Release factor removal method and application thereof

By introducing tag proteins at the end of the release factor and removing these factors with magnetic bead treatment, the problem of decreasing release factor activity in the cell-free protein synthesis system is solved, and efficient removal and improvement of the introduction efficiency of non-natural amino acid insertion proteins is achieved.

CN120060319APending Publication Date: 2025-05-30KANGMA (SHANGHAI) BIOTECH LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202311630390.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2023-11-30
Publication Date
2025-05-30

AI Technical Summary

Technical Problem

In cell-free protein synthesis systems, the decrease in the activity of ribosome-releasing factors eRF1 and eRF3 can affect the termination process of protein synthesis, resulting in limited cell growth and difficulty in removing these factors efficiently.

Method used

The ends of the release factor are introduced into the tag proteins through genetic modification to generate tagged release factors, and the tagged release proteins are removed by magnetic bead treatment, thereby removing the release factor, thereby improving the introduction efficiency of non-natural amino acid insertion proteins.

Benefits of technology

The removal of release factors in vitro without affecting cell growth and the synthesis efficiency of non-natural amino acids incorporated into proteins is achieved.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120060319A_ABST
    Figure CN120060319A_ABST
Patent Text Reader

Abstract

According to the method for removing the release factor and the application of the release factor, the histidine tag is introduced to the tail end of the release factor, in-vitro removal of the release factor is facilitated, the consequence that cells are seriously damaged in a conventional gene knockout mode is avoided, and the reaction liquid obtained after in-vitro removal of the recombinant release factor has the advantages that the reaction time is shortened; the method has application values of in-vitro synthesis of proteins doped with non-natural amino acids and ribosome display.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and more preferably, to a method for removing release factors and its application. Background Art

[0002] Cell-free protein synthesis (CFPS) is a technology that uses exogenous mRNA or DNA as a template and synthesizes proteins in vitro using enzymes, amino acid substrates, and energy. Compared with traditional in vivo recombinant expression systems, in vitro cell-free synthesis systems have multiple advantages, such as being able to directly use PCR products as templates to simultaneously synthesize multiple proteins in parallel, enabling high-throughput screening of polypeptide or protein drugs. In addition, in vitro cell-free synthesis systems also have unique advantages in the application of expressing polypeptides or proteins that are toxic to cells. The cell-free protein expression system is an important supplement to the cell-based protein expression system.

[0003] Eukaryotic ribosomal release factors eRF1 and eRF3 play key roles in the termination of protein translation and the process of re-releasing ribosomes. Among them, eRF1 has a structure similar to tRNA and can recognize three stop codons (UAA, UAG, UGA); while eRF3 has a structure similar to eEF2 and plays a key role in the process of eRF1 entering the ribosome and ribosome translocation. The decrease in the activity of these two ribosomal release factors will affect the termination process of ribosome-based protein synthesis in cells.

[0004] In the model fungus Saccharomyces cerevisiae, there are two ribosomal release factor encoding genes, named SUP45 (eRF1, YBR143C) and SUP35 (eRF3, YDR172W) respectively; in the K. lactis Y1140 genome, the corresponding gene numbers of these two genes are KLLA0_C11231g and KLLA0_D17424g in sequence. These two genes are essential genes, and knocking them out will seriously affect the growth of cells. Summary of the Invention

[0005] The objective of the present invention is to introduce a tag protein into the end of the release factor of cells through genetic modification, and the obtained cell lysate helps to remove the release factor in vitro, thereby eliminating the need to knock out the gene of the release factor, without affecting the growth of cells, and improving the import efficiency of non-natural amino acids inserted into proteins.

[0006] In the first aspect of the present invention, a nucleic acid construct is provided, characterized in that: the nucleic acid construct contains at least a nucleic acid sequence having the structure as shown in Formula I: Z1-Z2, wherein Z1 and Z2 are elements for constructing the construct respectively; "-" is independently a bond or a nucleotide linking sequence; Z1 is a coding sequence of a release factor, and Z2 is a coding sequence of a tag protein. Among them, the linking position of Z2 is not restricted in the formula, that is, it can be at the N-terminus or at the C-terminus.

[0007] Further preferably, the tag protein is selected from the group consisting of a histidine tag, a CBP tag, a CMyc tag, a FLAG tag, a Spot tag, a C tag, an Avi tag, a Streg tag, a SUMO tag, a GST tag, an MBP tag or a combination thereof.

[0008] Further preferably, the tag is selected from a histidine tag.

[0009] Further preferably, the structure of the histidine tag is n×His, where 1≦n≦50; preferably 2≦n≦30; further preferably, 5≦n≦20; more preferably 6≦n≦10.

[0010] Further preferably, the release factor is RF1, RF2 or RF3.

[0011] Further preferably, the release factor is eRF1 or eRF3.

[0012] In the second aspect of the present invention, a recombinant release factor is provided, and the recombinant release factor is encoded by the nucleic acid construct described in the first aspect of the present invention.

[0013] Further preferably, a tag protein is introduced at the N-terminus or C-terminus of the encoded release factor.

[0014] Further preferably, a tag protein is introduced at the C-terminus of eRF1.

[0015] Further preferably, a tag protein is introduced at the N-terminus of eRF3.

[0016] In the third aspect of the present invention, a vector is provided, and the vector contains the nucleic acid construct described in the first aspect of the present invention.

[0017] Further preferably, the vector is selected from: bacterial plasmids, phages, yeast plasmids, or animal cell vectors, shuttle vectors. In addition, the vector can be a transposon vector. The methods for preparing recombinant vectors are well known to those of ordinary skill in the art. Any plasmid and vector can be adopted as long as it can replicate and be stable in the host.

[0018] In the fourth aspect of the present invention, a genetically engineered strain is provided, wherein one or more loci of the genome of the genetically engineered strain are integrated with the nucleic acid construct described in the first aspect of the present invention, or the genetically engineered strain contains the recombinant protein provided in the second aspect of the present invention or the vector provided in the third aspect of the present invention.

[0019] More preferably, the strain is derived from one or any combination of bacteria, mammalian cells, human cells, plant cells, yeast cells, and insect cells.

[0020] More preferably, the yeast cells are selected from one or a combination of Pichia pastoris, Pichia finlandica, Pichia trehalophila, Pichia koclamae, Pichia membranaefaciens, Pichia minuta, Ogataea minuta, Pichia lindneri, Pichia opuntiae, Pichia thermotolerans, Pichia salictaria, Pichia guercuum, Pichia pijperi, Pichia stipitis, Pichia methanolica, Pichia sp., Saccharomyces cerevisiae, brewer's yeast, molasses yeast, Saccharomyces sp., Hansenula polymorpha, Candida utilis, Kluyveromyces.

[0021] More preferably, the Kluyveromyces further includes: Kluyveromyces lactis, Kluyveromyces marxianus, Kluyveromyces dobzhanskii, Kluyveromyces aestuarii, Kluyveromyces nonfermentans, Kluyveromyces wickerhamii, Kluyveromyces thermotolerans, Kluyveromyces fragilis, Kluyveromyces hubeiensis, Kluyveromyces polysporus, Kluyveromyces siamensis, Kluyveromyces yarrowii, or a combination thereof; preferably, the yeast cell is a Kluyveromyces cell, more preferably a Kluyveromyces lactis cell.

[0022] In a fifth aspect of the present invention, a method for removing release factors in vitro is provided. First, the genetically engineered strain provided in the fourth aspect of the present invention is prepared into a lysate, and then the lysate is treated with magnetic beads.

[0023] More preferably, the magnetic beads are nickel magnetic beads.

[0024] In a sixth aspect of the present invention, an in vitro reaction system is provided, which is obtained by the method for removing release factors in vitro provided in the fifth aspect of the present invention.

[0025] More preferably, the obtained in vitro reaction system does not contain or partially contains recombinant release factors.

[0026] In a seventh aspect of the present invention, a cell-free synthesis system for synthesizing a protein incorporated with non-natural amino acids is provided, including: 1) the in vitro reaction system provided in the sixth aspect of the present invention; 2) an orthogonal aminoacyl-tRNA synthetase / orthogonal tRNA pair; 3) non-natural amino acids; 4) an exogenous protein gene sequence template.

[0027] More preferably, at least one codon encoding an amino acid in the exogenous protein gene sequence is mutated.

[0028] In an eighth aspect of the present invention, an application of the cell-free synthesis system provided in the sixth aspect of the present invention in cell-free synthesis of a protein incorporated with non-natural amino acids is provided.

[0029] The ninth aspect of the present invention provides a kit, and the kit includes the cell-free synthesis system provided by the sixth aspect of the present invention.

[0030] The tenth aspect of the present invention provides a method for cell-free synthesis of a protein incorporated with unnatural amino acids, including the following steps: Step (1), providing the cell-free synthesis system provided by the sixth aspect of the present invention or the kit provided by the ninth aspect of the present invention; Step (2), adding a DNA molecule encoding an exogenous protein to the synthesis system or the kit in step (1), and obtaining the protein through reaction under the conditions of an orthogonal aminoacyl-tRNA synthetase / orthogonal tRNA and an unnatural amino acid.

[0031] Further preferably, at least one codon encoding an amino acid in the exogenous protein gene sequence is mutated.

[0032] Further, the exogenous protein is selected from: luciferin protein, luciferase (such as firefly luciferase), fluorescent protein (such as green fluorescent protein, yellow fluorescent protein, red fluorescent protein), aminoacyl-tRNA synthetase, glyceraldehyde-3-phosphate dehydrogenase, catalase, actin, variable region of antibody, luciferase mutant, α-amylase, colicin A, hepatitis C virus E2 glycoprotein, insulin precursor, interferon αA, cytokine, interferon α2b, interleukin-1β, lysozyme, serum albumin, single-chain antibody fragment (scFV), transthyretin, tyrosinase, xylanase or a combination thereof.

[0033] Further, the exogenous protein includes a wild-type protein, a mutant protein or a recombinant protein.

[0034] Further, the aminoacyl-tRNA synthetase is selected from natural or mutant Pyl-tRNA synthetase (PylRS), Leu-tRNA synthetase (LeuRS), Tyr-tRNA synthetase (TyrRS), Phe-tRNA synthetase (PheRS) or TrP-tRNA synthetase (TrpRS). Further preferably, it is PylRS.

[0035] Further, the aminoacyl-tRNA synthetase is selected from natural or mutant MaPylRS, MmPylRS, MbPylRS, EcTyrRS, MjTyrRS, EcLeuRS, ScPheRS, ScTrpRS, BsTrpRS

[0036] Further, the unnatural amino acid refers to an amino acid type other than the 20 natural amino acids.

[0037] Further, the structural formula of the unnatural amino acid is a compound of formula (2) or a salt form thereof.

[0038] Wherein n is selected from natural numbers from 1 to 20, and R 1 is selected from substituted or unsubstituted C5-C60 aryl or heteroaryl, substituted or unsubstituted C1-C20 alkyl, substituted or unsubstituted C2-C20 alkenyl or substituted or unsubstituted C2-C20 alkynyl, and A is selected from O or -CH 2 -.

[0039] In another preferred example, n is selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20.

[0040] In another preferred example, n is selected from natural numbers from 1 to 10.

[0041] In another preferred example, n is selected from 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.

[0042] In another preferred example, n is selected from natural numbers from 1 to 6.

[0043] In another preferred example, n is selected from 1, 2, 3, 4, 5 or 6.

[0044] In another preferred example, the R 1 is selected from substituted or unsubstituted C5-C30 aryl or heteroaryl.

[0045] In another preferred example, the R 1 is selected from substituted or unsubstituted phenyl.

[0046] In another preferred example, the R 1 is selected from substituted or unsubstituted C2-C20 alkenyl.

[0047] In another preferred example, the R 1 is selected from substituted or unsubstituted C2-C10 alkenyl.

[0048] In another preferred example, the R 1 is selected from substituted or unsubstituted C2-C6 alkenyl.

[0049] In another preferred example, the R 1 is selected from or substituted or unsubstituted C2-C20 alkynyl.

[0050] In another preferred example, the R 1 is selected from or substituted or unsubstituted C2-C10 alkynyl.

[0051] In another preferred embodiment, the R 1 is selected from an optionally substituted C2-C6 alkynyl group.

[0052] In another preferred embodiment, the A is selected from O.

[0053] In another preferred embodiment, the A is selected from -CH 2 -.

[0054] In another preferred embodiment, the substituents are common substituents in the art, such as aryl, heteroaryl, alkyl, cycloalkyl, aryloxy, heteroaryloxy, alkyloxy, cycloalkyloxy, hydroxy, mercapto, ester group, carboxyl group, cyano group, halogen, nitro group, sulfonic acid group, azide group, alkenyl, alkynyl, phosphate group, etc.

[0055] In another preferred embodiment, the structural formula of the unnatural amino acid is selected from one or a combination of the following, or its salt form:

[0056]

[0057] The advantages of the present invention are as follows:

[0058] (1) By introducing a histidine tag at the N-terminus or C-terminus of the release factor, it is found that this modification can significantly reduce the in vitro protein synthesis activity of cell extracts, and has certain application value in ribosome display and the introduction of unnatural amino acids.

[0059] (2) The recombinant release factor integrated in the strain can be removed only by a simple in vitro adsorption method, avoiding the serious damage to cells caused by the conventional gene knockout method.

[0060] (3) The reaction solution obtained after removing the recombinant release factor in vitro significantly improves the efficiency of in vitro synthesis of proteins incorporated with unnatural amino acids. BRIEF DESCRIPTION OF THE DRAWINGS

[0061] Figure 1 It is the amino acid sequence alignment result of eRF1 in different yeast strains. Among them, P12385 corresponds to eRF1 in Saccharomyces cerevisiae, W0TC52 corresponds to eRF1 in Kluyveromyces marxianus, and Q6CTN8 corresponds to eRF1 in Kluyveromyces lactis. It shows that the amino acid sequences of eRF1 proteins in the three budding yeasts are highly consistent.

[0062] Figure 2Amino acid sequence alignment results of eRF3 in different yeast strains. Among them, P12385 corresponds to eRF1 in Saccharomyces cerevisiae, W0TC52 corresponds to eRF1 in Kluyveromyces marxianus, and Q6CTN8 corresponds to eRF1 in Kluyveromyces lactis. It shows that the C-terminus of the eRF1 protein amino acid sequence in three budding yeasts is relatively conserved, while its N-terminus has relatively more variations. Therefore, fusion expression is mainly considered at its N-terminus.

[0063] Figure 3 The structure of yeast eRF1 predicted by Alpha Fold2 and its conservation analysis. It can be seen that its N-terminus is relatively conserved and forms a relatively rigid α-helix structure; its C-terminus is also relatively conserved, but does not form a rigid structure. Therefore, fusion expression is mainly considered at its C-terminus.

[0064] Figure 4 Design scheme of the CRISPR-Cas9-mediated gene mutation method. The figure shows the mutation design scheme of SUP45. Among them, gRNA is designed at a position closer to the C-terminus inside the ORF of SUP45. Synonymous mutations are introduced in the gRNA binding region through Primer2 and Primer3, and 6×His-tag is introduced at the C-terminus through Primer4 and Primer5.

[0065] Figure 5 Design scheme of nucleotide mutations mediated by gRNA position and primers. The figure shows the design details of introducing synonymous mutations at the SUP45-gRNA position through Primer2 and Primer3, including the sequence information, relative positions of primers Primer2 and Primer3, and their matching with the original sequence.

[0066] Figure 6 IVTT activity results of cell extracts of mutant strains. Among them, control represents the situation where the strain is not mutated. Light color represents a reaction for 3 h, and dark color represents a reaction for 20 h. The results show that the modification of the N-terminus of eRF3 and the C-terminus 6×Histag of eRF1 significantly reduces the IVTT activity of cell extracts of mutant strains.

[0067] Figure 7 IVTT activity results of cell extracts of mutant strains after treatment with Ni-NTA magnetic beads. Among them, control represents the situation where the strain is not mutated. Light color represents without treatment with Ni-NTA magnetic beads, and dark color represents treatment with Ni-NTA magnetic beads.

[0068] Figure 8 Template for inserting a non-natural amino acid at the EGFP151 site (TAG 1site reporter).

[0069] Figure 9 The activity results of the in vitro expression of proteins containing unnatural amino acids after the cell extract of the mutant strain was treated with Ni-NTA magnetic beads. Detailed implementation manners

[0070] It should be noted that, without conflict, the embodiments in the present application and the features in the embodiments can be combined with each other.

[0071] The present invention will be further described below in combination with the detailed implementation manners and embodiments. It should be understood that these embodiments are only used to illustrate the present invention and not to limit the scope of the present invention. For the experimental methods without specific conditions noted in the following embodiments, the conditions guided by the detailed implementation manners described above shall be preferred and referred to first, and then the conventional conditions or the conditions recommended by the manufacturer can be followed.

[0072] Unless otherwise stated, the percentages and parts mentioned in the present invention are weight percentages and weight parts.

[0073] Unless otherwise specified, the materials and reagents used in the embodiments of the present invention are all commercially available products.

[0074] Unless otherwise specified, the temperature unit in the present application is degree Celsius (°C).

[0075] Nouns and terms

[0076] The following are the explanations or descriptions of the meanings of some relevant "nouns" and "terms" adopted in the present invention, so as to better understand the present invention. The corresponding explanations or descriptions apply to the whole text of the present invention, both to the following text and to the above text. When the present invention involves citing documents, the definitions of relevant terms, nouns, and phrases in the cited documents are also cited. However, when there is a conflict with the definitions in the present invention, the definitions in the present invention shall prevail. When there is a conflict between the definitions in the cited documents and the definitions in the present invention, it does not affect the components, substances, compositions, materials, systems, formulations, types, methods, equipment, etc. determined in the cited documents to be used as they are.

[0077] In the present invention, the preferred implementation manners such as "preferred", "more preferred", "even more preferred", "most preferred", "further preferred", etc. do not constitute any limitation on the scope of coverage and protection scope of the invention, and are not used to limit the scope and implementation manners of the present invention. They are only used to provide some implementation manners as examples.

[0078] In the description of the present invention, for preferred manners such as "one of the preferred", "one of the preferred manners", "one of the preferred embodiments", "one of the preferred examples", "preferred example", "in a preferred embodiment", "in some preferred examples", "in some preferred manners", "preferably", "preferred", "preferably", "more preferably", "more preferably", "further preferably", "most preferably", etc., and illustrative listing manners such as "one of the embodiments", "one of the manners", "example", "specific example", "for example", "as an example", "for instance", "such as", etc., they do not constitute any limitation on the scope of coverage and protection scope of the invention in any sense, and the specific features described by each manner are included in at least one specific embodiment of the present invention. In the present invention, the specific features described by each manner can be combined in a suitable manner in any one or more specific embodiments. In the present invention, the technical features or technical solutions corresponding to each preferred manner can also be combined by any suitable manner.

[0079] In the present invention, "any combination thereof" means "greater than 1" in terms of quantity and means the group constituted by the following situations in terms of coverage: "optionally one of them, or the group constituted by optionally at least two of them".

[0080] In the present invention, descriptions such as "one or more", "one or more kinds", etc. of "one or more" have the same meaning as "at least one", "at least one kind", "its combination", "or its combination", "and its combination", "or any combination thereof", "and any combination thereof", etc., and can be used interchangeably, indicating that the quantity is equal to "1" or "greater than 1".

[0081] In the present invention, the use of "or / and", "and / or" means "optionally one of them or optionally their combination", and also means at least one of them.

[0082] The term "about" can refer to a value or composition within an acceptable error range determined by those of ordinary skill in the art for a specific value or composition, which will depend in part on how the value or composition is measured or determined. For example, as used herein, the expression "about 100" includes all values between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0083] Sequence identity (or homology) is determined by comparing two aligned sequences along a predetermined comparison window (which can be 50%, 60%, 70%, 80%, 90%, 95% or 100% of the length of the reference nucleotide sequence or protein) and determining the number of positions where identical residues occur. Generally, this is expressed as a percentage. Methods for measuring sequence identity of nucleotide sequences are well known to those skilled in the art.

[0084] The prior art means described in the present invention in ways such as "usually", "conventionally", "generally", "frequently", "often", etc. are also cited as references for the content of the present invention. Without special instructions, they can be regarded as one of the preferred ways of some technical features of the present invention. It should be noted that they do not constitute any limitation to the scope of coverage and protection scope of the invention.

[0085] All documents mentioned in the present invention and the documents directly or indirectly cited by these documents are cited as references in this application as if each document is cited separately as a reference.

[0086] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described hereinafter (including but not limited to the embodiments) can be combined with each other to form new or preferred technical solutions as long as they can be used to implement the present invention. Due to space limitations, they will not be elaborated one by one.

[0087] In vitro protein synthesis reaction refers to the reaction of synthesizing proteins in an in vitro cell-free synthesis system, which at least includes the translation process. It includes but is not limited to IVT reaction (in vitro translation reaction), IVTT reaction (in vitro transcription-translation reaction), and IVDTT reaction (in vitro replication-transcription-translation reaction). In the present invention, the IVTT reaction is preferred. The IVTT reaction, corresponding to the IVTT system, is a process of transcribing and translating DNA into protein (Protein) in vitro. Therefore, we also refer to this type of in vitro protein synthesis system as D2P system, D-to-P system, D_to_P system, DNA-to-Protein system; the corresponding in vitro protein synthesis method is also called D2P method, D-to-P method, D_to_P method, DNA-to-Protein method.

[0088] "Cell-free system" means that when performing in vitro protein synthesis, it is not through the secretion and expression method of intact cells. It should be noted that in the in vitro cell-free protein synthesis system of the present invention, it is also allowed to add cell components to promote the reaction, but the added cells do not mainly aim at secreting and expressing exogenous target proteins. In addition, in the D2P system without intact cells constructed under the guidance of the present invention, a small amount of intact cells are intentionally added (for example, the protein content provided by them does not exceed 30 wt% compared with the protein content provided by the cell extract). Such an "evasion" method is also included in the protection scope of the present invention.

[0089] Objective protein: The target expression product of the in vitro protein synthesis system of the present invention is not synthesized and secreted by host cells, but is synthesized in vitro based on an exogenous nucleic acid template, and can also be referred to as an exogenous protein. The exogenous protein can be a protein, a fusion protein, a mixture containing protein molecules or fusion protein molecules; it also broadly includes polypeptides. The product obtained after an in vitro protein synthesis reaction based on a nucleic acid template encoding a target protein can be a single substance or a combination of two or more substances. "Exogenous protein", "objective protein", "target protein", "target translation product" have the same meaning and can be translated as "objective protein", "interested protein", "objective translated product", "interested protein product", etc., and can be used interchangeably in the present invention.

[0090] D2P, DNA-to-Protein, from DNA template to protein product. For example, D2P technology, D2P system, D2P method, D2P kit, etc.

[0091] "The expression system of the present invention", "the in vitro expression system of the present invention", "cell-free in vitro expression system", "cell-free in vitro expression system" can be used interchangeably, and all refer to the in vitro protein expression system of the present invention. Other description methods can also be used, such as: protein in vitro synthesis system, in vitro protein synthesis system, cell-free system, cell-free system, cell-free protein synthesis system, cell-free in vitro protein synthesis system, in vitro cell-free protein synthesis system, in vitro cell-free synthesis system, CFS system (cell-free system), CFPS system (cell-free protein synthesis system), etc. According to the reaction mechanism, it can include an in vitro translation system (which can be abbreviated as the IVT system, a type of mR2P system), an in vitro transcription and translation system (which can be abbreviated as the IVTT system, a type of D2P system), an in vitro replication, transcription and translation system (which can be abbreviated as the IVDTT system, a type of D2P system), etc. In the present invention, the IVTT system is preferred. We also refer to the in vitro protein synthesis system as the "Protein Factory" ("Protein Factory" or "proteinfactory" or "Proteinfactory"). The in vitro protein synthesis system provided by the present invention describes its components in an open manner. The cell-free protein synthesis system of the present invention uses exogenous DNA, mRNA or a combination thereof as a nucleic acid template for protein synthesis, and realizes the in vitro synthesis of the target protein by artificially controlling the addition of substrates required for protein synthesis and protein factors related to transcription and translation.

[0092] In the present invention, "protein" and "proteins" have the same meaning and are both translated as "protein", and can be used interchangeably.

[0093] In the present invention, "system" and "system of systems" are both translated as "system" and can be used interchangeably.

[0094] In the present invention, "protein synthesis amount", "protein expression amount" and "protein expression yield" have the same meaning and can be used interchangeably.

[0095] In the present invention, cell extract, cell extraction solution, cell lysate, cell disruption product, and cell lysis product have the same meaning and can be used interchangeably. English can be described as cell extract, cell lysate, etc.

[0096] In the present invention, energy system, energy supply system, and energy supply system have the same meaning and can be used interchangeably. The energy regeneration system and the energy regeneration system have the same meaning and can be used interchangeably. The energy regeneration system is a preferred embodiment or component of the energy system.

[0097] Furthermore, the present invention provides a cell-free protein synthesis system, which at least includes a cell extract or a cell lysate.

[0098] More preferably, the cell-free protein synthesis system further includes one or more components selected from the following group: substrates for synthesizing RNA, substrates for synthesizing proteins, polyethylene glycol or its analogs, magnesium ions, potassium ions, buffers, RNA polymerase, an energy regeneration system, dithiothreitol, and an optional aqueous solvent.

[0099] More preferably, the substrates for synthesizing RNA include: one of nucleoside monophosphates, nucleoside triphosphates, or a combination thereof.

[0100] More preferably, the substrates for synthesizing proteins include: 20 natural amino acids and non-natural amino acids.

[0101] More preferably, the magnesium ions are derived from a magnesium ion source, and the magnesium ion source is selected from the following group: magnesium acetate, magnesium glutamate, or a combination thereof.

[0102] More preferably, the potassium ions are derived from a potassium ion source, and the potassium ion source is selected from the following group: potassium acetate, potassium glutamate, or a combination thereof.

[0103] More preferably, the energy regeneration system is selected from the following group: the creatine phosphate / creatine phosphokinase system, the glycolysis pathway, and the energy system of its intermediates, or a combination thereof.

[0104] Further preferably, the energy regeneration system comprises a glucose / phosphate system, and the phosphate is selected from the group consisting of tripotassium phosphate, triammonium phosphate, trisodium phosphate, dipotassium hydrogen phosphate, diammonium hydrogen phosphate, disodium hydrogen phosphate, potassium dihydrogen phosphate, ammonium dihydrogen phosphate, sodium dihydrogen phosphate, or a combination thereof.

[0105] Further preferably, the buffer is selected from the group consisting of 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid, tris(hydroxymethyl)aminomethane, or a combination thereof.

[0106] Further preferably, the in vitro protein synthesis system contains polyethylene glycol (PEG) or an analogue thereof. The concentration of polyethylene glycol or an analogue thereof is not particularly limited. Generally, the concentration (w / v) of polyethylene glycol or an analogue thereof is 0.1-8%, preferably 0.5-4%, more preferably 1-2%, based on the total weight of the protein synthesis system. Representative PEGs are selected from the group consisting of PEG3000, PEG3350, PEG6000, PEG8000, or a combination thereof.

[0107] Further preferably, the polyethylene glycol includes polyethylene glycols with a molecular weight (Da) of 200-10000, such as PEG200, 400, 1500, 2000, 4000, 6000, 8000, 10000, etc., preferably polyethylene glycols with a molecular weight of 3000-10000.

[0108] In the present invention, the RNA polymerase is not particularly limited and can be selected from one or more RNA polymerases. A typical RNA polymerase is T7 RNA polymerase.

[0109] An alternative embodiment is that the in vitro protein synthesis system provided by the present invention includes: cell extract, 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid, potassium acetate, magnesium acetate, adenosine triphosphate (ATP), guanosine triphosphate (GTP), cytidine triphosphate (CTP), thymidine triphosphate (TTP), amino acid mixture, creatine phosphate, dithiothreitol (DTT), creatine phosphokinase, RNA polymerase.

[0110] In the present invention, the cell extract does not contain intact cells. Typical cell extracts include ribosomes for protein translation, aminoacyl-tRNA synthetases, initiation factors, elongation factors, and termination release factors required for protein synthesis. In addition, the cell extract also contains some other proteins derived from the cytoplasm of the cells, especially soluble proteins.

[0111] In the present invention, the proportion of the cell extract in the in vitro cell-free protein synthesis system is not particularly limited. Generally, the cell extract accounts for 20-70% of the in vitro cell-free protein synthesis system, preferably 30-60%, more preferably 40-50%.

[0112] In the present invention, the protein content of the cell extract is 20 - 100 mg / mL, preferably 50 - 100 mg / mL. The method for measuring the protein content is the Coomassie brilliant blue assay method.

[0113] The present invention also provides a vector or vector combination, wherein the vector contains the nucleic acid construct of the present invention. Preferably, the vector is selected from: bacterial plasmids, phages, yeast plasmids, animal cell vectors, shuttle vectors; the vector is a transposon vector. The methods for preparing recombinant vectors are well known to those of ordinary skill in the art. Any plasmid and vector can be used as long as it can replicate and be stable in the host.

[0114] Those of ordinary skill in the art can use well-known methods to construct expression vectors containing the promoter and / or target gene sequence of the present invention. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc.

[0115] template DNA

[0116] The template DNA is a nucleotide sequence encoding any target protein to be synthesized, which can be an original sequence, or an artificially synthesized sequence or artificially modified sequence. Using this template DNA, the corresponding RNA and / or protein can be synthesized.

[0117] In the present invention, the method for preparing the cell extract is not limited, and a preferred preparation method

[0118] includes the following steps:

[0119] (i) Provide cells;

[0120] (ii) Wash the cells to obtain washed cells;

[0121] (iii) Disrupt the washed cells to obtain a crude cell extract;

[0122] (iv) Perform solid-liquid separation on the crude cell extract to obtain the liquid part, which is the cell extract.

[0123] In the present invention, the solid-liquid separation method is not particularly limited, and a preferred method is centrifugation.

[0124] In a preferred embodiment, the centrifugation is carried out in a liquid state.

[0125] In the present invention, the centrifugation conditions are not particularly limited, and a preferred centrifugation condition is 5000 - 100000 g, preferably 8000 - 30000 g.

[0126] In the present invention, the centrifugation time is not particularly limited. A preferred centrifugation time is 0.5 min - 2 h, and preferably, 20 min - 50 min.

[0127] In the present invention, the temperature of the centrifugation is not particularly limited. Preferably, the centrifugation is carried out at 1 - 10°C, and preferably, at 2 - 6°C.

[0128] In the present invention, the washing treatment method is not particularly limited. A preferred washing treatment method is to carry out the treatment with a washing solution at a pH of 7 - 8 (preferably, 7.4). The washing solution is not particularly limited. Typically, the washing solution is selected from the group consisting of potassium 4-(2-hydroxyethyl)-1-piperazineethanesulfonate, potassium acetate, magnesium acetate, or a combination thereof.

[0129] In the present invention, the method of cell disruption treatment is not particularly limited. A preferred method of cell disruption treatment includes high-pressure disruption and freeze-thaw (such as liquid nitrogen cryogenic) disruption.

[0130] The nucleoside triphosphate mixture in the in vitro cell-free protein synthesis system is adenosine triphosphate, guanosine triphosphate, cytidine triphosphate, and uridine triphosphate. In the present invention, the concentration of each mononucleotide is not particularly limited. Usually, the concentration of each mononucleotide is 0.5 - 5 mM, and preferably, 1.0 - 2.0 mM.

[0131] The amino acid mixture in the in vitro cell-free protein synthesis system may include natural or unnatural amino acids, and may include D-type or L-type amino acids. Representative amino acids include (but are not limited to) 20 natural amino acids: glycine, alanine, valine, leucine, isoleucine, phenylalanine, proline, tryptophan, serine, tyrosine, cysteine, methionine, asparagine, glutamine, threonine, aspartic acid, glutamic acid, lysine, arginine, and histidine. The concentration of each amino acid is usually 0.01 - 0.5 mM, and preferably, 0.02 - 0.2 mM, such as 0.05, 0.06, 0.07, 0.08 mM.

[0132] In a preferred embodiment, the cell-free protein synthesis system further contains polyethylene glycol or its analog. The concentration of polyethylene glycol or its analog is not particularly limited. Generally, the concentration (w / v) of polyethylene glycol or its analog is 0.1-8%, preferably 0.5-4%, more preferably 1-2%, based on the total weight of the biosynthesis system. Representative examples of PEG include (but are not limited to): PEG3000, PEG8000, PEG6000, and PEG3350. It should be understood that the system of the present invention may also include polyethylene glycols of various other molecular weights (such as PEG200, 400, 1500, 2000, 4000, 6000, 8000, 10000, etc.).

[0133] In a preferred embodiment, the cell-free protein synthesis system further contains sucrose. The concentration of sucrose is not particularly limited. Generally, the concentration of sucrose is 0.03-40 wt%, preferably 0.08-10 wt%, more preferably 0.1-5 wt%, based on the total weight of the protein synthesis system.

[0134] A particularly preferred cell-free protein synthesis system, in addition to yeast cell extract, further contains the following components: 22 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid at pH 7.4, 30-150 mM potassium acetate, 1.0-5.0 mM magnesium acetate, 1.5-4 mM nucleoside triphosphate mixture, 0.08-0.24 mM amino acid mixture, 25 mM phosphocreatine, 1.7 mM dithiothreitol, 0.27 mg / mL phosphocreatine kinase, 1%-4% polyethylene glycol, 0.5%-2% sucrose, 0.027-0.054 mg / mL T7 RNA polymerase.

[0135] The present invention will be further described below in conjunction with specific embodiments. It should be understood that these embodiments are only for illustrating the present invention.

[0136] Rather than limiting the scope of the present invention. The experimental methods without specific conditions noted in the following examples are generally carried out under conventional conditions, such as the conditions described in Sam brook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise specified, percentages and parts are weight percentages and weight parts. The present invention uses Kluyveromyces lactis (abbreviated as K. lactis or kl) as an example, but the same design, analysis, and experimental methods are also applicable to other eukaryotic cells such as other yeasts and animal cells, as well as prokaryotic cells.

[0137] The present invention takes Kluyveromyces lactis (K. lactis) as an example, but the same design, analysis, and experimental methods are also applicable to other lower eukaryotic cells such as yeast and higher animal cells. The gene modification method in the present invention is the CRISPR-Cas9 technology, but it is not limited thereto, and any known and existing gene modification method can be used.

[0138] An in vitro protein synthesis reaction mixture system, also described as an in vitro protein synthesis reaction mixture, reaction mixture system, or reaction mixture, refers to a mixture system including an in vitro protein synthesis system and a nucleic acid template encoding a target protein; it can be homogeneous or heterogeneous and can be a liquid system such as a solution, emulsion, suspension, etc.

[0139] The final concentrations of the components in the Protein Factory described in the present invention are as follows: 80% (v / v) Kluyveromyces lactis extract, 15 mM glucose, 320 mM maltodextrin (molar concentration measured as glucose monomers), 24 mM tripotassium phosphate, 1.8 mM nucleoside triphosphate mixture (a mixture of adenosine triphosphate, guanosine triphosphate, cytidine triphosphate, and uridine triphosphate, with a final concentration of 1.8 mM for each nucleoside triphosphate), 0.7 mM amino acid mixture (glycine, alanine, valine, leucine, isoleucine, phenylalanine, proline, tryptophan, serine, tyrosine, cysteine, methionine, asparagine, glutamine, threonine, aspartic acid, glutamic acid, lysine, arginine, and histidine, with a final concentration of 0.7 mM for each amino acid), magnesium L-aspartate, 80 mM potassium acetate, 2% (w / v) polyethylene glycol 8000, 9.78 mM Tris·HCl buffer at pH 8.0, 6% (w / v) trehalose. Among them, the Kluyveromyces lactis extract contains endogenously expressed T7 RNA polymerase. The preparation process of the Kluyveromyces lactis cell extract adopts conventional technical means and is prepared with reference to the method described in CN109593656A. Generally speaking, the preparation steps include: providing an appropriate amount of raw materials of Kluyveromyces lactis cells after fermentation culture, quickly freezing the cells with liquid nitrogen, breaking the cells, and centrifuging to collect the supernatant, thus obtaining the cell extract. The protein concentration in the obtained Kluyveromyces lactis cell extract is 20 - 40 mg / mL.

[0140] In the model fungus Saccharomyces cerevisiae, there are two ribosome release factor encoding genes, named SUP45 (eRF1, YBR143C) and SUP35 (eRF3, YDR172W) respectively; in the genome of K. lactis Y1140, the corresponding gene numbers of these two genes are KLLA0_C11231g and KLLA0_D17424g in sequence. These two genes are essential genes, and knocking them out will seriously affect the growth of cells. Therefore, an attempt was made to partially remove one of these two proteins in vitro by fusing histone tags.

[0141] The relevant sequence names and sequence information involved in the present invention are shown in Tables 1 to 4 below.

[0142] Table 1 Gene List

[0143] Gene ID Gene Name Release Factor KLLA0_C11231g SUP45 eRF1 KLLA0_D17424g SUP35 eRF3

[0144] Table 2 gRNA List

[0145] gRNAs Sequence Number Sequence PAM Sup35-gRNA SEQ ID NO:1 gctggagcagcgtaaccggt tgg Sup45-gRNA SEQ ID NO:2 gatactggtaaatactgctacgg cgg

[0146] Table 3 Primer List

[0147]

[0148]

[0149] Table 4 Target Gene and Target Protein Sequence Table

[0150]

[0151]

[0152]

[0153]

[0154]

[0155]

[0156] Example 1: Design of gRNA Targeting Sequences

[0157] Select the ORF region (100 - 2000 bp) of the gene to be designed with gRNA targeting. Complete the design of gRNA on the CRISPOR (tefor.net) website (http: / / crispor.tefor.net / ), and select the gRNAs with higher scores as alternative sequences. For each selected gene, the present invention selects 2 sequences with the highest comprehensive scores as the final gRNA sequences, and the specific information is shown in Table 2. According to the designed gRNA targeting sequences, synthesize the corresponding 24-base primer pairs, that is, add 4-base sequences of AATC and AAAC to the 5'-ends of the forward sequence and the reverse complementary sequence of each gRNA respectively. The finally obtained pair of 24-base primers constitutes a 24-base primer pair.

[0158] Example 2: Construction of gRNA_Cas9 expression vector

[0159] Dilute the paired 24-base primer pairs to 10 μM respectively. Take 10 μL of each and add them to a PCR tube and mix. Then complete the annealing process on a PCR instrument according to the following program: 95°C, 3 min; 72°C, 2 min; 65°C, 2 min; 60°C, 2 min; 55°C, 2 min; 50°C, 2 min; 16°C, 2 min. Take 0.5 μL of the annealed primer pairs and 20 ng of the pCasMFR vector digested with BsaI and purified, mix them in a 10 μL T4 ligase system, and carry out a ligation reaction at 16°C for 1 h. The ligation products are all transformed into competent Escherichia coli DH5α cells, and screened on an LB plate containing 50 μg / mL kanamycin. Randomly select 2 single colonies for sequencing verification, and select the clones with correct sequencing to extract the gRNA_Cas9 co-expression plasmid, determine the concentration, and use it for subsequent electroporation experiments.

[0160] Example 3: Construction of double-stranded DNA donor

[0161] Taking SUP45 as an example, the DNA donor sequence used in the present invention was obtained by the Overlap-PCR method. The 6×His-tag was introduced by primers, and several synonymous mutations were introduced in the gRNA binding region by primers. A total of 6 primers were designed for the assembly of the donor. First, using the genomic DNA of K. lactis Y1140 as a template, PCR amplifications were performed with SUP45-P1+SUP45-P2, SUP45-P3+SUP45-P4, and SUP45-P5+SUP45-P6 as forward and reverse primer pairs respectively using Phanta SuperFidelity DNA polymerase to obtain PCR products H1, H2, and H3, where the fragment lengths of H1 and H3 were not less than 500 bp. Then, using SUP45-P1+SUP45-P6 as forward and reverse primers, and the products H1, H2, and H3 from the previous step of PCR as templates, a second round of PCR was carried out. The product of the second round of PCR was precipitated with 70% ethanol and then dissolved in 50 μL ddH 2 O and stored at -20 °C for later use (if the gene is SUP35, the names of the above primers all correspond to SUP35).

[0162] Example 4: Transformation and screening of yeast strains

[0163] The transformation of Kluyveromyces lactis strains was completed by the electrotransformation method. According to the requirements of the electrotransformation method, competent cells were prepared using K. lactis Y1140 as the starting strain. Before electroporation, 40 μL of the competent cell mixture was thoroughly mixed with the corresponding 500 ng of the gRNA_Cas9 expression plasmid and 1 - 2 μg of DNA Donor, and the electrotransformation process was completed according to the standard operation procedure. The electrotransformed yeast cells were screened on YPD plates containing 250 μg / mL G418. Single colonies were picked for PCR verification, and the positive PCR products were sent to a sequencing company for sequencing; the single colonies with correct sequencing were streaked on plates, and single colonies were picked for a second round of PCR verification. Only the strains that passed both rounds of verification were prepared into glycerol storage tubes and stored in an -80 °C refrigerator.

[0164] Strains containing two or more mutations were obtained through two-step transformation and screening.

[0165] Example 5: Preparation of lysis solution and detection of IVTT activity

[0166] Single colonies were picked after streaking the strain to be tested cryopreserved at -80 °C on a YPD plate and inoculated into a 250 mL Erlenmeyer flask containing 100 mL of seed medium, and cultured with shaking at 30 °C and 200 rpm for 24 h; an aliquot of the seed culture was transferred to a 1000 mL Erlenmeyer flask containing 400 mL of fermentation medium, and cultured with shaking at 30 °C and 200 rpm until the harvest stage. Cells were collected by high-speed centrifugation, and cell lysates were prepared under liquid nitrogen protection for subsequent IVTT activity testing. A certain amount of lysate prepared according to the standard procedure was used to detect and analyze the D2P expression activity of the lysate with mEGFP as the reporter protein according to the operating procedure, and the IVTT activity of the corresponding lysate was judged based on the detected reporter fluorescence intensity (RFU value) (see Figure 6 ), and the results showed that the modification of the N-terminus of eRF3 and the C-terminus of eRF1 with 6×His tag significantly reduced the IVTT activity of the cell extracts of the mutant strain. This characteristic of the decreased in vitro protein synthesis rate after modification may have certain application value in ribosome display and the introduction of unnatural amino acids.

[0167] Example 6: In vitro removal of recombinant release factors and detection of IVTT activity

[0168] After the lysate prepared in the steps of Example 5 was treated with Ni-NTA magnetic beads, all or most of the ribosome release factors with His tag in the lysate could be removed.

[0169] The lysate obtained after treatment with Ni-NTA magnetic beads was subjected to IVTT activity detection in the same manner as in Example 5 (see specifically Figure 7 ), and it can be seen from Figure 7 that the treatment with Ni-NTA magnetic beads further reduced the IVTT activity of the cell extracts of the mutant strain with the modification of the N-terminus of eRF3 and the C-terminus of eRF1 with 6×His tag. It was shown that the selective removal of His tag-modified eRF3 and eRF1 could be effectively achieved by treatment with Ni-NTA magnetic beads.

[0170] Example 7: Activity verification of in vitro expression of proteins containing unnatural amino acids

[0171] The lysate obtained after treatment with Ni-NTA magnetic beads was subjected to activity verification of in vitro expression of proteins containing unnatural amino acids (taking the removal of recombinant eRF3 as an example).

[0172] (1) Reaction conditions

[0173] 100 ul of proteinfactory reaction solution (cell lysate treated with Ni-NTA magnetic beads);

[0174] Target gene (TAG 1site reporter, see Figure 8 ) 3 μl of the template PCR amplification product;

[0175] 5 μM orthogonal - aminoacyl tRNA synthetase

[0176] 5 μM orthogonal - tRNA

[0177] 1 μl of unnatural amino acid.

[0178] The unnatural amino acids used are respectively:

[0179]

[0180] (2) Activity assay

[0181] The reaction was carried out at 30 °C overnight. The fluorescence signal of EGFP protein was read with a Tecan infinity 200pro microplate reader at Ex485 / Em535, and the protein expression level was characterized by the fluorescence signal intensity.

[0182] (3) A comparative example was set up simultaneously. The difference in the comparative example was only that the cell lysate was not treated with Ni - NTA magnetic beads.

[0183] It can be seen from Figure 9 that the protein factory reaction solution (cell lysate treated with Ni - NTA magnetic beads) after removing the release factor can significantly improve the efficiency of protein synthesis containing unnatural amino acids compared with the untreated protein factory reaction solution (cell lysate not treated with Ni - NTA magnetic beads), increasing by about 1.5 - 1.8 times.

[0184] Inspired by the above ideal embodiments according to the present application, through the above description, relevant staff can completely make various changes and modifications without departing from the technical idea of this application. The technical scope of this application is not limited to the content in the specification, and its technical scope must be determined according to the scope of the claims.

Claims

1. A nucleic acid construct, characterized in that: the nucleic acid construct contains at least a nucleic acid sequence having a structure as shown in Formula I: Z1-Z2, wherein Z1 and Z2 are elements for constructing the construct respectively; "-" is independently a bond or a nucleotide linking sequence; Z1 is a coding sequence of a release factor, and Z2 is a coding sequence of a tag protein.

2. The nucleic acid construct according to claim 1, characterized in that: the tag protein is selected from the group consisting of histidine tags.

3. The nucleic acid construct according to claim 2, characterized in that: the structure of the histidine tag is n×His, where 1≦n≦50; preferably 2≦n≦30; further preferably, 5≦n≦20; more preferably 6≦n≦10.

4. The nucleic acid construct according to any one of claims 1-3, characterized in that: the release factor is RF1, RF2 or RF3.

5. The nucleic acid construct according to any one of claims 1-3, characterized in that: the release factor is eRF1 or eRF3.

6. A recombinant release factor, characterized in that: the recombinant release factor is encoded by the nucleic acid construct according to any one of claims 1-5.

7. A vector, characterized in that: the vector contains the nucleic acid construct according to any one of claims 1-5.

8. A genetically engineered strain, characterized in that: one or more sites of the genome of the genetically engineered strain are integrated with the nucleic acid construct according to any one of claims 1-5, or the genetically engineered strain contains the recombinant protein according to claim 6 or the vector according to claim 7.

9. The genetically engineered strain according to claim 8, characterized in that: The strain described above is derived from one or any combination of bacteria, mammalian cells, human cells, plant cells, yeast cells, and insect cells. Preferably, the strain is derived from yeast cells, and more preferably, from Kluyveromyces cells. More preferably, the Kluyveromyces is selected from Kluyveromyces lactis, Kluyveromyces marxianus, Kluyveromyces dobzhanskii, Kluyveromyces aestuarii, Kluyveromyces nonfermentans, Kluyveromyces wickerhamii, Kluyveromyces thermotolerans, Kluyveromyces fragilis, Kluyveromyces hubeiensis, Kluyveromyces polysporus, Kluyveromyces siamensis, Kluyveromyces yarrowii, or a combination thereof.

10. A method for removing release factors in vitro, characterized in that: First, the genetically engineered strain described in any one of claims 8 or 9 is prepared into a lysate, and then the lysate is treated with magnetic beads.

11. The method for removing release factors in vitro according to claim 11, characterized in that: The magnetic beads are nickel magnetic beads.

12. A cell-free synthesis system, characterized in that: It is obtained by the method described in claim 10 or 11.

13. A kit, characterized in that: The kit contains the cell-free synthesis system described in claim 12.

14. Use of the cell-free synthesis system described in claim 12 or the kit described in claim 13 in cell-free synthesis of proteins incorporated with non-natural amino acids or ribosome display.

15. A method for cell-free synthesis of proteins incorporated with non-natural amino acids, comprising the following steps: Step (1), providing the cell-free synthesis system described in claim 12 or the kit described in claim 13; Step (2), adding a DNA molecule encoding an exogenous protein to the synthesis system or kit described in step (1), and reacting in the presence of an orthogonal aminoacyl-tRNA synthetase / orthogonal tRNA and a non-natural amino acid to obtain the protein.

Citation Information

Patent Citations

  • Method for preparing novel cell extract

    CN109593656A