Beta-farnesene synthase mutant, modified strain and application
By mutating and optimizing strains of the farniene synthase from Artemisia annua, the problem of low production efficiency of β-faniene in the prior art was solved, and β-faniene production with high yield and high purity was achieved.
Patent Information
- Application Number
- CN202510555663.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-29
- Publication Date
- 2025-05-30
- Estimated Expiration
- 2045-04-29
AI Technical Summary
The prior art is difficult to effectively produce β-faniene, especially because the plant extraction method is limited by geographical and climatic conditions, and the chemical synthesis method lacks three-dimensional configuration control, resulting in insufficient yield and purity.
Through genetic engineering methods, the farniene synthase (AaFS) derived from Artemisia annua was mutated to construct a genetically engineered strain containing mutants to increase the content of β-faniene. Specific methods include designing primers for PCR amplification, constructing plasmid vectors, and integrating mutants through yeast electrotransformation, optimizing chastic bacteria to increase yield.
The yield of β-faniene was achieved significantly increased within 96 hours of fermentation time, and the β-faniene content of some mutant strains reached 2.32 g/L or 2.23 g/L, an increase of 58.3% or 52.2% compared with unmutant strains. Through the optimization of the process, the yield of β-faniene can reach 31.67 g/L.
Smart Images

Figure CN120060227A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of genetic engineering, and particularly relates to a β-farnesene synthase mutant, a modified strain and applications thereof. Background Art
[0002] Farnesene (C 15 H 24 ), as a highly unsaturated compound with strong chemical reactivity, is an acyclic sesquiterpene. According to the different positions of double bonds in the farnesene configuration, it is divided into α-farnesene, β-farnesene and X-farnesene. Among them, α-farnesene has the smell of petals and apples; β-farnesene has the smell of glue and plastic; X-farnesene occasionally appears in lavender essential oil. Due to the characteristics of farnesene itself, it has wide applications in the fields of energy chemistry, essence and fragrance, pharmaceutical production, cosmetics, etc. In terms of energy chemistry, the energy density of farnesene derivatives is much higher than that of No. 3 aviation kerosene, and it can be used as a fuel additive to significantly improve its performance, effectively extend the flight range and increase the bomb load, which has important military significance and strategic significance. In pharmaceutical production, farnesene can be used as an intermediate for the production of the side chain of vitamin E (isophytol), and an innovative change in the production process of vitamin E can be achieved (the synthesis of the side chain isophytol is shortened from 11 steps to 3 steps).
[0003] Compared with the other two farnesenes, β-farnesene is the main aphid alarm pheromone and can be developed into an environmentally friendly pest control agent. By artificially synthesizing β-farnesene or using genetic engineering means to improve the ability of plants to release β-farnesene itself, the use of chemical pesticides can be effectively reduced. For example, in some orchards, releasing β-farnesene lures can attract natural enemies of pests and control the population of pests. The chemical synthesis method of farnesene has been completely replaced by biosynthesis due to factors such as raw material sources, product yields, and pollution emissions.
[0004] Currently, β-farnesene can be obtained by plant extraction or chemical synthesis. However, the plant extraction method has relatively strict limiting conditions and it is difficult to achieve industrialization; the chemical synthesis method lacks means for controlling the stereoconfiguration and the industrial-grade raw materials are not pure enough. Moreover, the production of farnesene by the plant extraction method is usually unsustainable and restricted by strict geographical and climatic conditions, making it difficult to achieve industrialization. And the products obtained by the chemical synthesis method without stereocontrol are industrial-grade raw materials. Therefore, it is very meaningful to produce β-farnesene by microbial fermentation using synthetic biology-related technologies. Summary of the Invention
[0005] In view of this, the technical problem to be solved by the present invention is to provide a β-farnesene synthase mutant, a modified strain and applications thereof.
[0006] The present invention mutates the farnesene synthase (AaFS) derived from Artemisia annua obtained by gene synthesis, and obtains a genetically engineered strain containing the mutant through gene integration; moreover, the obtained genetically engineered strain can effectively increase the content of β-farnesene on the basis of ensuring a fermentation time of 96 h.
[0007] The mutant of the farnesene synthase derived from Artemisia annua provided by the present invention has the amino acid sequence of the farnesene synthase derived from Artemisia annua as shown in SEQ ID NO:1, and the mutant includes at least one of the following mutation sites: T434I, D248N, K197L, K197T, K197Y, K197A, K197M, K197H, K197F, K197G, K197R, K197E, K197Q, K197S, K197W, K197I, K197P, K197V, K197C, K197D, K197N, T526A, T526E, T526F, T526L, T526H, T526G, T526P, T526S, T526Y, T526K, T526V, T526M, T526N, T526D, T526C, T526I, T526W, T526Q, T526R, S11F, P28Q, H33N, K58E, K70R, I100V, H116Y, V150I, F180Y, D185G, R227K, D248N, S260N, R407K, I423V, T434I, A442G, S455T, S475T, E544D or K561I.
[0008] In some embodiments, the mutation sites in the mutant are at least one of K197A, T526I, H116Y, R227K, D248N or T434I.
[0009] As a feasible case, the mutant includes the mutation sites: K197A and T526N, or includes K197A and T526I, or includes K197M and T526N, or includes K197M and T526I, or includes D248N and R227K, or includes D248N and H116Y, or includes D248N and T434I, or includes R227K and H116Y, or includes R227K and T434I, or includes H116Y and T434I.
[0010] In some specific embodiments, the mutation sites include at least one of K197A, T526I, T434I or R227K.
[0011] The present invention screens the mutant and obtains GL0116::AaFS T434IMutant strains and GL0116::AaFS R227K-T434I Mutant strains with β-farnesene contents of 2.32 g / L and 2.23 g / L respectively, which are increased by 58.3% and 52.2% respectively compared with the non-mutant strain. Since AaFS is a specific synthase for β-farnesene, only β-farnesene is detected by gas phase method and no α-farnesene is produced. Preferably, the mutation sites in the mutant include R227K and T434I.
[0012] Furthermore, the present invention also provides a nucleic acid encoding the mutant described above.
[0013] According to the characteristics of yeast, the present invention has optimized the codons of the encoding nucleic acid. Among many optimization schemes, the AaFS encoded by the nucleic acid sequence shown in SEQ ID No.2 R227K-T434I mutant has the best expression effect and β-farnesene yield.
[0014] Preferably, the nucleic acid has the nucleotide sequence shown in SEQ ID NO:2; or has a sequence with 1 or more nucleotides substituted, deleted, added and / or replaced on the basis of the nucleic acid sequence shown in SEQ ID NO:2; or has a sequence with an identity of more than 80% to the nucleic acid sequence shown in SEQ ID NO:2.
[0015] The identity of more than 80% includes more than 80%, more than 85%, more than 90%, more than 95%, more than 96%, more than 97%, more than 98%, more than 99%, more than 99.5%, more than 99.6%, more than 99.7%, more than 99.8% or more than 99.9%.
[0016] Furthermore, the present invention also provides an expression cassette, which includes a promoter and the nucleic acid described above.
[0017] In some embodiments, the promoter is a eukaryotic promoter or a prokaryotic promoter, and the present invention does not limit this. For example, the promoter is TEF1 promoter, GAP promoter, GAL1 promoter, GAL10 promoter, ADH1 promoter, PGK1 promoter, TEF1 promoter, CYC1 promoter, HIS3 promoter, URA3 promoter, LEU2 promoter, MET25 promoter. In the present invention, the expression cassette may also include a replicon, a terminator, and / or an enhancer. For example, the replicon is 2μ ori, pBR322 ori or F1 ori, and the enhancer is selected from UASGAL, UASG, HSE (heat shock element), CUP1 - UAS, UASINO, UASCTR, UASSTE, UASPH05, UASTYR1 or UASRNR. For example, the terminator is selected from ADH1 terminator, CYC1 terminator, CYC1 terminator, PGK1 terminator, TDH3 terminator, CDC20T terminator, HRR25T terminator, FOB1T terminator, HDA1T terminator, DEP1T terminator, PDA1T terminator, SLD2T terminator.
[0018] The present invention also provides a plasmid vector, which comprises the nucleic acid as described above or the expression cassette as described above.
[0019] In the present invention, the plasmid vector is a cloning vector or an expression vector. In the present invention, the plasmid vector is used for storage, amplification of the nucleic acid or the expression cassette, or for expression of the mutant, and the present invention does not limit this. In some embodiments, the vector is a plasmid vector, including but not limited to PY26, YEp13, YEp24, YEp351, YEp352, YEp353, YEp354, YEp355, YEp356, YEp356r, YEp357, YEp357r, YEp358, YEp363, YEp364, YEp365, YEp366, YEp366r, YEp367, YEp367r, YEp368.
[0020] Furthermore, the present invention also provides a transformant, which is transformed or transfected with the plasmid vector as described above, or whose genome integrates the nucleic acid as described above or integrates the expression cassette as described above.
[0021] In the present invention, the host is used for the amplification or storage of the nucleic acid fragment, expression cassette or plasmid vector as described above, and can also be used for the expression of the mutant as described above, or for the preparation of β-farnesene, and the present invention does not limit this. For example, the transformant is a eukaryotic host or a prokaryotic host, and the eukaryotic host includes but is not limited to yeast, insect cells, and renal epithelial cells, and the prokaryotic host includes but is not limited to Escherichia coli.
[0022] As a feasibility case, the host of the transformant used for amplification or storage is Escherichia coli, and the host of the transformant used for the preparation of β-farnesene is yeast. For example, the host is Hansenula polymorpha, Pichia pastoris, Debaryomyces hansenii, Kluyveromyces lactis, Yarrowia lipolytica, Saccharomyces cerevisiae var. diastaticus, Schizosaccharomyces pombe, Rhodotorula glutinis. In some embodiments, the host of the transformant is Saccharomyces cerevisiae.
[0023] The present invention screens and optimizes the host, and the results show that different chassis bacteria have obvious effects on the yield of β-farnesene. Preferably, the genotype of the host of the transformant in the present invention is CEN.PK113-7D::ACS1-6::ERG10::ERG13::tHMG1::HMG2::ERG12::ERG8::ERG19::IDI1::ERG20; or its genotype is CEN.PK113-7D::ACS1-6::ERG10::ERG13::tHMG1::HMG2::ERG12::ERG8::ERG19::IDI1::ERG20::ERG8-20::Idi1::tHMG::adh::Acs::Acl::Zwf::Gnd::Pdr5::Pdr10::Osh3::VhbΔDpp1ΔLpp1ΔGpd1::Fs:: ΔBts1.
[0024] Furthermore, the present invention also provides a method for preparing β-farnesene, which includes: culturing the transformant as described above to obtain a product containing β-farnesene.
[0025] The method provided by the present invention can shorten the fermentation time, and the culture medium composition is simple. The shake flask fermentation time using the biphasic fermentation method is shortened from the original 120 h to 96 h, and the yield of β-farnesene can reach 31.67 g / L.
[0026] The culture medium for the culture comprises water and (NH 4 ) 2 SO 4 3 g / L, KH 2 PO 4 3.5 g / L, MgSO 4 ·7H 2 O 6.2 g / L, glucose 80 g / L, galactose 9.9 g / L, trace elements 10 mL / L, vitamins 120 μL / mL, CuSO 4 ·5H 2 O 0.6 mL / L, 10% (V / V) n-dodecane.
[0027] The GL0116::AaFS T434I mutant strain and the GL0116::AaFS R227K-T434I mutant strain obtained by mutating the farnesene synthase (AaFS) derived from Artemisia annua. After further screening and optimization of the chassis bacteria, the yield of β-farnesene reached 31.67 g / L. Description of the Drawings
[0028] Figure 1 Shows the structural diagram of the AaFS protein obtained by homology modeling; Figure 2 Shows the Ramachandran plot for the evaluation of the AaFS protein homology model; Figure 3 Shows the schematic diagram of the molecular docking result at site 197; Figure 4 Shows the schematic diagram of the molecular docking result at site 526; Figure 5 Shows the farnesene fermentation detection result after saturation mutagenesis at site 197; Figure 6 Shows the farnesene fermentation detection result after saturation mutagenesis at site 526; Figure 7 Shows the multiple sequence alignment of farnesene synthase (AaFS) with other farnesene synthases; Figure 8 Shows the quantitative detection result after directed mutagenesis of farnesene synthase (AaFS); Figure 9 Shows the farnesene fermentation detection result of farnesene synthase AaFs (superimposed mutant fermentation result); Figure 10 Fermentation detection results of farnesene synthase AaFs for farnesene synthesis (fermentation results in strain 2739). Specific implementation manners
[0029] The present invention provides a β-farnesene synthase mutant, a modified strain and applications. Those skilled in the art can draw on the content herein and appropriately modify process parameters to achieve the same. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are all considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and those skilled in the art can clearly make changes or appropriate alterations and combinations to the methods and applications herein without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.
[0030] Unless otherwise defined in the present invention, scientific and technical terms related to the present invention shall have the meanings understood by those of ordinary skill in the art.
[0031] In addition, unless otherwise specified herein, singular terms herein shall include plural forms, and plural terms shall include singular forms. More specifically, as used in this specification and the appended claims, unless otherwise clearly indicated, the singular forms "a" and "the" include plural referents.
[0032] The terms "comprise", "include" and "have" can be used interchangeably, aiming to indicate the inclusiveness of the solution, meaning that the solution may have other elements in addition to the listed elements. At the same time, it should be understood that when using "comprise", "include" and "have" to describe in this article, the solution of "consisting of..." is also provided.
[0033] When the term "and / or" is used herein, it includes the meanings of "and", "or" and "any other combination of all or any of the elements linked by the term".
[0034] The term "at least one" means one or more, and "a plurality" means two or more. "At least one of the following" or its similar expressions refer to any combination of these items, including any combination of single item(s) or plural item(s).
[0035] The present invention mutates the farnesene synthase (AaFS) derived from Artemisia annua through gene synthesis, and uses two mutation strategies to screen mutants with good phenotypes. One strategy is to predict appropriate mutation sites by molecular docking based on the binding between the enzyme and the substrate molecule; the other strategy is to perform homologous comparison on the amino acid sequence corresponding to the farnesene synthase, and select the corresponding sites for directed mutation according to the conserved sequence comparison. Subsequently, primers corresponding to the mutation sites obtained by the two strategies are designed, and plasmid vectors containing a strong promoter and farnesene synthase are constructed using PCR in vitro amplification technology and molecular cloning technology. Different plasmid vectors obtained after sequencing are integrated into the GL0116 strain, and the β-farnesene yield is quantitatively detected by shake flask fermentation subsequently. In addition, the present invention also provides a two-phase fermentation method for the engineered Saccharomyces cerevisiae strain.
[0036] The test materials used in the present invention are all ordinary commercially available products and can be purchased in the market.
[0037] 4.1 Culture media and related solutions LB medium: Tryptone 10 g / L, Yeast Extract 5 g / L, NaCl 10 g / L. In addition, 2% (m / v) agar powder needs to be added separately to the LB solid medium. After mixing, it is sterilized at 121 °C for 20 min.
[0038] YPD basic medium: Tryptone 20 g / L, Yeast Extract 10 g / L, glucose 20 g / L. In addition, 2% (m / v) agar powder needs to be added separately to the YPD solid medium. After mixing, it is sterilized at 115 °C for 20 min.
[0039] Shake flask fermentation medium: (NH 4 ) 2 SO 4 3 g / L, KH 2 PO 4 3.5 g / L, MgSO 4 ·7H 2 O 6.2 g / L, glucose 80 g / L, galactose 9.9 g / L, trace elements 10 mL / L, CuSO 4 ·5H 20.6 mL / L, mix well and adjust the pH to 6.3 - 6.5. Aliquot into 500 mL shake flasks (without baffles and with a liquid volume of 100 mL), and add 10% (V / V) n-dodecane after aliquoting. Sterilize at 115 °C for 20 min. In addition, when inoculating the fermentation medium, add 120 μL / mL of the vitamin stock solution (previously prepared) into the shake flasks separately, and control the initial OD of each shake flask to be 6, with an inoculation amount of 10% (v / v).
[0040] Vitamin stock solution: biotin 0.05 g / L, B5 1 g / L, B3 1 g / L, inositol 25 g / L, B1 1 g / L, B6 1 g / L, p-aminobenzoic acid 0.2 g / L. First dissolve biotin in 750 mL of ddH 2 O, then add 10 mL of 5 M NaOH, and then add the remaining components; after complete dissolution, adjust the pH to 6.3 - 6.5 with 1 M HCl, and finally make up the volume to 1 L, store at 4 °C, and filter sterilize before subsequent use.
[0041] Trace element stock solution: 0.5 M EDTA 80 ml / L, ZnSO 4 ·7H 2 O 5.75 g / L, MnCl 2 ·4H 2 O 0.32 g / L, CoCl 2 ·6H 2 O 0.47 g / L, Na 2 MoO 4 ·2H 2 O 0.48 g / L, CaCl 2 ·2H 2 O 2.9 g / L, FeSO 4 ·7H 2 O 2.8 g / L. First prepare the EDTA solution, add sodium hydroxide to adjust the pH to increase the solubility, then add the remaining drugs in turn. After complete dissolution, adjust the pH to about 4.0 with sodium hydroxide, and finally make up the volume to 1 L, store in the dark at 4 °C.
[0042] 4.2 Types and concentrations of antibiotics used The types and concentrations of antibiotics used are shown in Table 1:[[]]END]] Table 1. Types and concentrations of antibiotics used in this experiment
[0043] 4.3 Sequences involved SEQ ID NO:1 Amino acid sequence of farnesene synthase from Artemisia annua MSTLPISSVSSSSSTSPLVVDDKDSTKPDVIRHTMNFNASIWGDQFLTYDEPEDLVMKKQLVEELKEEVKKELITIKGSNEPMQHVKLIELIDAVQRLGIAYHFEEEIEEALQHIHVTYGEQWVDKENLQSISLWFRLLRQQGFNVSSGVFKDFMDEKGKFKESLCNDAQGILALYEAAFMRVEDETILDNALEFTKVHLDIIAKDPSCDTSLRTQIHQALKQPLRRRLARIEALHYMPIYQQETSHDEVLLKLAKLDFSVLQSMHKKELSHICKWWKDLDLQNKLPYVRDRVVEGYFWILSIYYEPQHARTRMFLMKTCMWLVVLDDTFDNYGTYEELEIFTQAVERWSISCLDMLPEYMKLIYQELLNLHVEMEESLEKEGKTYQIHYVKEMAKELVRNYLVEARWLKEGYMPTLEEYMSISMVTGTYGLMTARSYVGRADIVTEDTFKWVSSYPPIVKASCVIIRLMDDIVSHKEEQERGHVASSIECYSKESGASEEEACEYISRKVEDAWKVINRESLRPTAVPFPLLMPAINLARMCEVLYSVNDGFTHAEGDMKSYMKSFFVHPMVV* SEQ ID NO:2,AaFS R227K-T434I Mutated amino acid sequence MSTLPISSVSSSSSTSPLVVDDKDSTKPDVIRHTMNFNASIWGDQFLTYDEPEDLVMKKQLVEELKEEVKKELITIKGSNEPMQHVKLIELIDAVQRLGIAYHFEEEIEEALQHIHVTYGEQWVDKENLQSISLWFRLLRQQGFNVSSGVFKDFMDEKGKFKESLCNDAQGILALYEAAFMRVEDETILDNALEFTKVHLDIIAKDPSCDTSLRTQIHQALKQPLRKRLARIEALHYMPIYQQETSHDEVLLKLAKLDFSVLQSMHKKELSHICKWWKDLDLQNKLPYVRDRVVEGYFWILSIYYEPQHARTRMFLMKTCMWLVVLDDTFDNYGTYEELEIFTQAVERWSISCLDMLPEYMKLIYQELLNLHVEMEESLEKEGKTYQIHYVKEMAKELVRNYLVEARWLKEGYMPTLEEYMSISMVTGTYGLMIARSYVGRADIVTEDTFKWVSSYPPIVKASCVIIRLMDDIVSHKEEQERGHVASSIECYSKESGASEEEACEYISRKVEDAWKVINRESLRPTAVPFPLLMPAINLARMCEVLYSVNDGFTHAEGDMKSYMKSFFVHPMVV* SEQ ID NO:3,AaFS R227K-T434I Mutated nucleic acid sequence SEQ ID NO:4, AaFS T434I Mutated amino acid sequence MSTLPISSVSSSSSTSPLVVDDKDSTKPDVIRHTMNFNASIWGDQFLTYDEPEDLVMKKQLVEELKEEVKKELITIKGSNEPMQHVKLIELIDAVQRLGIAYHFEEEIEEALQHIHVTYGEQWVDKENLQSISLWFRLLRQQGFNVSSGVFKDFMDEKGKFKESLCNDAQGILALYEAAFMRVEDETILDNALEFTKVHLDIIAKDPSCDTSLRTQIHQALKQPLRRRLARIEALHYMPIYQQETSHDEVLLKLAKLDFSVLQSMHKKELSHICKWWKDLDLQNKLPYVRDRVVEGYFWILSIYYEPQHARTRMFLMKTCMWLVVLDDTFDNYGTYEELEIFTQAVERWSISCLDMLPEYMKLIYQELLNLHVEMEESLEKEGKTYQIHYVKEMAKELVRNYLVEARWLKEGYMPTLEEYMSISMVTGTYGLMIARSYVGRADIVTEDTFKWVSSYPPIVKASCVIIRLMDDIVSHKEEQERGHVASSIECYSKESGASEEEACEYISRKVEDAWKVINRESLRPTAVPFPLLMPAINLARMCEVLYSVNDGFTHAEGDMKSYMKSFFVHPMVV* SEQ ID NO:5, AaFS T434I Mutated nucleic acid sequence Gene sequence corresponding to the plasmid map of PY26 Gene sequence corresponding to the plasmid map of PY26-AaFS 4.4 Strains Involved Saccharomyces cerevisiae strain (GL0116), which is constructed based on Saccharomyces cerevisiae CEN.PK113-7D and has the genotype CEN.PK113-7D::ACS1-6::ERG10::ERG13::tHMG1::HMG2::ERG12::ERG8::ERG19::IDI1::ERG20, named GL0116.
[0044] Saccharomyces cerevisiae strain (2739), which is constructed based on Saccharomyces cerevisiae CEN.PK113-7D and has the genotype CEN.PK113-7D::ACS1-6::ERG10::ERG13::tHMG1::HMG2::ERG12::ERG8::ERG19::IDI1::ERG20::ERG8-20::Idi1::tHMG::adh::Acs::Acl::Zwf::Gnd::Pdr5::Pdr10::Osh3::VhbΔDpp1ΔLpp1ΔGpd1::Fs:: ΔBts1, named 2739.
[0045] The present invention will be further described below in conjunction with embodiments. It should be understood that in various embodiments of the present application, the magnitudes of the serial numbers of the above processes do not mean the order of execution. Some or all steps can be executed in parallel or successively. The execution order of each process should be determined by its function and internal logic, and should not constitute any limitation to the implementation process of the embodiments of the present application.
[0046] Example 1. Construction of the corresponding vector containing farnesene synthase (AaFS) derived from Artemisia annua Primers for designing and constructing plasmid vectors are shown in Table 2: Table 2. Primers Required for Constructing Expression Vectors
[0047] (1) Linear cyclization of PY26 Using the PY26 plasmid (the original plasmid sequence is as shown above) as the PCR template and PY26-KH-F / R as the upstream and downstream primers, configure the PCR system as shown in Table 3. Table 3. PCR Amplification System
[0048] Set the working procedure with a PCR instrument: The reaction procedure is pre-denaturation at 95 °C for 5 min; denaturation at 95 °C for 30 s; annealing at 60 °C for 30 s; extension at 72 °C (30 s / Kb); repeat the denaturation, annealing, and extension for a total of 30 - 33 cycles; finally, extend at 72 °C for 5 min and hold at 16 °C. After the PCR is completed, perform agarose gel electrophoresis. After obtaining the target fragment, use a gel extraction kit or a liquid PCR recovery kit to recover the fragment, and then detect its corresponding concentration.
[0049] (2)Obtain the target gene fragment Use the plasmid for synthesizing the AaFS gene (the original AaFS gene sequence is as shown above) as the template, and use AaFS-F / R as the upstream and downstream primers to configure the PCR system as shown in Table 3. The subsequent PCR reaction system and recovery method are the same as those in (1).
[0050] (3)Ligate the fragment with the vector to construct the corresponding expression vector Ligate the fragment recovered above with the linearized vector fragment, and use a ligase for ligation. The ligation system is shown in Table 4.
[0051] Table 4. Ligation system
[0052] After mixing the above system evenly, place it at 50 °C for 15 - 30 min, and then immediately hold at 4 °C. Transfer the reaction mixture into Escherichia coli competent DH5α for chemical transformation.
[0053] Place it on ice for 30 min, heat shock at 42 °C for 45 - 90 s, then quickly place it on ice for 2 - 3 min. Add 800 - 1000 μL of LB medium, and place it in a constant temperature shaker at 37 °C and 200 rpm for 50 - 60 min of recovery. Then coat it on the corresponding resistant plate and invert it in a constant temperature incubator at 37 °C for overnight culture.
[0054] (4)Obtain the correct clone For the culture dish after overnight culture, perform colony PCR verification. Use the colony as the corresponding template, and use PY26-YZ-F / R as the upstream and downstream primers to configure the PCR system as shown in Table 3. The reaction system is the same as that in (1). After agarose gel electrophoresis, obtain the transformant with the same size as the target fragment and send it for sequencing. After successful base alignment, single colonies can be selected for plasmid extraction.
[0055] (5)Plasmid extraction.
[0056] Example 2. Homology modeling and molecular docking of farnesene synthase from Artemisia annua (1)Homology modeling of farnesene synthase Homology modeling was carried out through the SWISS-MODEL online website. The amino acid sequence corresponding to the gene-synthesized farnesene synthase (AaFS) was used to compare with the existing models for modeling. The obtained comparison model, namely E7BTW7.1.A, is shown in Figure 1 the figure. It has a high homology with the target protein. The homology modeling model was evaluated by the PROCHECK tool, and the protein simulation structure with a higher matching degree was selected as the reference benchmark for subsequent analysis. Finally, it was shown in the form of a Ramachandran conformation diagram, as shown in Figure 2 the figure.
[0057] It can be seen from Figure 2 that the ratio of the optimal region of the protein structure after modeling reached 92.1%, exceeding the rationality threshold of 90%. Therefore, the model result is reasonable and subsequent simulation analyses such as molecular docking can be carried out.
[0058] Example 3. Construction of site-directed saturation mutations and fermentation verification (1)Molecular docking simulation In this experiment, Autodock was used to perform semi-flexible molecular docking simulation on the AaFS protein and the ligand FPP small molecule. Before molecular docking, the protein and small molecule to be tested were subjected to dehydration and hydrogenation treatment. Subsequently, the farnesene synthase was docked with the FPP compound, and the docking result was processed with Pymol and displayed in a visualization window.
[0059] Using prediction boxes of different sizes, after molecular docking simulation, two sites with lower binding free energy were obtained, namely site 197 and site 526. The hydrogen bond sizes between the amino acids at the specific sites and the surrounding amino acids are shown in Figure 3 and Figure 4 the figure.
[0060] (2)Construction of plasmid vectors for various mutants Subsequently, site-directed saturation mutations will be carried out on the above two sites. By designing corresponding mutant primers (specific mutant primers are shown in Table 5), PCR amplification was performed to linearize the plasmid vector constructed in Example 1.
[0061] Table 5. Primers required for site-directed saturation mutations Primer Name Primer Sequence (5’→3’) K197G-F cgcattggagttcaccggcgtccacttagac K197A-F cgcattggagttcaccgcagtccacttagac K197V-F cgcattggagttcaccgtcgtccacttagac K197L-F cgcattggagttcaccctcgtccacttagac K197I-F cgcattggagttcaccatcgtccacttagac K197P-F cgcattggagttcaccccagtccacttagac K197F-F cgcattggagttcaccttcgtccacttagac K197Y-F cgcattggagttcacctacgtccacttagac K197W-F cgcattggagttcacctgggtccacttagac K197S-F cgcattggagttcaccagcgtccacttagac K197T-F cgcattggagttcaccacggtccacttagac K197C-F cgcattggagttcacctgcgtccacttagac K197M-F cgcattggagttcaccatggtccacttagac K197N-F cgcattggagttcaccaatgtccacttagac K197Q-F cgcattggagttcacccaggtccacttagac K197D-F cgcattggagttcaccgacgtccacttagac K197E-F cgcattggagttcaccgaagtccacttagac K197R-F cgcattggagttcacccgtgtccacttagac K197H-F cgcattggagttcacccatgtccacttagac AaFS-197TB-R ggtgaactccaatgcgttatctaagatagtctcg T526G-F gagaatctttgagaccaggcgctgttccatttccattg T526A-F gagaatctttgagaccagcagctgttccatttccattg T526V-F gagaatctttgagaccagtcgctgttccatttccattg T526L-F gagaatctttgagaccactcgctgttccatttccattg T526I-F gagaatctttgagaccaatcgctgttccatttccattg T526P-F gagaatctttgagaccaccagctgttccatttccattg T526F-F gagaatctttgagaccattcgctgttccatttccattg T526Y-F gagaatctttgagaccatacgctgttccatttccattg T526W-F gagaatctttgagaccatgggctgttccatttccattg T526S-F gagaatctttgagaccaagcgctgttccatttccattg T526K-F gagaatctttgagaccaaaggctgttccatttccattg T526C-F gagaatctttgagaccatgcgctgttccatttccattg T526M-F gagaatctttgagaccaatggctgttccatttccattg T526N-F gagaatctttgagaccaaatgctgttccatttccattg T526Q-F gagaatctttgagaccacaggctgttccatttccattg T526D-F gagaatctttgagaccagacgctgttccatttccattg T526E-F gagaatctttgagaccagaagctgttccatttccattg T526R-F gagaatctttgagaccacgtgctgttccatttccattg T526H-F gagaatctttgagaccacatgctgttccatttccattg AaFS526TB-R tggtctcaaagattctctattaataactttccaagc 526TB-YZ-F gatggtctatctcttgcttggatatgttg 526TB-YZ-R ggatatgtatatggtggtattgccatg 197TB-YZ-F ctccattggtcgtagacgataaggactc 197TB-YZ-R ctggttctggcgtgctgagg Using the primers in the above table, perform PCR amplification. The corresponding reaction system is shown in Table 3, and the reaction procedure is shown in Example 1. After agarose gel electrophoresis, the target fragment is obtained, digested, recovered, and then transferred into Escherichia coli competent DH5α. Use the transformation method in Example 1 for transformation, and finally obtain successful transformants. The plasmid vectors corresponding to various mutants are thus constructed.
[0062] (3) Integrate the mutant plasmid vector into the Saccharomyces cerevisiae strain Integrate the plasmid vectors of various mutants obtained above into the Saccharomyces cerevisiae strain (GL0116). Use yeast electroporation to transform and integrate the AaFS mutant. The specific yeast electroporation process is as follows: ① Take a 1 mL test tube to culture the primary seeds overnight, and transfer 50 mL to a shake flask for secondary seed culture the next day; ② Measure OD600 to 0.8 - 1.0 after about 4 - 5 h, and ice-bath the secondary seeds for 10 - 15 min; ③ Centrifuge at 6000 g for 6 min at 4 °C, discard the supernatant, and collect the cells; ④ Wash the cells twice with 35 - 50 mL of sterile water, and centrifuge at 6000 g for 4 - 6 min at 4 °C, discard the supernatant, and collect the cells; ⑤ Repeat step ④. After washing twice with sterile water, resuspend with 35 - 50 mL of 10% glycerol solution, centrifuge at 6000 g for 4 - 6 min at 4 °C, discard the supernatant, and collect the cells; ⑥ Add a certain amount of 10% glycerol to it, mix gently with a pipette tip, and then aliquot 50 μL of the competent cells into each tube for standby; ⑦ Add 500 μg of RNA plasmid or 500 μg of gRNA and the fragment, about 3 - 7 μL, to the competent cells, mix with a pipette tip, then add it to a pre-dried and pre-cooled electroporation cuvette, and place it on ice; ⑧ Set the voltage to 2.5 kv for electroporation (breakdown time 4.9 - 5.5 ms, empty control 6.0 ms); place the electroporation cuvette in the electroporator for electroporation. After the electroporation is completed, immediately add 700 - 900 μL of YPD medium to the electroporation cuvette and transfer it to a 2 mL centrifuge tube. Incubate at 30 °C for 1 h, then take an appropriate amount of the bacterial solution and spread it on a plate. Then invert the petri dish and place it in a 30 °C constant temperature incubator for culture.
[0063] After colonies grow on the petri dish, perform colony PCR. Pick out a single yeast colony and place it in 20 - 30 μL of cell lysis solution, mix well and place it in a PCR instrument. Lyse at 98 °C for 1 h to be used as a template, and then use Fly Mix reagent for PCR. The corresponding PCR system is shown in Table 6.
[0064] Table 6. Saccharomyces cerevisiae colony PCR reaction system
[0065] The PCR instrument was used to set the working program: the reaction program was 95 °C pre-denaturation for 2 min; 95 °C denaturation for 20 s; 58 °C annealing for 20 s; 72 °C extension (10 s / Kb); repeated denaturation, annealing and extension for 30-35 cycles; and finally 72 °C extension for 5 min and insulation at 16 °C. After the PCR was completed, agarose gel electrophoresis was performed to compare the corresponding transformants with the same target length, indicating successful integration. The correct transformants were then selected for culture and subsequent fermentation experiments.
[0066] (4) Conduct shake flask fermentation experiments The obtained fermentation strain with site-directed mutation was subjected to fixed-site fermentation in a shake flask, and the strain to be fermented was selected for single colony selection, transferred to a test tube, and cultured overnight at 30°C. Then, the bacterial solution in the test tube was transferred to a YPD shake flask (250 mL, 50 mL of liquid) and cultured at 30°C for 1-2 days to obtain the seed solution. The seed solution was then transferred to the shake flask fermentation medium (the specific fermentation medium formula is shown in 4.1), and the test can be performed after culturing at 30°C for 4-5 days. According to the fermentation steps, saturation mutations were performed on sites 197 and 526 in farnesene synthase (AaFS) and fermented by shake flask.
[0067] (5) Quantitative detection of β-farnesene production In this experiment, the internal standard method was used for gas phase detection. The corresponding detection steps are as follows: ① Fermentation sample pretreatment: shake the fermentation broth and take 30 mL into a centrifuge tube, centrifuge at 6000-8000 rpm / min for 8 min. After centrifugation, carefully take 100 μL of the upper oil phase and mix it with 900 μL of liquid A tetradecane internal standard. At this time, the sample is diluted ten times, and then filtered through a 0.22 μM nylon membrane and loaded into the liner tube for gas phase detection.
[0068] ② Gas phase detection: confirm that the chromatographic column is HP-5, and connect the gas chromatographic column to the instrument according to the requirements of “short in and long out”; then follow the series of steps of “turn on the machine → turn on the hydrogen-air integrated machine (ensure the water level is normal) → open the gas cylinder (open in reverse and close in forward direction) → ensure that the needle wash solution and waste liquid are normal”.
[0069] ③Sample detection: After calling out the corresponding method, start the instrument, load the sample after the baseline is stable, and finally enter the shutdown procedure to end the experiment.
[0070] ④ Data processing: After the sample detection is completed, it enters the processing method of area normalization method to determine the peak area at about 13 min (the peak at this time belongs to β-farnesene), and then the β-farnesene yield of the corresponding sample is determined by plotting a standard curve.
[0071] According to the above method steps, the β-farnesene yield of the above fermentation strains was quantitatively detected, and the specific yield results are as follows Figure 5-6 shown: From Figure 5 、 Figure 6 it can be found that after the saturation mutation at site 197, the yield of GL0116::AaFS K197A increased by 40.6% compared with the control group; after the saturation mutation at site 526, the yield of GL0116::AaFS T526N increased by 27.8% compared with the control group.
[0072] Example 4. Conservative sequence comparison of farnesene synthase (AaFS) (1) Sequence comparison From the NCBI online website, use the "BLAST" function to perform a protein similarity search, upload the AaFS target protein sequence involved in this patent, and select several farnesene synthases with higher homology according to the homology size. Through drawing on the Weblogo website, the sequence alignment map of farnesene synthase (AaFS) is obtained, as shown in Figure 7 shown.
[0073] (2) Select subsequent site-directed mutation sites Combined with the amino acid sequence of the FS original sequence, the following mutation sites can be selected for subsequent mutation experiments: 11, 28, 33, 58, 70, 100, 116, 150, 180, 185, 227, 248, 260, 407, 423, 434, 442, 455, 475, 544, 561, and the mutation sites are S11F, P28Q, H33N, K58E, K70R, I100V, H116Y, V150I, F180Y, D185G, R227K, D248N, S260N, R407K, I423V, T434I, A442G, S455T, S475T, E544D, K561I.
[0074] (3) Construct plasmid vectors of various mutants Subsequently, site-directed saturation mutations will be carried out on the above two sites, and PCR amplification will be carried out by designing corresponding mutation primers (specific mutation primers are shown in Table 7) to linearize the plasmid vector constructed in Example 1.
[0075] Table 7. Primers used for constructing site-directed mutation plasmid vectors Primer Name Sequence (5’→3’) S11F-F ctatttcttctgtctcattctcttcatc S11F-R gagaggtagatgaagagaatgagacagaag P28Q-F cgataaggactctactaaacaggacgtc P28Q-R ctgatgacgtcctgtttagtagagtcc H33N-F caggacgtcatcaggaacaccatg H33N-R gcgttgaaattcatggtgttcctg K58E-F ctgaggatttggtcatggagaaacagttg K58E-R cgaccaactgtttctccatgacc K70R-F gaaggaggaggtccggaagg K70R-R gtaatcaactccttccggacctcc I100V-F ctgtccaaagattgggtgtagcctac I100V-R gaagtggtaggctacacccaatc H116Y-F gaggctttacaacatatatacgtcacatacgg H116Y-R cactgttcaccgtatgtgacgtatatatg V150I-F caaggttttaatgtttcatctggaatattcaaggac V150I-R ctcgtccataaagtccttgaatattccagatg F180Y-F gcattgtatgaggccgcatacatg F180Y-R cttcaaccctcatgtatgcggc D185G-F atgagggttgaaggagagactatcttag D185G-R caatgcgttatctaagatagtctctccttc R227K-F cattaaagcaacctttgaggaagaggttg R227K-R cgattctagccaacctcttcctcaaag D248N-F gcaggaaacctcacacaacgaag D248N-R ctaactttaacaaaacttcgttgtgtgagg S260N-F gcaaaattggacttcaacgtcttgc S260N-R cttatgcattgactgcaagacgttgaag R407K-F ctatttggttgaggccaagtggttg R407K-R catataaccctctttcaaccacttggcc I427V-F ccttggaggagtacatgtcagtctcaatg I427V-R ggtaccagtaaccattgagactgacatg T434I-F ggtacctatggtttgatgatagccagatc T434I-R cttccgacgtatgatctggctatcatc A442G-F cagatcatacgtcggaagaggagatatc A442G-R ggtatcctctgttacgatatctcctcttcc S455T-F gataccttcaagtgggtttctacataccctc S455T-R ccttgacgataggagggtatgtagaaacc S475T-F ggttgatggatgacattgttactcataagg S475T-R ctcctgttcctccttatgagtaacaatgtc E544D-F caacttggcaaggatgtgcgacgttttg E544D-R gtttactgaatacaaaacgtcgcacatcc K561I-F ctcacgccgaaggtgatatgatatcata K561I-R ggatgtacgaaaaaagatttcatatatgatatcatatcacc DDFS-YZ-F ccaaacctctggcgaagaattgt DDFS-YZ-R ccgcggagatcttatactaccatagg Using the primers in the above table, PCR amplification was carried out. The corresponding reaction system is shown in Table 3, and the reaction procedure is shown in Example 1. After agarose gel electrophoresis, the target fragment was obtained, digested, recovered, and then transferred into the competent Escherichia coli DH5α. The transformation was carried out using the transformation method in Example 1, and finally successful transformants were obtained. The plasmid vectors corresponding to various mutants were thus constructed.
[0076] (4) Integrating the mutant plasmid vector into the Saccharomyces cerevisiae strain The plasmid vectors of various mutants obtained above were integrated in the Saccharomyces cerevisiae strain (GL0116). The yeast electroporation transformation of the AaFS mutant was used, and the specific yeast electroporation transformation process and the subsequent verification process of the electroporation transformants were the same as those shown in Example 3.
[0077] (5) Conducting flask fermentation experiments The 21 strains with directed mutations obtained were subjected to flask fermentation and quantitative detection. The fermentation method and detection method are shown in Example 3.
[0078] Directed mutations were carried out on the farnesene synthase (AaFS). After flask fermentation, the yield of β-farnesene was quantitatively detected. The specific yield results are shown in Figure 8 .
[0079] From Figure 8 it can be seen that after directed mutations were carried out on the farnesene synthase (AaFs), the β-farnesene content of some strains was greatly improved. Among them, the yield of the GL0116::AaFS H116Y mutant strain increased by 42.2% compared with the control group; the yield of the GL0116::AaFS R227K mutant increased by 37.3% compared with the control group; the yield of the GL0116::AaFS D248N mutant increased by 45.6% compared with the control group; the yield of the GL0116::AaFS T434I mutant (the mutant base sequence of farnesene synthase is shown in SEQ ID No. 3) increased by 58.3% compared with the control group.
[0080] Example 5. Carrying out stacked mutations on the effective mutant strains (1) Constructing a stacked mutation plasmid vector Based on the well - performing mutants obtained in the previous Examples 3 and 4, superimposed mutations were carried out, namely K197A - T526N, K197A - T526I, K197M - T526N, K197M - T526I, D248N - R227K, D248N - H116Y, D248N - T434I, R227K - H116Y, R227K - T434I, H116Y - T434I. Through designing corresponding mutant primers (the specific mutant primers are shown in Tables 5 and 7), PCR amplification was carried out to linearize the plasmid vectors carried by the strains with good mutation effects and which had ended fermentation in Examples 3 and 4.
[0081] (4) Integrate the mutant plasmid vector into the Saccharomyces cerevisiae strain Integrate the plasmid vectors of various superimposed mutants obtained above into the Saccharomyces cerevisiae strain (GL0116), and use yeast electroporation to transform and integrate the AaFS mutant. The specific yeast electroporation transformation process and the subsequent verification process of the electroporated transformants are the same as those shown in Example 3.
[0082] (5) Conduct shake - flask fermentation experiments Carry out shake - flask fermentation and quantitative detection on the 10 strains with superimposed mutations obtained. The fermentation method and detection method are as shown in Example 3. The content of β - farnesene obtained after fermentation and gas - phase detection is shown in Figure 9 as follows.
[0083] From Figure 9 it can be seen that after carrying out superimposed mutations on the farnesene synthase (Fs) through pairwise different combinations of mutation sites, for some strains with superimposed mutations, although the content of β - farnesene has increased, it is not high; in addition, the fermentation effect of some strains with superimposed mutations has decreased instead of increased. After comparing the yields of these ten mutant strains, it was found that the content of the GL0116::AaFS R227K-T434I mutant strain (the mutant base sequence of farnesene synthase is shown in SEQ ID No.2) is the highest, reaching 2.23 g / L, and the yield has increased by 52.2% compared with the control group.
[0084] Example 6. Experiments on effective mutant strains in genetically engineered strains (1) Integrate the mutant plasmid vector into the Saccharomyces cerevisiae strain 2739 Integrate the plasmid vectors of the well - performing mutants and superimposed mutants obtained above into the 2739 genetically engineered strain, and use yeast electroporation to transform and integrate the AaFS mutant. The specific yeast electroporation transformation process and the subsequent verification process of the electroporated transformants are the same as those shown in Example 3.
[0085] (2) Conduct shake - flask fermentation experiments The 10 strains with superimposed mutations obtained were subjected to shake-flask fermentation and quantitative detection. The fermentation method and detection method are shown in Example 3. The β-farnesene content obtained after fermentation and gas-phase detection is shown in Figure 10 shown below.
[0086] As can be seen from Figure 10 the results, after integrating the farnesene synthase (AaFS) mutants that performed well in various experimental results into the 2739 strain, the β-farnesene yield of some mutant-corresponding strains increased. After comparison, it was found that the content of the 2739::AaFS T434I mutant strain (the mutant base sequence of farnesene synthase is shown in SEQ ID No. 3) was the highest, reaching 31.67 g / L.
[0087] The above is only the preferred embodiment of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.
Claims
1. A mutant of β-farnesene synthase derived from Artemisia annua, wherein the amino acid sequence of the β-farnesene synthase derived from Artemisia annua is shown in SEQ ID NO: 1, and the mutation site in the mutant is at least one of K197A, T526I, H116Y, R227K, D248N or T434I.
2. The mutant according to claim 1, characterized in that The mutation site is at least one of K197A, T526I, T434I or R227K.
3. The mutant according to claim 1 or 2, characterized in that The mutation site is T434I, or R227K and T434I.
4. A nucleic acid encoding the mutant according to any one of claims 1 to 3.
5. The nucleic acid according to claim 4, characterized in that It has a nucleotide sequence as shown in SEQ ID NO: 2; or having a sequence in which one or more nucleotides are substituted, deleted, added and / or replaced based on the nucleic acid sequence shown in SEQ ID NO: 2; Or a sequence having more than 80% identity with the nucleic acid sequence shown in SEQ ID NO:
2.
6. An expression cassette comprising a promoter and the nucleic acid according to claim 4 or 5.
7. A plasmid vector comprising the nucleic acid of claim 4 or 5 or the expression cassette of claim 6.
8. A transformant transformed or transfected with the plasmid vector according to claim 7, or having the nucleic acid according to claim 4 or 5 integrated into its genome or the expression cassette according to claim 6 integrated into it.
9. The transformant according to claim 8, characterized in that Its host is Saccharomyces cerevisiae.
10. The transformant according to claim 9, characterized in that The genotype of the host is CEN.PK113-7D::ACS1-6::ERG10::ERG13::tHMG1::HMG2::ERG12::ERG8::ERG19::IDI1::ERG20; or CEN.PK113-7D::ACS1-6::ERG10::ERG13::tHMG1::HMG2::ERG12::ERG8::ERG19::IDI1::ERG20:: ERG8-20 :: Idi1 :: ikB :: adh :: Acs :: Acl::Zwf::Gnd::Pdr5::Pdr10:: Osh3::VhbΔDpp1ΔLpp1ΔGpd1 ::Fs:: ΔBts1 .
11. A method for preparing β-farnesene, comprising: Cultivating the transformant according to any one of claims 8 to 10 to obtain a product containing β-farnesene.
12. The preparation method according to claim 11, characterized in that: The culture medium includes water and (NH4)2SO4 3 g / L, KH2PO4 3.5 g / L, MgSO4·7H2O 6.2 g / L, glucose 80 g / L, galactose 9.9 g / L, trace elements 10 mL / L, vitamins 120 µL / mL, CuSO4·5H2O 0.6 mL / L, and 10% (V / V) n-dodecane.
Citation Information
Patent Citations
Beta-farnesene synthetase mutant and application thereof
CN116426514A
Farnesene synthetase mutant, coding gene and application
CN117660426A
Farnesene synthetase mutant, gene, genetically engineered bacterium and application thereof
CN117701544A
Farnesene synthetase mutant and coding gene
CN117701545A
Farnesene synthetase mutant for co-production of beta-farnesene and alpha-bisabolol
CN117802078A