A combined module for increasing the yield of polyketide natural products from actinomycetes, and the construction and application of recombinant bacteria containing such products.

Abstract

This invention relates to a combined module for increasing the yield of polyketide natural products from actinomycetes, and the construction and application of recombinant bacteria containing this module, belonging to the field of genetic engineering technology. To improve the yield of natural products such as polyketides and nonribosomal peptides, this invention utilizes a metabolic engineering strategy to combine and modify the CoASH synthetic pathway and the PPTase post-modification pathway, providing a combined module that can increase the yield of natural products from actinomycetes. This module consists of the CoASH cofactor synthesis module element SCoaA. R106A Composed of SCoaD and PPTase post-modification module element HPC3, recombinant vectors and recombinant bacteria containing this module were constructed. It was found that overexpression of this module can effectively increase the yield of natural products such as actinomycete polyketides, polyethers, and non-ribosomal peptides.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a combination module for increasing the yield of polyketide natural products from actinomycetes and the construction and application of recombinant bacteria containing such products. Background Art

[0002] Polyketides are a diverse class of natural products with broad biological and pharmacological activities. The biosynthesis of polyketides involves a series of Claisen decarboxylation condensations between activated malonyl derivatives and acyl thioesters. Various acyl-CoA precursors and polyketide synthesis modules play crucial roles in this process. Coenzyme A (CoASH) is the most common intermediate substrate in organisms, acting as an acyl carrier and carbonyl activating group, playing a central role in the biotransformation of many central metabolic processes. However, in addition to providing cofactors and activating substrates for precursor synthesis, CoASH also acts as a donor of the 4′ phosphate pantothenyl ethylamine group, converting it from an inactive acyl carrier protein (apo-ACP) to an active acyl carrier protein (holo-ACP) under the catalysis of phosphate pantothenyl ethylamine transferase (PPTase). Therefore, an adequate supply of CoASH is essential for the biosynthesis of polyketides.

[0003] Phosphopantoylthioethylamine transferases (PPTAs) are a superfamily of enzymes essential for the synthesis of various compounds, including polyketides, polyethers, and nonribosomal peptides. Based on their evolutionary characteristics, PPTases can be classified into three types: Accps (approximately 120 amino acids, acting on acyl carrier proteins of type II FAS), Sfp (twice the size of Accps, acting on carrier proteins of type I PKS and NRPS), and integrative (merged into a single domain at the carboxyl terminus of the fatty acid α-subunit, catalyzing the autophosphatase acylation of the amino-terminal carrier protein of the same polypeptide). The number, type, and efficiency of PPTases vary among different strains. This phenomenon may be due to the evolutionary differences in actinomycetes' potential to synthesize different types of secondary metabolites, resulting from adaptation to their required substrate tolerance. Therefore, the universality, broad functions, and diverse catalytic properties of PPTases determine their importance. PPTase-catalyzed ACP activation is an essential and crucial step in the biosynthesis of polyketides. Therefore, modifying the CoASH synthesis pathway and the PPTase post-modification pathway is of great significance for improving the yield of compounds such as actinomycete polyketides, polyethers, and nonribosomal peptides. Summary of the Invention

[0004] To increase the yield of natural products such as polyketides, polyethers, and nonribosomal peptides from actinomycetes, this invention provides a combined module that can improve the yield of natural products from actinomycetes by combining and modifying the CoASH synthetic pathway and the PPTase post-modification pathway through metabolic engineering strategies. This module consists of the CoASH cofactor synthesis module element SCoaA. R106A Composed of SCoaD and PPTase post-modification module element HPC3, recombinant vectors and recombinant bacteria containing this module were constructed. It was found that overexpression of this module can effectively increase the yield of natural products such as actinomycete polyketides, polyethers, and non-ribosomal peptides.

[0005] To solve the above-mentioned technical problems and achieve the corresponding technical effects, the present invention provides the following technical solution:

[0006] The first objective of this invention is to provide a combined module for increasing the yield of actinomycete natural products, the combined module comprising a CoASH cofactor synthesis module and a PPTase post-modification module, wherein the CoASH cofactor synthesis module comprises the element SCoaA R106A Composed of SCoaD, SCoaA R106A The nucleotide sequences of SCoaD are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively. The PPTase post-modification module is element HPC3, whose nucleotide sequence is shown in SEQ ID NO.3. The natural product is a polyketide compound, a polyether compound, or a non-ribosomal peptide compound.

[0007] The second objective of this invention is to provide a recombinant vector containing the aforementioned combined module, wherein the starting vector of the recombinant vector is pSET152, the promoter actII-orf4p fragment is amplified using the genome of Streptomyces coelicolor M145 as a template, and the promoter actII-orf4p fragment is combined with the element SCoaA in the combined module. R106A SCoaD and HPC3 are integrated into the starting vector to obtain the recombinant vector pSET152::orf4 SAD HPC3.

[0008] A third objective of this invention is to provide the application of the aforementioned recombinant vector pSET152::orf4 SAD HPC3 in increasing the production of actinolite from Streptomyces azureus.

[0009] A fourth objective of this invention is to provide a recombination carrier containing the aforementioned combined module, wherein the starting carrier of the recombination carrier is pSET152::ermEp*, and the element SCoaA in the combined module is... R106A SCoaD and HPC3 are integrated into the starting vector to obtain the recombinant vector pSET152::ermEp*SAD HPC3.

[0010] The fifth objective of this invention is to provide the application of the above-mentioned recombinant vector pSET152::ermEp*SAD HPC3 in increasing the yield of natural products from actinomycetes, wherein the natural products are polyketides, polyethers, or non-ribosomal peptides.

[0011] The sixth objective of this invention is to provide a recombinant bacterium containing the above-mentioned recombinant vector pSET152::orf4 SAD HPC3, wherein the recombinant bacterium is obtained by introducing the recombinant vector pSET152::orf4 SAD HPC3 into the starting strain of Streptomyces coelicolor M145.

[0012] The seventh objective of this invention is to provide the application of the above-mentioned recombinant bacteria in increasing the production of actinomycete red from Streptomyces azurite.

[0013] The eighth object of the present invention is to provide a recombinant bacterium containing the above-mentioned recombinant vector pSET152::ermEp*SAD HPC3, wherein the recombinant bacterium is obtained by introducing the recombinant vector pSET152::ermEp*SAD HPC3 into the starting strain of *Streptomyces bingchenggensis* BC-101-4, *Streptomyces avermitilis* S0, *Streptomyces tsukubaensis* NRRL18488, *Streptomyces rimosus* M4018, *Streptomyces venezuelae* ISP5230, *Streptomyces albus* IPPDNR, *Saccharopolyspora spinosa* NRRL 18395, or *Streptomyces roseosporus* NRRL 11379.

[0014] A ninth object of the present invention is to provide the application of the above-mentioned recombinant bacteria in increasing the yield of actinomycete natural products, wherein the natural products are polyketides, polyethers, or non-ribosomal peptides.

[0015] In one embodiment of the present invention, when the starting strain is *Streptomyces bingchengensis* BC-101-4, the recombinant strain is used to increase the yield of milbemycin or nanchangmycin; when the starting strain is *Streptomyces avermectin* S0, the recombinant strain is used to increase the yield of avermectin; when the starting strain is *Streptomyces tsukuba* NRRL 18488, the recombinant strain is used to increase the yield of FK506; when the starting strain is *Streptomyces crassiflora* M4018, the recombinant strain is used to increase the yield of oxytetracycline; when the starting strain is *Streptomyces venezulata* ISP5230, the recombinant strain is used to increase the yield of jedomycin; when the starting strain is *Streptomyces alba* IPPDNR, the recombinant strain is used to increase the yield of daunorubicin; when the starting strain is *Polyspora sacchariformis* NRRL 18395, the recombinant strain is used to increase the yield of spinosad; and when the starting strain is *Streptomyces roseospora* NRRL 11379, the recombinant strain is used to increase the yield of daptomycin.

[0016] The beneficial effects of this invention are:

[0017] This invention combines and modifies the CoASH synthesis pathway and PPTase post-modification pathway based on metabolic engineering strategies. While increasing the intracellular CoASH cofactor content of the strain to meet the demand for CoASH cofactors during secondary metabolite synthesis, it also enhances the PPTase post-modification pathway, drawing more precursors and cofactors towards polyketide biosynthesis. This provides a combined module that can effectively increase the yield of polyketides, polyethers, or non-ribosomal peptides in actinomycetes. This combined module consists of a CoASH cofactor synthesis module and a PPTase post-modification module. The CoASH cofactor synthesis module is composed of the element SCoaA. R106A It consists of SCoaD, and the PPTase-modified module is element HPC3.

[0018] This invention, through constructing recombinant vectors and recombinant strains containing the aforementioned combined modules, obtained a total of 8 high-yield recombinant strains carrying the combined modules, namely *Streptomyces azureense* M145 / ADH, *Streptomyces burgdorferi* BC-101-4 / ADH, *Streptomyces avermitilis* S0 / ADH, *Streptomyces tsukuba* NRRL 18488 / ADH, *Streptomyces crassiflora* M4018 / ADH, *Streptomyces vesicae* ISP5230 / ADH, *Streptomyces alba* IPPDNR / ADH, *Saccharomyces cerevisiae* NRRL 18395 / ADH, and *Streptomyces roseospora* NRRL 11379 / ADH. Among them, the recombinant strain *Streptomyces cerevisiae* M145 / ADH showed a 54.17% increase in actinol production compared to the original strain M145, reaching 141.12 mg / L; *Streptomyces bisporus* BC-101-4 / ADH showed a 39.11% increase in milbemycin production compared to the original strain BC-101-4, reaching 1352.43 mg / L, while the production of nanchangmycin increased by 24.90% compared to the original strain BC-101-4, reaching 1400.79 mg / L; and *Streptomyces avermectin* S0 / ADH showed a avermectin B production... 1a The yield of FK506 of *Streptomyces tsukuba* NRRL 18488 / ADH increased by 38.50% compared to the original strain S0, reaching 3.11 g / L; the yield of FK506 of *Streptomyces tsukuba* NRRL 18488 / ADH increased by 45.58% compared to the original strain NRRL 18488, reaching 83.70 mg / L; the yield of oxytetracycline of *Streptomyces crassiflora* M4018 / ADH increased by 48.52% compared to the original strain M4018, reaching 1.94 g / L; the yield of daunorubicin of *Streptomyces venezulata* ISP5230 / ADH increased by 15.51% compared to the original strain ISP5230, reaching 288.64 μg / mL; the yield of daunorubicin of *Streptomyces albopictus* IPPDNR / ADH increased by 56.67% compared to the original strain IPPDNR, reaching 38.20 μg / mL; and the yield of spinosad of *Saccharomyces cerevisiae* NRRL18395 / ADH increased compared to the original strain NRRL 18488 / ADH. The daptomycin yield of the recombinant strain Streptomyces roseospora NRRL 11379 / ADH increased by 44.64% to 41.66 mg / L; the daptomycin yield of the recombinant strain Streptomyces roseospora NRRL 11379 / ADH increased by 37.19% compared with the original strain NRRL 11379, reaching 334.75 mg / L. Attached Figure Description

[0019] Figure 1 A schematic diagram illustrating the construction of the recombinant vector pSET152::orf4 SAD HPC3;

[0020] Figure 2 A schematic diagram illustrating the construction of the recombinant vector pSET152::ermEp*SAD HPC3;

[0021] Figure 3 The graph shows the detection results of actinol production by recombinant Streptomyces cerevisiae strains M145 / ADH, M145 / C, and the original strain M145.

[0022] Figure 4 The image shows the detection results of milbemycin and nanchangmycin yields of recombinant Streptomyces BC-101-4 / ADH, BC-101-4 / C, and the original strain BC-101-4; among them, Figure 4 In the graph, A represents the detection results of milbemycin production. Figure 4 In the figure, B represents the detection results of Nanchangmycin production;

[0023] Figure 5 The recombinant strains of Streptomyces avermectin S0 / ADH, S0 / C and the original strain S0 avermectin B 1a Chart showing the results of yield testing;

[0024] Figure 6 The graph shows the yield of recombinant Streptomyces tsukuba strains NRRL 18488 / ADH, NRRL 18488 / C and the original strain NRRL18488FK506.

[0025] Figure 7 The graph shows the detection results of oxytetracycline production by recombinant Streptomyces strains M4018 / ADH, M4018 / C, and the original strain M4018.

[0026] Figure 8 The graph shows the results of the detection of jedocycin production by recombinant strains ISP5230 / ADH, ISP5230 / C and the original strain ISP5230 of Streptomyces venezuelae.

[0027] Figure 9 The graph shows the detection results of daunorubicin production by recombinant Streptomyces strains IPPDNR / ADH, IPPDNR / C, and the original strain IPPDNR.

[0028] Figure 10 The graph shows the detection results of spinosad production by recombinant strains NRRL 18395 / ADH, NRRL 18395 / C and the original strain NRRL18395 of Polysporus spp.

[0029] Figure 11 The figure shows the results of daptomycin production detection for recombinant Streptomyces roseospora strains NRRL 11379 / ADH, NRRL 11379 / C, and the original strain NRRL11379. Detailed Implementation

[0030] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to specific embodiments and accompanying drawings. It should be noted that the embodiments mentioned below are only for explaining the invention and are not intended to limit the scope of the invention. The embodiments mentioned below are only some embodiments of the invention, not all embodiments. In the art, any embodiments obtained by those skilled in the art without creative effort are protected by this invention.

[0031] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. The materials, reagents, culture media, and instruments used are all conventional materials, reagents, culture media, and instruments in the art, and can be obtained commercially by those skilled in the art. Unless otherwise specified, the molecular biology experimental operations involved in this invention, such as PCR amplification, enzyme digestion and ligation, and transformation, are all conventional experimental operations in the art or can be performed according to the product instructions of the corresponding reagents.

[0032] Streptomyces bingchenggensis BC-101-4 is disclosed in the following literature: Wang X, Wang X, Xiang W (2009) Improvement of milkemycin-producing Streptomyces bingchenggensis by rational screening of ultraviolet- and chemically induced mutants. World J Microbiol Biotechnol 25:1051-1056.

[0033] Streptomyces coelicolor M145 is disclosed in the following literature: Kieser T, Bibb MJ, Buttner MJ, Chater KF, Hopwood DA (2000) Practical Streptomyces genetics. John Innes Foundation, Norwich.

[0034] Streptomyces avermitilis (S0) is disclosed in patent application number CN202310480048.6, entitled "A sugar transporter protein TP6568 and its application in modifying high-yielding Streptomyces".

[0035] Streptomyces rimosus M4018 is disclosed in the following literature: Yin Shouliang, Lin Zhiwei, Zhang Yuxiu, et al. Engineering modification of Streptomyces rimosus to improve oxytetracycline production [J]. China Biotechnology Journal, 2016, 36(7):72-82. DOI:10.13523 / j.cb.20160711.

[0036] Saccharopolyspora spinosa NRRL 18395 is disclosed in the following literature: Guo Hang, Bai Tingli, Tao Meifeng. Cloning and assembly of rhamnose and glutamine synthesis genes of Saccharopolyspora spinosa [J]. Journal of Huazhong Agricultural University, 2012, 31(3):298-302. DOI:10.3969 / j.issn.1000-2421.2012.03.007.

[0037] Streptomyces venezuelae ISP5230 is disclosed in the following literature: He Jianyong, Yao Xinsheng, LEO.C.VINING. Cloning of chloramphenicol biosynthesis gene in Streptomyces venezuelae [J]. Journal of Shenyang Pharmaceutical University, 2006, 23(11):731-734. DOI:10.3969 / j.issn.1006-2858.2006.11.013.

[0038] Streptomyces tsukubaensis NRRL 18488 is disclosed in the following literature: Ma Dongxu. Enhance tacrolimus production by regulating the expression of BulZ and its target gene-encoded proteins [D]. Tianjin: Tianjin University, 2018. DOI:10.7666 / d.D01679402.

[0039] Streptomyces albus IPPDNR was constructed by heterologously expressing the daunorubicin synthetic gene cluster from Streptomyces albus Del14. Streptomyces albus Del14 is disclosed in the following literature: MYRONOVSKYI M, B,NADMID S, et al. Generation of cluster-free Streptomyces albus chassis strains for improved heterologous expression of secondary metabolite clusters[J].Metabolic Engineering,2018,49:316-24. The synthetic gene cluster of daunorubicin is disclosed in the following literature: Lomovskaya N, Otten SL, Doi-Katayama Y, et al. Doxorubicin overproduction in Streptomyces peucetius:cloning and characterization of the dnrU ketoreductase and dnrV genes and the doxAcytochrome P-450hydroxylase gene.J Bacteriol.1999;181(1):305-318. The specific method for constructing Streptomyces whitei IPPDNR is as follows: construct an overexpression integrative plasmid pSET156-DNR containing the daunorubicin synthesis gene cluster, transform the overexpression integrative plasmid into Escherichia coli, and then introduce the overexpression integrative plasmid into the originating strain Del14 through an intergeneric fusion transfer experiment to obtain Streptomyces whitei IPPDNR.

[0040] Streptomyces roseosporus NRRL 11379 is disclosed in the following literature: Yu Jisan, Hong Kui, Lin Haipeng, et al. Optimization of fermentation medium for the production of daptomycin precursor A21978C by Streptomyces roseosporus NRRL11379 [J]. Anhui Agricultural Sciences, 2008, 36(19):7974-7976. DOI:10.3969 / j.issn.0517-6611.2008.19.012.

[0041] All of the above strains are preserved in our laboratory.

[0042] The strain information involved in the following examples is shown in Table 1, the primer information is shown in Table 2, and the plasmid information is shown in Table 3.

[0043] Table 1. Information on the strains involved in the examples.

[0044]

[0045]

[0046] Table 2 shows the primer information involved in the examples.

[0047]

[0048] Note: Bold characters indicate homologous arm sequences; underlined characters indicate restriction endonuclease sites.

[0049] Table 3 shows the plasmid information involved in the embodiments.

[0050]

[0051] Example 1: Construction of a recombinant vector containing a CoASH cofactor synthesis module and a PPTase post-modification module

[0052] Recombinant vectors for the CoASH cofactor synthesis module and PPTase post-modification module of different strains were constructed using the pSET152 vector. The CoASH cofactor synthesis module involves the element CoaA... R106A Both CoaD and CoaD are derived from Escherichia coli, and their original sequences can be found in Wei et al. ACS Synth Biol. 2019, 17; 8(5). doi:10.1021 / acssynbio.9b00042. The element SCoaA used in this invention R106A SCoaD is based on the original sequence with codon optimization in Streptomyces, and the codon-optimized SCoaA is... R106A The nucleotide sequence of SCoaD is shown in SEQ ID NO.1, and the nucleotide sequence of SCoaD is shown in SEQ ID NO.2. The element of the PPTase post-modification module is HPC3 derived from Streptomyces corchorusii, and its nucleotide sequence is shown in SEQ ID NO.3.

[0053] SEQ ID NO.1:

[0054] ATGTCCATCAAGGAGCAGACCCTGATGACCCCGTACCTGCAGTTCGACCGCAACCAGTGGGCCGCCCTGCGCGACTCCGTCCCGATGACCCTGTCCGAGGACGAGATCGCCCGCCTGAAGGGCATCAACGAGGACCTGTCCCTGGAGGAGGTCGCCGAGATCTACCTGCCCCTGTCGCGCCTGCTGAACTTCTACATCTCCTCCAACCTGCGCCGGCAGGCCGTCCTGGAGCAGTTCCTGGGCACCAACGGCCAGCGCATCCCGTACATCATCTCCATCGCCGGCTCCGTCGCCGTCGGCAAGTCCACCACCGCCGCCGTCCTGCAGGCCCTGCTGTCCCGCTGGCCGGAGCACCGCCGCGTCGAGCTGATCACCACCGACGGCTTCCTGCACCCCAACCAGGTCCTGAAGGAGCGCGGCCTGATGAAGAAGAAGGGCTTCCCCGAGTCCTACGACATGCACCGCCTGGTCAAGTTCGTCTCCGACCTGAAGTCCGGCGTCCCGAACGTCACCGCCCCCGTCTACTCCCACCTGATCTACGACGTGATCCCGGACGGCGACAAGACCGTCGTGCAGCCCGACATCCTGATCCTGGAGGGCCTGAACGTGCTGCAGTCCGGCATGGACTACCCGCACGACCCCCACCACGTCTTCGTCTCCGACTTCGTCGACTTCTCCATCTACGTCGACGCCCCCGAGGACCTGCTGCAGACCTGGTACATCAACCGCTTCCTGAAGTTCCGCGAGGGCGCCTTCACCGACCCCGACTCCTACTTCCACAACTACGCCAAGCTGACCAAGGAGGAGGCCATCAAGACCGCCATGACCCTGTGGAAGGAGATCAACTGGCTGAACCTGAAGCAGAACATCCTGCCCACCCGCGAGCGCGCCTCCCTGATCCTGACCAAGTCCGCCAACCACGCGGTCGAGGAGGTCCGCCTGCGCAAGTGA

[0055] SEQ ID NO.2:

[0056] ATGCAGAAGCGCGCCATCTACCCCGGCACCTTCGACCCGATCACCAACGGCCACATCGACATCGTCACCCGCGCCACCCAGATGTTCGACCACGTCATCCTGGCCATCGCCGCCTCCCCCTCCAAGAAGCCGATGTTCACCCTGGAGGAGCGCGTCGCCCTGGCCCAGCAGGCCACCGCCCACCTGGGCAACGTCGAGGTCGTCGGCTTCTCCGACCTGATGGCCAACTTCGCCCGCAACCAGCACGCCACCGTCCTGATCCGCGGCCTGCGCGCCGTCGCCGACTTCGAGTACGAGATGCAGCTGGCCCACATGAACCGGCACCTGATGCCCGAGCTGGAGTCCGTCTTCCTGATGCCCTCCAAGGAGTGGTCCTTCATCTCCTCCTCCCTGGTCAAGGAGGTCGCCCGCCACCAGGGCGACGTCACCCACTTCCTGCCCGAGAACGTCCACCAGGCCCTGATGGCCAAGCTGGCCTGA

[0057] SEQ ID NO.3:

[0058] GTGATCGAGGAGCTGCTCCCGGAGTCGGTCGTGGCCGTGGAGGCGCGCTGACGACCCGCTGTGGGACTCCCCGCTCTACCCGGCGGAGGAGGCGCTCGTCGTGCGCGCGGTGGCCAAGCGGCGCCGTGAGTTCGCGGCCGTCCGGGGCTGCGCCCGGCGCGCCATGGAGA AGCTCGGCGTGCCGCCGCAGCCCGTGCTCACCGGTGAGCGGGGGGCCCCGCGCTGGCCGGACGGGCTGCTCGGCAGCATGACCCACTGCGACGGCTACTGCGCCGCCGCCGCTGGTCCGCGCCACCGACCTCGCCTCCCTGGGCATAGACGCCGAACCGCACGGGCCGCTGCCG GAAGGGGTGGGCTCCTCCGTCTTCCTGCCCGCCGAGGCCGAGCGCCTCGACCGGCTGGCCGCGCGTGGCCCGCCGTGCACTGGGACCGGCTGCTGTTCAGCGCCAAGGAGTCCGTCTACAAGGCGTGGTTCCCGCTCACCCGCATGTGGCTGGACTTCTCCGAGGCCGACA TCACCGTGCGGCCGGACGCCGAGGGCGAACCGTCCGGCTCCCTGCGCGCCGAGCTCCTCGTCCCCGGCCCCGTGATCGGCGGGCACCGGCTCCAGTCCTTCGAGGGCCGGTGGACCGTACGGCACGGCGTGGTGGCCACGTCGGTGGTCATACCGCACCCCGCCCCACGCCCC

[0059] (i) Construction of recombinant vectors for heterologous expression of the CoASH cofactor synthesis module and PPTase post-modification module in Streptomyces aquamarine:

[0060] In *Streptomyces aquamarine*, recombinant vectors were constructed using the time-sequential promoter actⅡ-orf4p. The specific construction method is as follows: Primers 4-SCoaA with homologous arms were designed. R106A -F and SCoaA R106A -R, used to amplify SCoaA with homologous arms from a synthesized codon-optimized gene (SEQ ID NO.1). R106APrimers SCoaD-F and SCoaD-R with homologous arms were designed to amplify the SCoaD fragment with homologous arms from a synthesized codon-optimized gene (SEQ ID NO.2); primers HPC3-F and HPC3-R with homologous arms were designed to amplify the HPC3 fragment with homologous arms from a synthesized gene (SEQ ID NO.3); primers Orf4-F and Orf4-R were designed using the *Streptomyces cerevisiae* M145 genome as a template, and the promoter fragment (actII-orf4p) with homologous arms was obtained by PCR using a KOD high-fidelity enzyme system. The plasmid pSET152 was double-digested with EcoRI and XbaI to obtain the linear vector xSET152. The linear vector xSET152 was then combined with the fragments actII-orf4p and SCoaA with homologous arms. R106A SCoaD and HPC3 were assembled using Gibson assay. After the reaction, the cells were transformed, and single clones were picked, cultured, and plasmids were extracted using a plasmid extraction kit. Electrophoresis was performed, followed by sequencing verification. The correct recombinant plasmid vector pSET152::orf4 SAD HPC3 was obtained after verification. A schematic diagram of the construction of this recombinant plasmid vector is shown below. Figure 1 As shown.

[0061] (II) Construction of recombinant vectors for heterologous expression of the CoASH cofactor synthesis module and PPTase post-modification module in *Streptomyces hygroscopicus*, *Streptomyces avermectin*, *Streptomyces crassifolius*, *Streptomyces sacchariformis*, *Streptomyces tsukuba*, *Streptomyces venezulatus*, *Streptomyces alba*, and *Streptomyces roseospora*:

[0062] Recombinant vectors were constructed using the constitutive strong promoter ermEp* in *Streptomyces cyrtonii* BC-101-4, *Streptomyces avermectin* S0, *Streptomyces tsukuba* NRRL 18488, *Streptomyces crassiflora* M4018, *Streptomyces vesicae* ISP5230, *Streptomyces alba* IPPDNR, *Saccharomyces cerevisiae* NRRL 18395, and *Streptomyces roseospora* NRRL11379. The specific construction method is as follows: Primers E-SCoaA with homologous arms were designed. R106A -F and SCoaA R106A -R, used to amplify SCoaA with homologous arms from a synthesized codon-optimized gene (SEQ ID NO. 1). R106APrimers SCoaD-F and SCoaD-R with homologous arms were designed to amplify the SCoaD fragment with homologous arms from the synthesized codon-optimized gene (SEQ ID NO.2); primers HPC3-F and HPC3-R with homologous arms were designed to amplify the HPC3 fragment with homologous arms from the synthesized gene (SEQ ID NO.3). The plasmid pSET152::ermEp* was double-digested with KpnI and BamHI to obtain the linear vector backbone xSET152-2. The linear vector xSET152-2 was then combined with the SCoaA fragment with homologous arms. R106A SCoaD and HPC3 were assembled using Gibson assay. After the reaction, the cells were transformed, and single clones were picked, cultured, and plasmids were extracted using a plasmid extraction kit. Electrophoresis was performed, followed by sequencing verification. The correct recombinant plasmid vector pSET152::ermEp*SAD HPC3 was obtained after verification. A schematic diagram of the construction of this recombinant plasmid vector is shown below. Figure 2 As shown.

[0063] Example 2: Construction of recombinant bacteria containing a CoASH cofactor synthesis module and a PPTase post-modification module

[0064] (I) Construction of recombinant strains that heterologously overexpress the CoASH cofactor synthesis module and the PPTase post-modification module

[0065] The recombinant plasmid vector pSET152::orf4 SAD HPC3 obtained in Example 1 was transformed into Escherichia coli competent cells ET12567 (pUZ8002). Then, the plasmid was introduced into Streptomyces cerevisiae M145 through an indirect zygote transfer experiment (see the following literature: Kieser T, Bibb MJ, Buttner MJ, Chater KF, Hopwood DA (2000) Practical Streptomyces genetics. The John Innes Foundation, Norwich.). After the zygotes grew, they were picked onto MS medium containing apramycin (Apr) and nalidixic acid (Nal). After resistance verification and PCR verification, the recombinant Streptomyces cerevisiae strain M145 / ADH with heterologous overexpression of the CoASH cofactor synthesis module and the PPTase post-modification module was obtained.

[0066] The recombinant plasmid vector pSET152::ermEp*SAD HPC3 obtained in Example 1 was transformed into Escherichia coli competent cells ET12567 (pUZ8002). Then, through genus-specific synergistic transfer experiments, the plasmid was introduced into *Streptomyces bingchenggensis* BC-101-4, *Streptomyces avermitosa* S0, *Streptomyces tsukuba* NRRL 18488, *Streptomyces crassiflora* M4018, *Streptomyces vesicae* ISP5230, *Streptomyces albopictus* IPPDNR, *Streptomyces sacchariformis* NRRL 18395, and *Streptomyces roseospora* NRRL 11379, respectively. The genus-specific synergistic transfer experiment for *Streptomyces bingchenggensis* BC-101-4 was performed according to the following literature: Zhang Y, He H, Liu H, Wang H, Wang X, Xiang W. Characterization of a pathway-specific activator of milbemycin biosynthesis and improved milbemycin production by its overexpression in *Streptomyces bingchenggensis*. Microb Cell. Fact. 2016;15(1):152. doi:10.1186 / s12934-016-0552-1; The genus-to-genus syngenesis transfer experiment of Streptomyces avermitosa S0 was conducted according to the following literature: DONG et al. Applied Microbiology and Biotechnology, 2024, 108(1). DOI:10.1007 / s00253-023-12964-9; The genus-to-genus syngenesis transfer experiment of Streptomyces tsukuba NRRL18488 was conducted according to the following literature: Martínez-Castro M et al. Appl Microbiol Biotechnol. 2013 Mar;97(5):2139-52. DOI:10.1007 / s00253-012-4364-x; The genus-to-genus syngenesis transfer experiment of Streptomyces schreberi M4018 was conducted according to the following literature: Yin et al. Microb Cell Fact. 2015 Apr 2; 14:46. DOI: 10.1186 / s12934-015-0231-7; The intermetagenous syngenetic transfer experiment of Streptomyces vena cava ISP5230 was conducted according to the following references: Zhang et al. Mol Microbiol. 2013 Nov; 90(4):884-97. DOI: 10.1111 / mmi.12406 and Doull et al. J Ind Microbiol. 1994 Mar; 13(2):120-5. DOI: 10.1007 / BF01584109. Recombinant strains of *Streptomyces glaber* BC-101-4 / ADH, *Streptomyces avermitilis* S0 / ADH, *Streptomyces tsukuba* NRRL18488 / ADH, *Streptomyces crassiflora* M4018 / ADH, *Streptomyces vesicae* ISP5230 / ADH, *Streptomyces albopictus* IPPDNR / ADH, *Saccharomyces spp.* NRRL 18395 / ADH, and *Streptomyces roseospora* NRRL 11379 / ADH were obtained after heterologous overexpression of the CoASH cofactor synthesis module and PPTase post-modification module, following resistance and PCR verification.

[0067] (II) Construction of control recombinant strains containing empty vectors:

[0068] The empty vector pSET152 was introduced into Escherichia coli ET12567 / pUZ8002 through transformation. Then, using the same indirect synergistic transfer method, pSET152 was introduced into *Streptomyces cerevisiae* M145, *Streptomyces cynomolgus* BC-101-4, *Streptomyces avermectin* S0, *Streptomyces tsukuba* NRRL 18488, *Streptomyces crassiflora* M4018, *Streptomyces vesicae* ISP5230, *Streptomyces alba* IPPDNR, *Saccharomyces cerevisiae* NRRL 18395, and *Streptomyces roseospora* NRRL 11379 to obtain control strains: *Streptomyces cerevisiae* M145 / C, *Streptomyces cynomolgus* BC-101-4 / C, *Streptomyces avermectin* S0 / C, *Streptomyces tsukuba* NRRL 18488 / C, *Streptomyces crassiflora* M4018 / C, *Streptomyces vesicae* ISP5230 / C, *Streptomyces alba* IPPDNR / C, *Saccharomyces cerevisiae* NRRL 18395 / C, and *Streptomyces roseospora* NRRL 11379 / C.

[0069] Example 3: Application of Streptomyces m145 / ADH overexpressing the CoASH cofactor synthesis module and PPTase post-modification module in increasing actinolite production.

[0070] The recombinant Streptomyces cerevisiae strains M145 / ADH and M145 / C obtained in Example 2, as well as the original strain M145, were inoculated onto MS solid medium and cultured at 28°C for 5 days. Spores were then collected at a concentration of 4 × 10⁻⁶ spores. 6 The inoculum was transferred to Streptomyces aquamarine fermentation medium at a rate of 1 / mL and cultured at 28℃ and 250rpm for 5 days. 0.5mL of the fermentation broth was then collected.

[0071] The sporulation medium was MS medium, with the following composition: 20 g / L soybean meal powder, 20 g / L mannitol, 20 g / L agar powder, and the remainder being water.

[0072] The fermentation medium consisted of: 50 g / L PEG6000, 1.23 g / L magnesium sulfate heptahydrate, 10 g / L glucose, 2 g / L acid-hydrolyzed casein, 1 mL / L dipotassium hydrogen phosphate trihydrate, 25 mM 5×TES buffer, 1 mM sodium dihydrogen phosphate, 1 mM dipotassium hydrogen phosphate, and trace elements: 0.1 g / L each of ZnSO4·7H2O, NaCl, FeSO4·7H2O, MnCl2·4H2O, and CaCl2·6H2O, with the remainder being water.

[0073] Detection method for actinomycin: Treat with 0.5 mL of 1M NaOH, centrifuge, and measure the OD of the supernatant. 608nm The yield of actinolite (Act) was measured.

[0074] The results of the acrylonitrile production test are as follows: Figure 3 As shown, compared with the original strain M145, the auropol production of the recombinant Streptomyces cerevisiae strain M145 / ADH increased by 54.17% to 141.12 mg / L, while the empty vector control strain M145 / C had no effect on the auropol production.

[0075] Example 4: Application of *Streptomyces BC-101-4 / ADH* strain overexpressing the CoASH cofactor synthesis module and PPTase post-modification module in improving the yield of milbemycin and nanchangmycin.

[0076] The recombinant Streptomyces BC-101-4 / ADH and BC-101-4 / C strains of *Streptomyces glabra* obtained in Example 2, and the original strain BC-101-4 were inoculated onto SKYM solid medium and cultured at 28°C for 9 days. Spores of approximately 1 square centimeter were scraped and inoculated into *Streptomyces glabra* seed culture medium and cultured at 28°C and 250 rpm for 46 hours. Then, at a 6% inoculation rate, they were inoculated into *Streptomyces glabra* fermentation medium and cultured at 28°C and 250 rpm for 9 days.

[0077] The sporulation medium was SKYM medium, with the following composition: 4 g / L sucrose, 1 g / L skim milk powder, 2 g / L yeast extract, 5 g / L malt extract, 20 g / L agar powder, and the remainder being water.

[0078] The seed culture medium consists of 5 g / L yeast extract, 10 g / L sucrose, 1 g / L skim milk powder, 3.5 g / L bacterial peptone, 0.5 g / L dipotassium hydrogen phosphate, and the remainder is water.

[0079] The fermentation medium consists of: 80 g / L sucrose, 20 g / L soybean meal, 1 g / L skim milk powder, 0.1 g / L ferrous sulfate, 1 g / L dipotassium hydrogen phosphate, 3 g / L calcium carbonate, and the remainder is water.

[0080] Detection methods for milbemycin and nanchangmycin: 0.5 mL of fermentation broth from *Streptomyces hygroscopicus* was thoroughly mixed with 1.5 mL of ethanol. The sample was then agitated for 30 min to extract milbemycin from the fermentation broth. The pre-treated sample was then centrifuged at 12000 rpm for 15 min. The supernatant milbemycin extract was filtered through a 0.22 μm organic filter membrane and analyzed by liquid chromatography using an Agilent instrument. The chromatographic method was 1260 high-performance liquid chromatography (HPLC). The chromatographic column was a C18 column (Zorbax, 4.6 mm × 250 mm, 5 μm). The detection wavelength was 242 nm, the injection volume was 20 μL, and the mobile phase flow rate was 1.0 mL / min. The specific chromatographic conditions were as follows: from 0 to 15 min, mobile phase A (methanol) eluted from 0% to 100%, and mobile phase B (acetonitrile:methanol:water = 7:2:1, v / v) eluted from 100% to 0%; from 15 to 17 min, mobile phase A was maintained at 100%; from 17 to 25 min, mobile phase A (methanol) eluted from 100% to 0%, and mobile phase B eluted from 0% to 100%; from 25 to 27 min, mobile phase B was maintained at 100%, and the column temperature was 28 °C.

[0081] Results of milbemycin yield testing are as follows Figure 4 As shown, compared with the starting strain BC-101-4, the recombinant strain BC-101-4 / ADH of Streptomyces hygroscopicus in Harbin increased the yield of milbemycin by 39.11% to 1352.43 mg / L, while the yield of nanchangmycin increased by 24.90% to 1400.79 mg / L. The empty vector control strain BC-101-4 / C had no effect on the yield of milbemycin and nanchangmycin.

[0082] Example 5: Application of Streptomyces avermectin S0 / ADH overexpressing the CoASH cofactor synthesis module and PPTase post-modification module in improving avermectin yield

[0083] The recombinant *Streptomyces avermitilis* strains S0 / ADH and S0 / C obtained in Example 2, and the starting strain S0, were inoculated onto YMS solid medium and cultured at 28°C for 7 days. Approximately 1 square centimeter of mycelium was then inoculated onto *Streptomyces avermitilis* seed medium and cultured at 28°C and 250 rpm for 48 hours. Finally, at a 6% inoculation rate, the mycelium was inoculated onto *Streptomyces avermitilis* fermentation medium and cultured at 28°C and 250 rpm for 10 days.

[0084] The sporulation medium was YMS medium, with the following composition: 4 g / L soluble starch, 4 g / L yeast extract, 10 g / L malt extract, 20 g / L agar powder, and the remainder being water.

[0085] The seed culture medium consisted of 25 g / L corn starch, 2 g / L soybean meal, 15 g / L peanut meal, 4 g / L yeast extract, 0.026 g / L cobalt chloride hexahydrate, 0.03 g / L α-amylase, and the remainder being water.

[0086] The fermentation medium consists of: 120 g / L corn starch, 38 g / L soybean meal, 0.8 g / L calcium carbonate, 8 g / L yeast extract, 0.02 g / L cobalt chloride hexahydrate, 0.1 g / L α-amylase, 0.3 g / L ammonium sulfate, 0.022 g / L sodium molybdate monohydrate, 0.0023 g / L manganese sulfate monohydrate, with the remainder being water.

[0087] The detection method for avermectin was as follows: 0.25 mL of the fermentation broth or supernatant of *Streptomyces avermectin* was thoroughly mixed with 1.20 mL of methanol. The sample was ultrasonically treated for 40 min to extract total avermectin and extracellular avermectin from the fermentation broth. The pre-treated sample was then centrifuged at 12000 rpm for 10 min. The supernatant avermectin extract was collected, filtered through a 0.22 μm organic filter, and then analyzed by liquid chromatography. The instrument used was a Shimadzu HPLC (Shimadzu LC) with a C18 column (Zorbax, 4.6 mm × 250 mm, 5 μm), a detection wavelength of 246 nm, an injection volume of 20 μL, a mobile phase of 90% methanol, a flow rate of 1.0 mL / min, and a column temperature of 35 °C.

[0088] Avermectin B 1a The yield test results are as follows Figure 5 As shown, compared with the original strain S0, the avermectin B content of the recombinant Streptomyces S0 / ADH strain is significantly higher. 1a The yield increased by 38.50%, reaching 3.11 g / L, and the empty vector control strain S0 / C showed better performance against avermectin B. 1a Production was unaffected.

[0089] Example 6: Application of Streptomyces Tsukuba NRRL18488 / ADH overexpressing the CoASH cofactor synthesis module and PPTase post-modification module in improving FK506 yield

[0090] The recombinant strains of Streptomyces tsukuba obtained in Example 2, NRRL 18488 / ADH and NRRL 18488 / C, and the original strain NRRL 18488 were inoculated onto sporulation solid medium and cultured at 28°C for 14 days. Spores were scraped off and inoculated into Streptomyces tsukuba YEME seed medium and cultured at 28°C and 220 rpm for 48 hours. Then, the inoculum was transferred to MGm fermentation medium at a rate of 6% and cultured at 28°C and 220 rpm for 10 days.

[0091] The composition of the sporulation solid culture medium is as follows: 10 g / L soluble starch, 1 g / L NaCl, 2 g / L (NH4)2SO4, 1 g / L K2HPO4, 2 g / L CaCO3, 1 g / L MgSO4·7H2O, 0.001 g / L FeSO4·7H2O, 0.001 g / L MnCl2·4H2O, 0.001 g / L ZnSO4·7H2O, 20 g / L agar, with the balance being water, pH 7.0.

[0092] The YEME seed culture medium consists of the following components: 3 g / L yeast extract, 5 g / L peptone, 3 g / L malt extract, 10 g / L glucose, 340 g / L sucrose, with the remainder being water, pH 7.0.

[0093] The composition of the MGm fermentation medium is as follows: 50 g / L soluble starch, 8.83 g / L glutamic acid, 2.5 mM K₂HPO₄, 0.2 g / L MgSO₄·7H₂O, 1 mg / L CaCl₂, 1 mg / L NaCl, 0.009 g / L FeSO₄·7H₂O, 21 g / L MOPS, and 0.45 ml / L trace elements. Each 10 ml of trace elements contains 39.0 mg CuSO₄·5H₂O, 5.7 mg H₃PO₃, and 3.7 mg (NH₄)₆MO₇O. 24 ·4H2O, 6.1 mg MnSO4·H2O, 880.0 mg ZnSO4·7H2O, balance is water, pH 6.5.

[0094] Detection method for FK506: Add 0.5 mL of fermentation broth to 0.75 mL of methanol, incubate at 50°C for 2.5 hours with shaking every 30 minutes, centrifuge, collect the supernatant, and perform HPLC detection via membrane chromatography. Detection method: Use an SB-C18 (250 mm × 4.6 mm, Agilent, America) column. The mobile phase volume ratio is acetonitrile: 0.1% phosphoric acid solution = 65:35. The flow rate is 1.0 mL / min, the column temperature is 50°C, the detection wavelength is 210 nm, and the injection volume is 20 μL.

[0095] The test results for FK506 production are as follows: Figure 6 As shown, compared with the starting strain NRRL 18488, the FK506 yield of the recombinant strain NRRL 18488 / ADH of Streptomyces tsukuba increased by 45.58%, reaching 83.70 mg / L, while the empty vector control strain NRRL18488 / C had no effect on the FK506 yield.

[0096] Example 7: Application of *Streptomyces clematis* M4018 / ADH overexpressing the CoASH cofactor synthesis module and PPTase post-modification module in improving oxytetracycline yield.

[0097] The recombinant strains M4018 / ADH and M4018 / C of *Streptomyces crassiflora* obtained in Example 2, as well as the original strain M4018, were inoculated onto MS solid medium and cultured at 30°C for 5 days. Spores were scraped off and inoculated into *Streptomyces crassiflora* seed medium and cultured at 30°C and 250 rpm for 24 hours. Then, the inoculum was transferred to *Streptomyces crassiflora* fermentation medium at a rate of 5% and cultured at 28°C and 250 rpm for 8 days.

[0098] The sporulation medium was MS medium, with the following composition: 20 g / L soybean meal powder, 20 g / L mannitol, 20 g / L agar powder, and the remainder being water.

[0099] The seed culture medium consists of 30 g / L starch, 3 g / L soybean meal, 4 g / L ammonium sulfate, 5 g / L calcium carbonate, 4 g / L corn steep liquor, 5 g / L sodium chloride, 0.15 g / L potassium dihydrogen phosphate, and the remainder is water.

[0100] The fermentation medium consists of: 150 g / L starch, 20 g / L soybean meal, 14 g / L ammonium sulfate, 14 g / L calcium carbonate, 4 g / L corn steep liquor, 4 g / L sodium chloride, 0.1 g / L potassium dihydrogen phosphate, 10 μg / L cobalt chloride, 0.1%-0.2% amylase, and the remainder is water.

[0101] Detection method for oxytetracycline: Take 1.5 mL of fermentation broth, acidify with 9 mol / L hydrochloric acid to pH 1.5 to 1.7, centrifuge, collect the supernatant and perform HPLC detection through a membrane. Detection method: Use an SB-C18 (250 mm × 4.6 mm, Agilent, America) column, with a mobile phase volume ratio of water:methanol:acetonitrile:2 mM phosphoric acid solution = 60:10:20:10, a flow rate of 1.0 mL / min, a detection wavelength of 350 nm, and an injection volume of 10 μL.

[0102] The test results of oxytetracycline production are as follows: Figure 7 As shown, compared with the original strain M4018, the oxytetracycline yield of the recombinant Streptomyces strain M4018 / ADH increased by 48.52%, reaching 1.94 g / L, while the empty vector control strain M4018 / C had no effect on the yield of oxytetracycline.

[0103] Example 8: Application of Streptomyces venezuelae ISP5230 / ADH overexpressing the CoASH cofactor synthesis module and PPTase post-modification module in improving jedocycin yield

[0104] The recombinant strains ISP5230 / ADH and ISP5230 / C of Streptomyces vena cava obtained in Example 2, as well as the original strain ISP5230, were inoculated on MYM solid medium and cultured at 30°C for 5 days. Spores were scraped off and inoculated into seed medium. After shaking culture at 30°C for 20 hours, the culture was transferred to fermentation medium and cultured at 30°C for another 48 hours.

[0105] The sporulation medium was MYM medium, with the following composition: 10 g / L malt extract, 4 g / L yeast extract, 4 g / L maltose, 20 g / L agar powder, and the remainder being water.

[0106] The seed culture medium was liquid MYM medium.

[0107] The fermentation medium consisted of MSM liquid medium, glucose, and phosphate buffer stock solution. The final glucose concentration was 33 mM, and the final phosphate buffer concentration was 50 μM. Each liter of MSM liquid medium (pH 7.5) contained 0.4 g MgSO4, 1.9 g MOPS, 9 mL of salt solution (an aqueous solution containing 1 g / 100 mL NaCl and 1 g / 100 mL CaCl2), 4.5 mL of 0.2 g / 100 mL FeSO4·7H2O aqueous solution, 4.5 mL of trace element solution, and 7.8 g L-isoleucine. Each liter of trace element solution contained 880 mg ZnSO4·7H2O, 39 mg CuSO4·5H2O, 6.1 mg MnSO4·4H2O, 5.7 mg H3BO3, and 3.7 mg (NH4)6Mo7O. 24 • 4H2O. Each liter of phosphate buffer stock solution (9mM) contains 10.5g K2HPO4 and 4.5g KH2PO4.

[0108] Jedomycin detection method: Take 1 mL of fermentation broth, centrifuge and filter to remove bacterial cells, add an equal volume of ethyl acetate for extraction, and take the upper organic phase; evaporate the extract to dryness in a fume hood at room temperature, dissolve it in a certain volume of methanol or DMSO, and perform HPLC detection. Detection method: Use an SB-C18 (250 mm × 4.6 mm, Agilent, America) column, with mobile phase A: water, B: acetonitrile + 0.1% trifluoroacetic acid, gradient elution, flow rate 1.0 mL / min, detection wavelength 316 nm, and injection volume 20 μL.

[0109] The test results for jedocycin yield are as follows: Figure 8 As shown, compared with the starting strain ISP5230, the recombinant Streptomyces vena cava strain ISP5230 / ADH produced 15.51% more dextrin, reaching 288.64 μg / mL, while the empty vector control strain ISP 5230 / C had no effect on dextrin production.

[0110] Example 9: Application of Streptomyces whitei strain IPPDNR / ADH overexpressing the CoASH cofactor synthesis module and PPTase post-modification module in improving daunorubicin yield

[0111] The recombinant Streptomyces whiteiformis strains IPPDNR / ADH and IPPDNR / C obtained in Example 2, as well as the starting strain IPPDNR, were inoculated onto MS solid medium and cultured at 30°C for 3 days. After that, 1cm×2cm spores were scraped off and inoculated into primary seed medium (tryptone soybean broth TSB). The medium was cultured at 30°C and 220rpm for 30 hours. The medium was then transferred to secondary seed medium at a 5% inoculation rate and cultured at 30°C and 220rpm for 24 hours. Finally, the medium was transferred to fermentation medium at a 10% inoculation rate and cultured at 30°C and 250rpm for 10 days.

[0112] The sporulation medium was MS medium, with the following composition: 20 g / L soybean meal powder, 20 g / L mannitol, 20 g / L agar powder, and the remainder being water.

[0113] The composition of the secondary seed culture medium is: 1 g / L yeast extract, 4 g / L glucose, 3 g / L soybean flour, 0.2 g / L calcium carbonate, and the remainder is water.

[0114] The fermentation medium consisted of 4 g / L glucose, 0.4 g / L yeast extract, 1 g / L malt extract, 5 g / L dextrin, 5 mL / L soybean oil, and the remainder being water.

[0115] Detection method for daunorubicin: Take 1 mL of fermentation broth, add 9 mL of methanol, let stand for 12 h, centrifuge, take the supernatant and perform HPLC detection through a membrane. Detection method: Use SB-C18 (250 mm × 4.6 mm, Agilent, America) column, XDB-C18, mobile phase A: 0.01 M ammonium acetate aqueous solution (pH = 4.2), mobile phase B: acetonitrile, flow rate 1.0 mL / min, detection wavelength 254 nm, column temperature 37 ℃, gradient washing, injection volume 20 μL.

[0116] The test results for daunorubicin production are as follows: Figure 9 As shown, compared with the original strain IPPDNR, the recombinant Streptomyces strain IPPDNR / ADH increased the daunorubicin yield by 56.67%, reaching 38.20 μg / mL, while the empty vector control strain IPPDNR / C had no effect on the daunorubicin yield.

[0117] Example 10: Application of Polysporus spp. NRRL18395 / ADH overexpressing the CoASH cofactor synthesis module and PPTase post-modification module in improving spinosad yield

[0118] The recombinant strains of *Saccharomyces cerevisiae* NRRL 18395 / ADH and NRRL 18395 / C obtained in Example 2, and the original strain NRRL 18395, were inoculated onto sporulation solid medium and cultured at 30°C for 7 days. Spores were scraped and inoculated into *Saccharomyces cerevisiae* seed medium, and cultured at 28°C and 250 rpm for 72 hours. Then, at a 10% inoculum, the culture was transferred to *Saccharomyces cerevisiae* fermentation medium and cultured at 28°C and 250 rpm for 8 days.

[0119] The composition of the sporulation medium is as follows: 20 g / L whole milk powder, 3 g / L yeast extract, 5 g / L glucose, 20 g / L agar, and the remainder is water.

[0120] The seed culture medium consists of the following components: 10 g / L whole milk powder, 10 g / L glucose, 5 g / L yeast extract, and 5 g / L peptone.

[0121] The fermentation medium consists of the following components: 10 g / L whole milk powder, 100 g / L glucose, 5 g / L yeast extract, 10 g / L peptone, 10 g / L soybean oil, 1 g / L K2HPO4, and 5 g / L CaCO3.

[0122] Spontamine detection method: Add 4 mL of anhydrous methanol to 2 mL of fermentation broth, sonicate for 1 h, centrifuge at 12000 rpm for 10 min, and use the supernatant directly for HPLC analysis. HPLC analysis conditions: Agilent Zorbax Eclipse XDB-C8 (4.6 mm × 150 mm, 5 μm; catalog number: 993967-906) column, detection wavelength 246 nm; mobile phase volume ratio: methanol:acetonitrile:water (containing 0.05% ammonium acetate) = 45:45:10; flow rate 1.0 mL / min, injection volume 20 μL.

[0123] The test results of spinosad production are as follows: Figure 10 As shown, compared with the starting strain NRRL 18395, the spinosad production of the recombinant strain NRRL 18395 / ADH of Saccharomyces cerevisiae increased by 44.64%, reaching 41.66 mg / L, while the empty vector control strain NRRL 18395 / C had no effect on the production of spinosad.

[0124] Example 11: Application of Streptomyces roseola NRRL 11379 / ADH overexpressing the CoASH cofactor synthesis module and PPTase post-modification module in improving daptomycin yield

[0125] The recombinant strains of *Streptomyces roseosus* NRRL 11379 / ADH and NRRL 11379-C obtained in Example 2, as well as the original strain NRRL 11379, were inoculated onto DAI solid medium and cultured at 28°C for 7 days. Spores were scraped off and cultured on *Streptomyces roseosus* primary seed medium at 28°C and 250 rpm for 60 h. Then, the inoculum was transferred to secondary seed medium at a 5% inoculum size and cultured at 28°C and 250 rpm for 36 h. Finally, the inoculum was transferred to *Streptomyces roseosus* fermentation medium at a 5% inoculum size and cultured at 28°C and 250 rpm for 10 days. Starting at 48 h, 0.5 mL of 2% (w / v) sterile sodium decanoate solution was added every 12 h.

[0126] The sporulation medium was DAI medium, with the following composition: 4 g / L glucose, 4 g / L yeast extract, 10 g / L malt extract, 2 g / L calcium carbonate, 20 g / L agar powder, and the remainder being water.

[0127] The seed culture medium consists of: 5 g / L glucose, 15 g / L dextrin, 5 g / L bacterial peptone, 5 g / L yeast extract, 5 g / L peanut meal, 0.5 g / L dipotassium hydrogen phosphate, 0.5 g / L magnesium sulfate heptahydrate, 0.2 g / L calcium carbonate, with the remainder being water.

[0128] The fermentation medium consists of: 50 g / L soluble starch, 10 g / L glucose, 10 g / L dextrin, 10 g / L tryptone, 0.3 g / L dipotassium hydrogen phosphate, 0.3 g / L magnesium sulfate heptahydrate, 0.2 g / L calcium carbonate, with the remainder being water.

[0129] Daptomycin detection method: Take 1 mL of fermentation broth, centrifuge twice at 13000 rpm, 4℃ for 15 minutes, take the supernatant and pass it through a membrane for HPLC detection. Detection method: Use SB-C18 (250 mm × 4.6 mm, Agilent, America) column, the volume ratio of mobile phase is water:acetonitrile = 56:44, the flow rate is 1.0 mL / min, the detection wavelength is 218 nm, and the injection volume is 20 μL.

[0130] The results of daptomycin yield testing are as follows: Figure 11 As shown, compared with the original strain NRRL 11379, the daptomycin yield of the recombinant Streptomyces rosenbergii strain NRRL 11379 / ADH increased by 37.19%, reaching 334.75 mg / L, while the empty vector control strain NRRL 11379 / C had no effect on the daptomycin yield.

[0131] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be defined by the claims.

Claims

1. A combined module for increasing the yield of actinomycete natural products, characterized in that, The combined module consists of a CoASH cofactor synthesis module and a PPTase post-modification module. The CoASH cofactor synthesis module is composed of the element SCoaA. R106A Composed of SCoaD, SCoaA R106A The nucleotide sequences of SCoaD are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively. The post-PPTase modification module is element HPC3, whose nucleotide sequence is shown in SEQ ID NO.

3. The natural product is a polyketide, polyether, or non-ribosomal peptide compound; the combined module is used to increase the yield of actinol in *Streptomyces coelicolor* M145, or to increase the yield of milbemycin or nanchangmycin in *Streptomyces bingchenggensis* BC-101-4, or to increase the yield of avermectin in *Streptomyces avermitilis* S0, or to increase the yield of FK506 in *Streptomyces tsukubaensis* NRRL 18488, or to increase the yield of oxytetracycline in *Streptomyces rimosus* M4018, or to increase the yield of jedomycin in *Streptomyces venezuelae* ISP5230, or to increase the yield of *Streptomyces white*. It can be used to increase the yield of daunorubicin in IPPDNR (albus), or to increase the yield of spinosad in Saccharopolyspora spinosa NRRL 18395, or to increase the yield of daptomycin in Streptomyces roseosporus NRRL 11379.

2. A recombinant carrier comprising the combined module of claim 1, characterized in that, The recombinant vector uses pSET152 as its starting vector. The promoter actII-orf4p fragment is amplified using the genome of *Streptomyces cerevisiae* M145 as a template. The promoter actII-orf4p fragment is then combined with the element SCoaA in the combinatorial module. R106A SCoaD and HPC3 are integrated into the starting vector to obtain the recombinant vector.

3. The application of the recombinant vector according to claim 2 in increasing the production of actinolite from Streptomyces cerevisiae M145.

4. A recombinant carrier comprising the combined module of claim 1, characterized in that, The starting carrier of the recombination carrier is pSET152::ermEp*, which combines the element SCoaA in the module. R106A SCoaD and HPC3 are integrated into the starting vector to obtain the recombinant vector.

5. The application of the recombinant vector according to claim 4 in increasing the yield of actinomycete natural products, characterized in that, The natural product is a polyketide, polyether, or non-ribosomal peptide compound; the application is to increase the yield of milbemycin or nanchangmycin in *Streptomyces berberis* BC-101-4, or to increase the yield of avermectin in *Streptomyces avermectin* S0, or to increase the yield of FK506 in *Streptomyces tsukuba* NRRL 18488, or to increase the yield of oxytetracycline in *Streptomyces crassiflora* M4018, or to increase the yield of jedomycin in *Streptomyces velifolia* ISP5230, or to increase the yield of daunorubicin in *Streptomyces alba* IPPDNR, or to increase the yield of spinosad in *Streptomyces sacchariformis* NRRL 18395, or to increase the yield of daptomycin in *Streptomyces roseospora* NRRL 11379.

6. A recombinant bacterium containing the recombinant vector of claim 2, characterized in that, The recombinant bacteria were obtained by introducing the recombinant vector described in claim 2 into the starting strain, using Streptomyces cerevisiae M145 as the starting strain.

7. The application of the recombinant bacteria according to claim 6 in increasing the production of actinolite from Streptomyces cerevisiae M145.

8. A recombinant bacterium containing the recombinant vector of claim 4, characterized in that, The recombinant bacteria are obtained by introducing the recombinant vector described in claim 4 into the following starting strains: *Streptomyces berberis* BC-101-4, *Streptomyces avermitilis* S0, *Streptomyces tsukuba* NRRL 18488, *Streptomyces crassiflora* M4018, *Streptomyces vesicae* ISP5230, *Streptomyces alba* IPPDNR, *Streptomyces sacchariformis* NRRL 18395, or *Streptomyces roseospora* NRRL 11379.

9. The application of the recombinant bacteria according to claim 8 in increasing the yield of actinomycete natural products, characterized in that, The natural products are polyketides, polyethers, or non-ribosomal peptides. When the starting strain is *Streptomyces bingchengensis* BC-101-4, the recombinant strain is used to increase the yield of milbemycin or nanchangmycin; when the starting strain is *Streptomyces avermectin* S0, the recombinant strain is used to increase the yield of avermectin; when the starting strain is *Streptomyces tsukuba* NRRL 18488, the recombinant strain is used to increase the yield of FK506; when the starting strain is *Streptomyces crassiflora* M4018, the recombinant strain is used to increase the yield of oxytetracycline; when the starting strain is *Streptomyces venezulata* ISP5230, the recombinant strain is used to increase the yield of jedomycin; when the starting strain is *Streptomyces alba* IPPDNR, the recombinant strain is used to increase the yield of daunorubicin; when the starting strain is *Polyspora sacchariformis* NRRL 18395, the recombinant strain is used to increase the yield of spinosad; when the starting strain is *Streptomyces roseospora* NRRL 11379, the recombinant strain is used to increase the yield of daptomycin.

Images