice in each group were collected. 0.1 g of feces was added to 1 mL of sterile physiological saline. After homogenization with a 1 mm sterile steel ball, it was serially diluted to 1.0×10 -6 , and 100 μL was spread on eosin methylene blue agar (EMB, Solarbio, Beijing, China, catalog number: LA2220) and MRS agar plates with sterile glass beads. After aerobic incubation at 37°C for about 18 h, the numbers of Lactobacillus and Escherichia coli flora were counted respectively.
[0062] 2.3 Intestinal pathological inflammation score After the experiment, the mice were anesthetized with sevoflurane. After collecting blood, the mice were sacrificed. The jejunum, ileum and colon were separated respectively. 1 cm of intestinal segments were taken and fixed in 4% paraformaldehyde solution for preservation. Paraffin sections were made. After hematoxylin-eosin staining, intestinal morphology measurement and pathological observation were carried out under a microscope. The tissue inflammation pathological scoring criteria are shown in Table 1. For jejunum and ileum tissues, three typical positions were selected for each sample, and three complete crypt-villi were selected for each position. The villus height and adjacent crypt depth were measured, and the ratio was calculated.
[0063] Table 1 Tissue damage inflammation score
[0064] 2.4 Ileum transcriptome sequencing analysis After the experiment, the ileum tissue was cut back with sterile surgical scissors, rinsed with sterile physiological saline and stored in a 2 mL cryotube, and stored at -80°C for testing. The transcriptome sequencing was completed by the company. Total RNA was extracted from ileum samples using an RNA extraction kit (Qiagen, Hilden, Germany). The RNA concentration and purity were measured by NanoDrop 2000. After cDNA library construction and cDNA library quality detection, the library was sequenced on the Illumina Novaseq platform. The DESeq2 R software package (v.1.20.0) was used for differential expression analysis between two groups. Genes with an adjusted P p < 0.05 were differential expression genes.
[0065] 2.5 Real-time fluorescence quantitative PCR detection Total RNA was extracted from ileum samples using an RNA extraction kit. The total RNA concentration and quality were detected by a NanoDrop 2000 spectrophotometer. The absorbance ratio (260 / 280 nm) of high-quality RNA was 1.8 - 2.0. 1 μg of RNA was reverse transcribed into cDNA using the PrimeScriptTM RT reagent kit. After the obtained cDNA was diluted 5-fold, it was stored at -80°C for standby. Select GAPDHThe gene was used as an internal reference gene, and SYBR ® Premix Ex Taq TM reagent and Applied Biosystems QuantStudio TM Real-Time PCR system were used to detect the relative expression levels of candidate genes. The nucleotide sequences of the primers for real-time fluorescence quantitative PCR are shown in Table 2. Amplification program: 95°C for 30 s, 40 cycles: 95°C for 5 s, 60°C for 30 s, followed by 95°C for 10 s, starting from 65°C and increasing by 0.5°C per cycle until 95°C and lasting for 15 s, and then 65°C for 15 s. All samples were replicated 3 times, and the relative expression levels of candidate genes were calculated using the 2 −△△Ct method.
[0066] Table 2 Primer sequences for real-time fluorescence quantitative PCR
[0067] 2.6 Detection of intestinal permeability and serum antioxidant On the 22nd day of the experiment, mouse blood was collected into a centrifuge tube by enucleating the eyeballs. After standing at room temperature for 2 h, it was centrifuged at 3000×g for 15 min in a 4°C low-temperature centrifuge. The separated serum was aliquoted into 2 mL cryotubes and stored at -80°C for further testing. ELISA kits and biochemical kits (Shanghai Enzyme-linked Biotechnology Co., Ltd., Shanghai, China, DAO catalog number: ml002199, SOD catalog number: ml105860, ROS catalog number: ml092661) were used to measure serum antioxidant and intestinal permeability indicators according to the instructions.
[0068] 2.7 Cecal microbiota detection Total genomic DNA of cecal chyme was extracted using a fecal DNA kit (TianGen Co., Ltd., Beijing, China, catalog number: DP328-02). The variable region V3-V4 of the 16S rRNA gene was amplified using the universal primers 341F / 806R. All the generated amplicons were evenly mixed, and then the mixed amplified PCR products were purified using a kit (Qiagen, Duesseldorf, Germany). The sequencing library was constructed using the TruSeq® DNA PCR-Free Sample Preparation kit according to the instructions. After evaluating the quality of the sequencing library, the library was sequenced on the Illumina NovaSeq platform. For the previously obtained valid sequences, the QIIME2 software was used for denoising (v.QIIME2-202006) to generate initial amplicon sequence variants (asv) (default: DADA2), and the asv with an abundance less than 5 was filtered out. The Alpha diversity index was calculated using QIIME2 to analyze the diversity, richness, and evenness of the bacterial community in the samples.
[0069] The nucleotide sequences of the universal primers 341F / 806R are shown below: 341F: CCTAYGGGRBGCASCAG (SEQ ID NO.9); 806R: GGACTACNNGGGTATCTAAT (SEQ ID NO.10).
[0070] 2.8 Statistical analysis The data were statistically analyzed using SPSS 22.0 (IBM Corp., Armonk, NY, USA). One-way ANOVA was performed using the method of comparing means. When there were significant differences between groups, the Duncan method was used for multiple comparisons. GraphPad Prism (v.9.0, GraphPad Software, San Diego, CA, USA) was used for plotting, and the data were expressed as mean ± standard error. P <0.05 was considered significantly different and indicated by "*"; P <0.01 was considered extremely significantly different and indicated by "**".
[0071] 3 Experimental results 3.1 Growth performance The experimental results of growth performance are as Figure 10 shown. Compared with the Con group and the K88 group, intragastric administration of Lactobacillus reuteri ZY18 significantly increased the body weight of mice on the 14th day of the experiment ( P≤ 0.05) ( Figure 10 -A), significantly reducing the average daily feed intake of mice ( P ≤0.05) ( Figure 10 -B); Although the body weight of the mice in the group gavaged with Lactobacillus reuteri ZY15 increased, it was not significant ( P ≥ 0.05) ( Figure 10 -A). Compared with the Con group, enterotoxigenic Escherichia coli (ETEC) K88 significantly reduced the body weight of mice on the 21st day of the experiment ( P ≤ 0.05) ( Figure 10 -A), and reduced the average daily feed intake during the period from 14 to 21 days ( P ≥ 0.05) ( Figure 10 -B); Compared with the K88 group, gavaging with Lactobacillus reuteri ZY15 significantly increased the body weight of mice on the 21st day of the experiment ( P ≤ 0.05) ( Figure 10 -A), and gavaging with Lactobacillus reuteri ZY18 extremely significantly increased the body weight of mice on the 21st day of the experiment ( P ≤ 0.01) ( Figure 10 -A).
[0072] On the 14th day of the experiment, gavaging with Lactobacillus reuteri ZY15 or Lactobacillus reuteri ZY18 significantly increased the number of lactic acid bacteria flora in the feces of mice ( P ≤ 0.05), and had no significant effect on the number of Escherichia coli flora in the feces ( P ≥ 0.05) ( Figure 10 -C). On the 21st day of the experiment, gavaging with Lactobacillus reuteri ZY15 or Lactobacillus reuteri ZY18 extremely significantly increased the number of lactic acid bacteria flora in the feces of mice ( P ≤ 0.01); Compared with the Con group, the K88 group, ZY15-K88 group or ZY18-K88 group of mice extremely significantly increased the number of Escherichia coli flora in the feces ( P ≤ 0.01), but compared with the K88 group, gavaging with Lactobacillus reuteri ZY15 or Lactobacillus reuteri ZY18 extremely significantly reduced the number of Escherichia coli flora in the feces of mice ( P ≤ 0.01), and there was no significant difference between the ZY15-K88 group and the ZY18-K88 group ( P ≥ 0.05) ( Figure 10 -D).
[0073] 3.2 Intestinal pathological inflammation score The experimental results are as Figure 11As shown. Compared with the Con group, enterotoxigenic Escherichia coli (ETEC) K88 induced infiltration of neutrophils and monocytes in the deep layers of the ileum, colon, and jejunum mucosa into the serosa layer, local mucosal erosion, and crypt disappearance, angiogenesis in the lamina propria mucosa, and hyperplasia of lamina propria fibrous tissue, resulting in epithelial damage and local mucosal erosion. Oral administration of Lactobacillus reuteri ZY15 or Lactobacillus reuteri ZY18 had a significant improvement effect ( Figure 11 -A). Compared with the Con group, enterotoxigenic Escherichia coli (ETEC) K88 significantly increased the pathological inflammation scores of the ileum, colon, and jejunum ( P ≤ 0.01); compared with the K88 group, oral administration of Lactobacillus reuteri ZY15 significantly reduced the pathological inflammation scores of the jejunum and ileum ( P ≤ 0.05), but the reduction in the colon was not significant ( P ≥0.05); oral administration of Lactobacillus reuteri ZY18 significantly reduced the pathological inflammation scores of the jejunum, ileum, and colon ( P ≤ 0.01). The pathological inflammation scores of the ileum, colon, and jejunum in the ZY18-K88 group were significantly lower than those in the ZY15-K88 group ( P ≤ 0.01), but there was no significant difference from the Con group ( P ≥ 0.05) ( Figure 11 -B, Figure 11 -C, Figure 11 -D). The relative mRNA gene expression levels of intestinal mucin Muc2 and tight junction protein ZO-1 in the ileum of mice in the ZY18-K88 group were significantly higher than those in the K88 group and the Con group, respectively ( P ≤0.05), and there was no significant change in the ZY15-K88 group ( P ≥ 0.05) ( Figure 11 -E, Figure 11 -F). Considering the pathological scores of the ileum, colon, and jejunum and the expression levels of intestinal barrier genes, Lactobacillus reuteri ZY18 had a significantly better improvement effect on intestinal barrier damage and inflammation caused by enterotoxigenic Escherichia coli (ETEC) K88 than Lactobacillus reuteri ZY15.
[0074] 3.3 Intestinal morphology observation The observation results are shown in Table 3. Compared with the Con group, enterotoxigenic Escherichia coli (ETEC) K88 significantly decreased the ratio of jejunal villus height to crypt depth ( P ≤ 0.01), and there was no significant difference among the K88 group, ZY15-K88 group, and ZY18-K88 group ( P ≥ 0.05). Compared with the Con group, the villus height and the ratio of villus height to crypt depth of the ileum in the K88 group and the ZY15-K88 group of mice were significantly decreased ( P≤ 0.01); compared with the K88 group, the ileal villus height and the ratio of villus height to crypt depth in the ZY15-K88 group and the ZY18-K88 group of mice were extremely significantly increased ( P ≤ 0.01), and the ileal crypt depth was extremely significantly decreased ( P ≤0.01); the ileal villus height and the ratio of villus height to crypt depth in the ZY18-K88 group of mice were extremely significantly higher than those in the ZY15-K88 group ( P ≤ 0.01), and there was no significant difference in the ileal crypt depth between the two groups ( P ≥ 0.05); the ileal villus height and the ratio of villus height to crypt depth in the ZY18-K88 group of mice were numerically higher than those in the Con group, but there was no significant difference from the Con group ( P ≥0.05). Based on the comprehensive morphological measurement results of the jejunum and ileum, Lactobacillus reuteri ZY18 had a significantly better effect on improving the small intestinal barrier and the functions of nutrient digestion and absorption caused by enterotoxigenic Escherichia coli (ETEC) K88 than Lactobacillus reuteri ZY15.
[0075] Table 3 Effects of Lactobacillus reuteri on the morphology of the jejunum and ileum of mice Note: In the data of the same row, the presence of the same letter or no letter indicates no significant difference ( P >0.05), and different lowercase letters indicate significant difference ( P <0.05).
[0076] 3.4 Ileal transcriptome sequencing analysis The test results are as Figure 12 shown. Compared with the Con group, enterotoxigenic Escherichia coli (ETEC) K88 significantly increased IL- 1b , HIF , IL-17 , TNF-α , IL-6 , AKT , mTOR ' relative expression levels of genes ( P ≤ 0.05), and significantly decreased EIF4 , iNOS , Muc2 , IL-22 ' relative expression levels of genes ( P ≤ 0.05) ( Figure 12 -A). Compared with the K88 group, intragastric administration of Lactobacillus reuteri ZY18 significantly increased IL-10 , IL-22 , IL-23 , cld1 , IL-10rb , Muc1 ,IL-22ra The relative gene expression levels of P ≥ 0.05), decreased IL-17a , IL-6 , IL-17rc The relative gene expression levels of P ≥ 0.05) ( Figure 12 -B). Compared with the ZY15-K88 group, intragastric administration of Lactobacillus reuteri ZY18 significantly increased Cldnd1 , IL-18 , IL-4 The relative gene expression levels of P ≤ 0.05), significantly decreased IL-11 , Tnfaip2 , IL-6a , IL-17rc The relative gene expression levels of P ≤0.05) ( Figure 12 -C). Compared with the K88 group and the ZY15-K88 group, intragastric administration of Lactobacillus reuteri ZY18 significantly increased the relative expression levels of anti-inflammatory cytokine-related genes and decreased the relative expression levels of pro-inflammatory cytokine-related genes.
[0077] 3.5 Intestinal permeability and serum antioxidant capacity The test results are as Figure 13 shown. Compared with the Con group, enterotoxigenic Escherichia coli (ETEC) K88 extremely significantly increased the levels of diamine oxidase (DAO) and reactive oxygen species (ROS) in the serum of mice ( P ≤ 0.01), extremely significantly decreased the protein expression level of serum superoxide dismutase (SOD) ( P ≤ 0.01) ( Figure 13 -A, Figure 13 -B, Figure 13 -C); The serum ROS levels of the ZY15-K88 group and the ZY18-K88 group of mice extremely significantly increased ( P ≤ 0.01), and there was no significant difference between the ZY15-K88 group and the ZY18-K88 group ( P ≥0.05) ( Figure 13 -B). Compared with the K88 group, intragastric administration of Lactobacillus reuteri ZY15 or Lactobacillus reuteri ZY18 extremely significantly decreased the serum DAO level ( P ≤ 0.01), extremely significantly increased the serum SOD protein level ( P ≤ 0.01), the serum ROS level of the ZY18-K88 group of mice significantly decreased ( P ≤ 0.05), and there was no significant difference between the ZY15-K88 group and the K88 group ( P ≥ 0.05) ( Figure 13 -A, Figure 13-B, Figure 13 -C). In summary, intragastric administration of Lactobacillus reuteri ZY15 or Lactobacillus reuteri ZY18 can reduce the intestinal permeability of mice and improve the antioxidant capacity of the body.
[0078] 3.6 Cecal flora diversity The test results are shown in Table 4. Compared with the Con group, enterotoxigenic Escherichia coli (ETEC) K88 significantly reduced the Shannon index of the cecal flora of mice ( P ≤ 0.01), and reduced the Observe_species, Chao1, and Simpson indices ( P ≥ 0.05). The Observe_species, Chao1, and Shannon indices of the cecal flora of mice in the ZY15-K88 group and the ZY18-K88 group were higher than those in the K88 group ( P ≥ 0.05), and the Alpha diversity index of the cecal flora of mice in the ZY18-K88 group was higher than that in the ZY15-K88 group ( P ≥ 0.05). In summary, intragastric administration of Lactobacillus reuteri ZY15 and ZY18 can alleviate the reduction of Alpha diversity of the intestinal flora of mice caused by enterotoxigenic Escherichia coli (ETEC) K88 to a certain extent, and the alleviating effect of Lactobacillus reuteri ZY18 is better.
[0079] Table 4 Effects of Lactobacillus reuteri on Alpha diversity of cecal flora in mice
[0080] Note: Data in the same row with the same letter or no letter indicate no significant difference ( P > 0.05), and different lowercase letters indicate significant difference ( P < 0.05).
[0081] 3.7 Cecal flora microflora The test results are as Figure 14 shown. At the phylum level of bacteria ( Figure 14 -A), compared with the Con group, ETEC K88 challenge increased the Bacteroidota (Bacteroidetes) and Proteobacteria (Proteobacteria) relative abundances by 17.25% and 75.91% respectively, and decreased the Firmicutes (Firmicutes) and Verrucomicrobiota (Verrucomicrobia) relative abundances by 23.28% and 65.31% respectively. Compared with the Con group and the K88 group, the Verrucomicrobiota relative abundances in the ZY15-K88 group and the ZY18-K88 group increased from 0.49% and 0.17% to 7.68% and 11.08% respectively. Compared with the K88 group, the ZY15-K88 groupProteobacteria The relative abundance increased from 9.12% to 11.19%, an increase of 22.70%, in the ZY18-K88 group Proteobacteria The relative abundance decreased from 9.12% to 7.78%, a decrease of 14.69%. Compared with the ZY15-K88 group, in the ZY18-K88 group Proteobacteria the relative abundance decreased by 30.47%; in the ZY15-K88 group and the ZY18-K88 group Bacteroidota the relative abundances decreased by 17.87% and 11.40% respectively.
[0082] At the bacterial family level ( Figure 14 -B) and genus ( Figure 14 -C) levels, corresponding to Verrucomicrobiota compared with the Con group, in the K88 group Akkermansiaceae and Akkermansia (Akkermansia) the relative abundance decreased from 0.45% to 0.16%, a decrease of 64.44%; compared with the K88 group, in the ZY18-K88 group and the ZY15-K88 group Akkermansiacea e and Akkermansia the relative abundances increased from 0.16% to 7.68% and 11.02% respectively; compared with the ZY15-K88 group, in the ZY18-K88 group Akkermansiacea e and Akkermansia the relative abundance increased by 43.38%. Compared with the Con group, in the K88 group Parabacteroides the level increased from 0.53% to 2.75%. In the K88 group, the ZY15-K88 group and the ZY18-K88 group Muribaculaceae the levels decreased from 39.44% to 30.48%, 26.99% and 28.71% respectively, a decrease of 22.71%, 31.54% and 27.20%; compared with the K88 group, in the ZY18-K88 group and the ZY15-K88 group Parabacteroides the levels increased by 133.81% and 19.27% respectively. Compared with the ZY15-K88 group, in the ZY18-K88 group Parabacteroides the level increased by 96.03%, indicating that intragastric administration of Lactobacillus reuteri ZY15 and ZY18 can increase the enrichment of beneficial intestinal bacteria Akkermansia and Parabacteroides , and Lactobacillus reuteri ZY18 has a better enrichment effect. Corresponding to Proteobacteria compared with the Con group, in the K88 group Enterobacteriaceae and Escherichia-Shigella (Escherichia-Shigella) the relative abundances increased from 0.80% and 0.53% to 7.50% and 5.16% respectively; compared with the K88 group, in the ZY15-K88 group Enterobacteriaceae and Escherichia-ShigellaThe relative abundances increased from 7.50% and 5.16% to 8.08% and 7.98% respectively, with increases of 7.73% and 54.65% respectively; the ZY18-K88 group Enterobacteriaceae and Escherichia-Shigella the relative abundances decreased to 0.78% and 0.60% respectively; compared with the ZY15-K88 group, in the ZY18-K88 group Enterobacteriaceae and Escherichia-Shigella the relative abundances decreased from 8.08% and 7.98% to 0.78% and 0.60% respectively. This indicates that intragastric administration of Lactobacillus reuteri ZY18 can significantly inhibit the relative abundances of harmful bacteria Enterobacteriaceae and Escherichia-Shigella . In summary, intragastric administration of Lactobacillus reuteri ZY18 is significantly superior to Lactobacillus reuteri ZY15 in enriching the intestinal tract Akkermansia and Parabacteroides and inhibiting Escherichia-Shigella .
Claims
1. A strain of Lactobacillus reuteri ( Lactobacillus reuteri )ZY18, characterized in that, Its microbial preservation number is CGMCC No.28938.
2. Use of Lactobacillus reuteri ZY18 according to claim 1 in the preparation of a feed additive or medicine for inhibiting bacteria.
3. The use according to claim 2, characterized in that: The bacteria include but are not limited to Escherichia coli, Staphylococcus aureus or Salmonella.
4. Use of the Lactobacillus reuteri ZY18 according to claim 1 in the preparation of a feed additive for promoting animal growth.
5. Use of the Lactobacillus reuteri ZY18 according to claim 1 in the preparation of a feed additive or medicine for improving inflammation and damage of the animal intestine.
6. The use according to claim 5, characterized in that The improvement of intestinal inflammation in animals is to reduce the pathological inflammation score of jejunum, ileum or colon; or to increase the relative expression level of anti-inflammatory cytokine related genes; or to reduce the relative expression level of pro-inflammatory cytokine related genes.
7. The use according to claim 5, characterized in that The improvement of intestinal damage in animals is to increase the expression level of intestinal barrier genes; or to increase the height of ileal villi and the ratio of villi height to crypt depth.
8. Use of the Lactobacillus reuteri ZY18 according to claim 1 in the preparation of a feed additive for improving the antioxidant capacity of animals.
9. Use of the Lactobacillus reuteri ZY18 according to claim 1 in the preparation of a feed additive or medicine for regulating animal intestinal flora.
10. The use according to any one of claims 4 to 9, characterized in that: The animal is a pig or a mouse.
Citation Information
Patent Citations
Lactobacillus reuteri having probiotic effect and resisting ETEC (Enterotoxigenic Escherichia Coli) and application
CN108004179A
Lactobacillus reuteri and application thereof
CN112358999A
Lactobacillus reuteri and application thereof as feed additive
CN118460435A
Novel Lactobacillus reuteri strain capable of improving fatty liver and use thereof
KR102578389B1
Bacterial strains isolated from pigs
WO2013008039A2