Nucleic acid construct based on flocculation gene and application thereof

Abstract

According to the nucleic acid construct based on the flocculation gene and the application of the nucleic acid construct, by replacing a promoter of the flocculation gene or integrating an exogenous flocculation gene into a cell, the cell collection time can be greatly shortened and the energy consumption during cell collection can be effectively reduced under the condition that the overall activity of IVTT of the cell is almost unchanged.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and more preferably, to a nucleic acid construct based on a flocculation gene and its applications. Background Art

[0002] Cell-free protein synthesis (CFPS) is a technology that uses exogenous mRNA or DNA as a template and synthesizes proteins in vitro using enzymes, amino acid substrates, and energy. Compared with traditional in vivo recombinant expression systems, the in vitro cell-free synthesis system has multiple advantages. For example, it can directly use PCR products as templates to simultaneously and parallelly synthesize multiple proteins, enabling high-throughput screening of polypeptide or protein drugs. In addition, the in vitro cell-free synthesis system also has unique advantages in the application of expressing polypeptides or proteins that are toxic to cells. The cell-free protein expression system is an important supplement to the cell-based protein expression system.

[0003] Existing cell-free protein synthesis systems can mainly be divided into two categories: One is to combine and reconstitute the purified ribosomes, enzymes, tRNAs, etc. required for protein synthesis in a certain proportion to endow them with the ability to express proteins in vitro, that is, the purified cell-free protein expression system (PURE). This system has clear component information and can conveniently and customarily adjust the formula to obtain different protein expression characteristics. However, the disadvantage is that the preparation process is complex and the cost is high. The other category is to obtain the main active substances from the extracts of living cells with protein expression activity and appropriately add the required enzymes, substrates, energy substances, and other components to endow them with the ability to express proteins in vitro, that is, the cell-free protein expression system based on cell extracts. Compared with the PURE system, the latter has the advantages of simple operation process, short cycle, and low cost. However, the latter also has disadvantages such as complex components and many uncontrollable factors in the system, so higher requirements are placed on the cell characteristics of the source cells of the cell extracts. Our company has been committed to building a cell-free protein expression platform technology based on cell extracts for many years. Starting from Kluyveromyces lactis, through continuous optimization and iteration, a D2P production strain with significantly improved cell-free protein expression performance has been obtained. However, there is still a huge room for optimization in the supporting technical processes and background strains of this system at present. Summary of the Invention

[0004] The object of the present invention is to endow cells (especially Kluyveromyces lactis) with flocculation traits through genetic modification, so that cells can be separated by simple static settling, greatly improving the cell separation efficiency, reducing energy consumption, and the obtained cell extracts have no influence on the activity of D2P (DNA to Protein) cell-free protein expression.

[0005] In the first aspect of the present invention, a nucleic acid construct is provided, characterized in that: the nucleic acid construct contains at least a nucleic acid sequence having a structure as shown in formula I: Z1-Z2 (I), wherein Z1 and Z2 are elements for constructing the construct respectively; "-" is independently a bond or a nucleotide linking sequence; Z1 is a promoter sequence, and Z2 is a sequence encoding a flocculating protein.

[0006] More preferably, the gene encoding the flocculating protein is selected from the FLO gene.

[0007] More preferably, the gene encoding the flocculating protein is of the original type or the modified type.

[0008] More preferably, the gene encoding the flocculating protein is KlFLO or ScFLO.

[0009] More preferably, the gene encoding the flocculating protein is selected from FLO1, FLO2, FLO3, FLO4, FLO5, FLO6, FLO7, FLO8, FLO9, FLO10, FLO11 or Lg-FLO1.

[0010] More preferably, the gene encoding the flocculating protein is FLO9.

[0011] More preferably, the gene encoding the flocculating protein is FLO1.

[0012] More preferably, the sequence of the flocculating protein is SEQ ID NO: 37 to SEQ ID NO: 43.

[0013] More preferably, the sequence of the gene encoding the flocculating protein is: SEQ ID NO: 35.

[0014] More preferably, the gene encoding the flocculating protein is a nucleotide having a homology of ≥85% (preferably, ≥90% homology; equally preferably ≥95% homology; most preferably, ≥97% homology, such as above 98%, above 99%) with the nucleotide sequence shown in SEQ ID NO: 35 and having the same activity as the SEQ ID NO: 35 sequence.

[0015] More preferably, the strong promoter is selected from one or more of TEF1, ENO2, HSP26, SPG4, TPS1 or ADH2. Even more preferably, it is ENO2.

[0016] More preferably, the nucleic acid construct further comprises a terminator.

[0017] More preferably, the terminator is selected from PRM9.

[0018] In a second aspect of the present invention, a recombinant protein is provided, which is encoded by the nucleic acid construct described in the first part of the present invention.

[0019] In a third aspect of the present invention, a vector is provided, which contains the nucleic acid construct described in the first aspect of the present invention.

[0020] More preferably, the vector is selected from: bacterial plasmids, phages, yeast plasmids, or animal cell vectors, shuttle vectors. In addition, the vector can be a transposon vector. The methods for preparing recombinant vectors are well-known to those of ordinary skill in the art. Any plasmid and vector can be used as long as it can replicate and be stable in the host.

[0021] In a fourth aspect of the present invention, a genetically engineered strain is provided, in which one or more sites are integrated with the nucleic acid construct described in the first aspect of the present invention, or the genetically engineered strain contains the recombinant protein described in the second aspect of the present invention or contains the vector described in the third aspect of the present invention.

[0022] More preferably, the nucleic acid construct described in the first aspect of the present invention is integrated into the genetically engineered strain.

[0023] More preferably, the sequence of the integration site is SEQ ID NO: 26, or the flocculation gene is a nucleotide having a homology of ≥85% (preferably, ≥90%; equally preferably, ≥95%; most preferably, ≥97%, such as above 98%, above 99%) with the nucleotide sequence shown in SEQ ID NO: 26 and having the same activity as the sequence of SEQ ID NO: 26.

[0024] More preferably, the strain is derived from one or any combination of bacteria, mammalian cells, human cells, plant cells, yeast cells, insect cells; preferably yeast cells.

[0025] More preferably, the yeast cells are selected from Pichia pastoris, Pichia finlandica, Pichia trehalophila, Pichia koclamae, Pichia membranaefaciens, Pichia minuta, Ogataea minuta, Pichia lindneri, Pichia opuntiae, Pichia thermotolerans, Pichia salictaria, Pichia guercuum, Pichia pijperi, Pichia stipitis, Pichia methanolica, Pichia sp., Saccharomyces cerevisiae, brewer's yeast, molasses yeast, Saccharomyces sp., Hansenula polymorpha, Candida utilis, Kluyveromyces, or a combination thereof.

[0026] Further preferably, the Kluyveromyces further includes: Kluyveromyces lactis, Kluyveromyces marxianus, Kluyveromyces dobzhanskii, Kluyveromyces aestuarii, Kluyveromyces nonfermentans, Kluyveromyces wickerhamii, Kluyveromyces thermotolerans, Kluyveromyces fragilis, Kluyveromyces hubeiensis, Kluyveromyces polysporus, Kluyveromyces siamensis, Kluyveromyces yarrowii, or a combination thereof; preferably, the yeast cell is a Kluyveromyces cell, more preferably a Kluyveromyces lactis cell.

[0027] The fifth aspect of the present invention provides a cell-free reaction system, which contains the nucleic acid construct described in the first aspect of the present invention, or the recombinant protein described in the second aspect of the present invention, or the vector described in the third aspect of the present invention, or contains a cell extract, and the cell extract is derived from the genetically engineered strain described in the third aspect of the present invention.

[0028] The sixth aspect of the present invention provides a kit, characterized in that the kit contains the cell-free reaction system provided in the fifth aspect.

[0029] The seventh aspect of the present invention provides an application of the nucleic acid construct provided in the first aspect of the present invention, or the genetically engineered strain provided in the fourth aspect of the present invention, or the cell-free reaction system provided in the fifth aspect of the present invention, or the kit provided in the fifth aspect of the present invention in the synthesis of a target protein.

[0030] The seventh aspect of the present invention provides a method for in vitro synthesizing a target protein, including:

[0031] Step 1), providing the cell-free reaction system described in the fifth aspect of the present invention or the kit provided in the sixth aspect of the present invention;

[0032] Step 2), adding a DNA molecule encoding the target protein to the reaction system or kit in Step 1) to synthesize the target protein. Brief Description of the Drawings

[0033] Figure 1 Analysis of the conserved domain of the amino acid sequence of the endogenous flocculation gene of K. lactis Y1140. It shows that only KLLA0_D00264g and KLLA0_A11935g have relatively complete N-terminal and C-terminal structures, and have more than 10 repeat domains near the C-terminal. Therefore, these two genes were selected for promoter replacement in the follow-up.

[0034] Figure 2 Primer design scheme for the method of promoter replacement of the endogenous flocculation gene mediated by CRISPR-Cas9. Taking the promoter replacement of KlFLO9 as an example, the gRNA was designed in the original promoter region of KlFLO9. Primers were designed at both ends of it, and the overlap PCR method was used to assemble the HR1 (corresponding to primers P1+P2), HR2 (corresponding to primers P5+P6) and the middle promoter (corresponding to primers P3+P4) regions. Nested PCR primers (P7+P8) were designed to improve the specificity of the PCR reaction.

[0035] Figure 3 Design scheme for the integration of exogenous flocculation genes. In the genome of K. lactis Y1140, there is a relatively long (>3000bp) intergenic region in the middle of the ORFs of the KLLA0_A05324g and KLLA0_A05346g genes, where exogenous flocculation genes can be inserted. Among them, H1 and H2 are the positions corresponding to the homologous arm sequences of the designed integration donor, and the gRNA is designed in the non-coding sequence between H1 and H2. The FLX gene expression cassette of the successfully mutated strain will replace the sequence between H1 and H2, thus realizing the integration of exogenous genes into the genome.

[0036] Figure 4 Observation results of the flocculation traits of the mutant strains with promoter replacement of the endogenous flocculation gene. Among them, control is the control strain, which is the strain without modification of the flocculation gene.

[0037] Figure 5 IVTT activity of the mutant strains with promoter replacement of the endogenous flocculation gene at different time periods. Among them, control is the control strain, which is the strain without modification of the flocculation gene.

[0038] Figure 6 Mutant strains with modified flocculation genes and their control strains cultured in shake flasks. Among them, the control strain control strain is the strain without modification of the flocculation gene.

[0039] Figure 7IVTT activities of cell extracts prepared from mutant strains with modified flocculation genes and their control strains over different time periods. Here, control refers to the control strain, which is a strain without modification of the flocculation gene. Detailed implementation manners

[0040] It should be noted that, without conflict, the embodiments and features in the embodiments of this application can be combined with each other.

[0041] The present invention will be further described below in combination with the detailed implementation manners and embodiments. It should be understood that these embodiments are only used to illustrate the present invention and not to limit the scope of the present invention. For the experimental methods without specific conditions indicated in the following embodiments, the conditions guided by the detailed implementation manners described above shall be preferentially followed, and then the conventional conditions can be followed, or the conditions recommended by the manufacturer can be followed.

[0042] Unless otherwise stated, the percentages and parts mentioned in the present invention are weight percentages and weight parts.

[0043] Unless otherwise specified, the materials and reagents used in the embodiments of the present invention are all commercially available products.

[0044] Unless otherwise specified, the temperature unit in this application is degree Celsius (°C).

[0045] Nouns and terms

[0046] The following are the explanations or descriptions of the meanings of some relevant "nouns" and "terms" adopted in the present invention, so as to better understand the present invention. The corresponding explanations or descriptions apply to the whole text of the present invention, both to the following text and to the above text. When the present invention involves the citation of documents, the definitions of relevant terms, nouns, and phrases in the cited documents are also cited. However, when there is a conflict with the definitions in the present invention, the definitions in the present invention shall prevail. When there is a conflict between the definitions in the cited documents and the definitions in the present invention, it does not affect the components, substances, compositions, materials, systems, formulations, types, methods, equipment, etc. determined in the cited documents.

[0047] In the present invention, the preferred implementation manners such as "preferred", "more preferred", "even more preferred", "even better", "most preferred", "further preferred", etc. do not constitute any limitation on the scope of coverage and protection scope of the invention, and are not used to limit the scope and implementation manners of the present invention, but only to provide some implementation manners as examples.

[0048] In the description of the present invention, for preferred manners such as "one of the preferred", "one of the preferred manners", "one of the preferred embodiments", "one of the preferred examples", "preferred example", "in a preferred embodiment", "in some preferred examples", "in some preferred manners", "preferably", "preferred", "preferably", "more preferably", "more preferably", "further preferably", "most preferably", etc., and illustrative listing manners such as "one of the embodiments", "one of the manners", "example", "specific example", "for example", "as an example", "for example", "such as", "like", etc., they do not constitute any limitation on the scope of coverage and the scope of protection of the invention in any sense, and the specific features described by each manner are included in at least one specific embodiment of the present invention. In the present invention, the specific features described by each manner can be combined in a suitable manner in any one or more specific embodiments. In the present invention, the technical features or technical solutions corresponding to each preferred manner can also be combined in any suitable manner.

[0049] In the present invention, "any combination thereof" means, in terms of quantity, "greater than 1", and in terms of the scope of coverage, it means a group composed of the following situations: "optionally any one, or a group composed of optionally at least two".

[0050] In the present invention, descriptions such as "one or more", "one or more kinds", etc. of "one or more" have the same meaning as "at least one", "at least one kind", "its combination", "or its combination", "and its combination", "or any combination thereof", "and any combination thereof", etc., and can be used interchangeably, indicating a quantity equal to "1" or "greater than 1".

[0051] In the present invention, the use of "or / and", "and / or" means "optionally one or optionally its combination", and also means at least one.

[0052] The term "about" can refer to a value or a composition within an acceptable error range determined by a person of ordinary skill in the art for a specific value or composition, which will depend in part on how the value or composition is measured or determined. For example, as used herein, the expression "about 100" includes all values between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0053] Sequence identity (or homology) is determined by comparing two aligned sequences along a predetermined comparison window (which can be 50%, 60%, 70%, 80%, 90%, 95% or 100% of the length of the reference nucleotide sequence or protein), and determining the number of positions where identical residues occur. Generally, this is expressed as a percentage. Methods for measuring the sequence identity of nucleotide sequences are well known to those skilled in the art.

[0054] The prior art means described in the present invention in terms of "usually", "conventionally", "generally", "frequently", "often", etc. are also cited as references for the content of the present invention. Without special instructions, they can be regarded as one of the preferred ways of some technical features of the present invention. It should be noted that they do not constitute any limitation to the scope of coverage and protection scope of the invention.

[0055] All the documents mentioned in the present invention and the documents directly or indirectly cited by these documents are cited as references in this application as if each document is cited separately as a reference.

[0056] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (including but not limited to the embodiments) can be combined with each other to form new or preferred technical solutions as long as they can be used to implement the present invention. Due to space limitations, they will not be repeated one by one.

[0057] In vitro protein synthesis reaction refers to the reaction of synthesizing proteins in a cell-free synthesis system in vitro, which at least includes the translation process. It includes but is not limited to IVT reaction (in vitro translation reaction), IVTT reaction (in vitro transcription-translation reaction), and IVDTT reaction (in vitro replication-transcription-translation reaction). In the present invention, the IVTT reaction is preferred. The IVTT reaction corresponds to the IVTT system and is a process of transcribing and translating DNA into protein (Protein) in vitro. Therefore, we also refer to such an in vitro protein synthesis system as a D2P system, D-to-P system, D_to_P system, or DNA-to-Protein system; the corresponding in vitro protein synthesis method is also called a D2P method, D-to-P method, D_to_P method, or DNA-to-Protein method.

[0058] "Cell-free system" means that when performing in vitro protein synthesis, it is not through the way of secretion and expression by intact cells. It should be noted that in the in vitro cell-free protein synthesis system of the present invention, it is also allowed to add cell components to promote the reaction, but the added cells do not mainly aim at secreting and expressing exogenous target proteins. In addition, in the D2P system without intact cells constructed under the guidance of the present invention, a small amount of intact cells are intentionally added (for example, the protein content provided by them does not exceed 30 wt% compared with the protein content provided by the cell extract). Such an "evasion" method is also included in the protection scope of the present invention.

[0059] Objective protein: The target expression product of the in vitro protein synthesis system of the present invention is not secreted and synthesized by host cells, but is synthesized in vitro based on an exogenous nucleic acid template, and can also be referred to as an exogenous protein. The exogenous protein can be a protein, a fusion protein, a mixture containing protein molecules or fusion protein molecules; it also broadly includes polypeptides. The product obtained after an in vitro protein synthesis reaction based on a nucleic acid template encoding the target protein can be a single substance or a combination of two or more substances. "Exogenous protein", "objective protein", "target protein", "target translation product" have the same meaning and can be translated as "objective protein", "interested protein", "objective translated product", "interested protein product", etc., and can be used interchangeably in the present invention.

[0060] D2P, DNA-to-Protein, from DNA template to protein product. For example, D2P technology, D2P system, D2P method, D2P kit, etc.

[0061] "The expression system of the present invention", "the in vitro expression system of the present invention", "cell-free in vitro expression system", "cell-free in vitro expression system" can be used interchangeably, and all refer to the in vitro protein expression system of the present invention. Other description methods can also be used, such as: in vitro protein synthesis system, in vitro protein synthesis system, cell-free system, cell-free system, cell-free protein synthesis system, cell-free in vitro protein synthesis system, in vitro cell-free protein synthesis system, in vitro cell-free synthesis system, CFS system (cell-free system), CFPS system (cell-free protein synthesis system), etc. According to the reaction mechanism, it can include an in vitro translation system (which can be abbreviated as the IVT system, a type of mR2P system), an in vitro transcription and translation system (which can be abbreviated as the IVTT system, a type of D2P system), an in vitro replication, transcription and translation system (which can be abbreviated as the IVDTT system, a type of D2P system), etc. In the present invention, the IVTT system is preferred. We also refer to the in vitro protein synthesis system as the "Protein Factory" ("Protein Factory" or "proteinfactory" or "Proteinfactory"). The in vitro protein synthesis system provided by the present invention describes its components in an open manner. The cell-free protein synthesis system of the present invention uses exogenous DNA, mRNA or a combination thereof as the nucleic acid template for protein synthesis, and realizes the in vitro synthesis of the target protein by artificially controlling the addition of substrates required for protein synthesis and protein factors related to transcription and translation.

[0062] In the present invention, "protein" and "proteins" have the same meaning and are both translated as "protein", and can be used interchangeably.

[0063] In the present invention, "system" and "system of systems" are both translated as "system" and can be used interchangeably.

[0064] In the present invention, "protein synthesis amount", "protein expression amount" and "protein expression yield" have the same meaning and can be used interchangeably.

[0065] In the present invention, cell extract, cell extraction solution, cell lysate, cell debris, and cell lysis products have the same meaning and can be used interchangeably. English descriptions such as "cell extract" and "cell lysate" can be used.

[0066] In the present invention, energy system, energy supply system, and energy supply system have the same meaning and can be used interchangeably. The energy regeneration system and the energy regeneration system have the same meaning and can be used interchangeably. The energy regeneration system is a preferred embodiment or component of the energy system.

[0067] Furthermore, the present invention provides a cell-free protein synthesis system, which at least includes a cell extract or a cell lysate.

[0068] More preferably, the cell-free protein synthesis system further includes one or more components selected from the following groups: substrates for synthesizing RNA, substrates for synthesizing proteins, polyethylene glycol or its analogs, magnesium ions, potassium ions, buffers, RNA polymerase, an energy regeneration system, dithiothreitol, and an optional aqueous solvent.

[0069] More preferably, the substrates for synthesizing RNA include: one of nucleoside monophosphates, nucleoside triphosphates, or a combination thereof.

[0070] More preferably, the substrates for synthesizing proteins include: 20 natural amino acids and non-natural amino acids.

[0071] More preferably, the magnesium ions are derived from a magnesium ion source, and the magnesium ion source is selected from the following groups: one of magnesium acetate, magnesium glutamate, or a combination thereof.

[0072] More preferably, the potassium ions are derived from a potassium ion source, and the potassium ion source is selected from the following groups: one of potassium acetate, potassium glutamate, or a combination thereof.

[0073] More preferably, the energy regeneration system is selected from the following groups: one of the phosphocreatine / phosphocreatine kinase system, the glycolysis pathway, and the intermediate product energy system of the glycolysis pathway, or a combination thereof.

[0074] Further preferably, the energy regeneration system comprises a glucose / phosphate system, and the phosphate is selected from the group consisting of potassium phosphate tribasic, ammonium phosphate tribasic, sodium phosphate tribasic, dipotassium hydrogen phosphate, diammonium hydrogen phosphate, disodium hydrogen phosphate, potassium dihydrogen phosphate, ammonium dihydrogen phosphate, sodium dihydrogen phosphate, or a combination thereof.

[0075] Further preferably, the buffer is selected from the group consisting of 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid, tris(hydroxymethyl)aminomethane, or a combination thereof.

[0076] Further preferably, the in vitro protein synthesis system contains polyethylene glycol (PEG) or an analogue thereof. The concentration of polyethylene glycol or an analogue thereof is not particularly limited. Generally, the concentration (w / v) of polyethylene glycol or an analogue thereof is 0.1-8%, preferably 0.5-4%, more preferably 1-2%, based on the total weight of the protein synthesis system. Representative PEGs are selected from the group consisting of PEG3000, PEG3350, PEG6000, PEG8000, or a combination thereof.

[0077] Further preferably, the polyethylene glycol includes polyethylene glycol with a molecular weight (Da) of 200-10000, such as PEG200, 400, 1500, 2000, 4000, 6000, 8000, 10000, etc., preferably polyethylene glycol with a molecular weight of 3000-10000.

[0078] In the present invention, the RNA polymerase is not particularly limited and can be selected from one or more RNA polymerases. A typical RNA polymerase is T7 RNA polymerase.

[0079] An alternative embodiment is that the in vitro protein synthesis system provided by the present invention includes: cell extract, 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid, potassium acetate, magnesium acetate, adenosine triphosphate (ATP), guanosine triphosphate (GTP), cytidine triphosphate (CTP), thymidine triphosphate (TTP), amino acid mixture, creatine phosphate, dithiothreitol (DTT), creatine phosphokinase, RNA polymerase.

[0080] In the present invention, the cell extract does not contain intact cells. Typical cell extracts include ribosomes for protein translation, aminoacyl-tRNA synthetases, initiation factors and elongation factors required for protein synthesis, and termination release factors. In addition, the cell extract also contains some other proteins derived from the cytoplasm of the cells, especially soluble proteins.

[0081] In the present invention, the proportion of the cell extract in the in vitro cell-free protein synthesis system is not particularly limited. Generally, the proportion of the cell extract in the in vitro cell-free protein synthesis system is 20-70%, preferably 30-60%, more preferably 40-50%.

[0082] In the present invention, the protein content of the cell extract is 20-100 mg / mL, preferably 50-100 mg / mL. The method for measuring the protein content is the Coomassie Brilliant Blue assay method.

[0083] The present invention also provides a vector or a combination of vectors, wherein the vector contains the nucleic acid construct of the present invention. Preferably, the vector is selected from: bacterial plasmids, phages, yeast plasmids, animal cell vectors, shuttle vectors; the vector is a transposon vector. The methods for preparing recombinant vectors are well known to those of ordinary skill in the art. Any plasmid and vector can be used as long as it can replicate and be stable in the host.

[0084] Those of ordinary skill in the art can use well-known methods to construct an expression vector containing the promoter and / or the target gene sequence of the present invention. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc.

[0085] template DNA

[0086] The template DNA is a nucleotide sequence encoding any target protein to be synthesized, which can be an original sequence, an artificially synthesized sequence or an artificially modified sequence. Using this template DNA, the corresponding RNA and / or protein can be synthesized.

[0087] In the present invention, the method for preparing the cell extract is not limited. A preferred preparation method

[0088] comprises the following steps:

[0089] (i) Providing cells;

[0090] (ii) Washing the cells to obtain washed cells;

[0091] (iii) Breaking the washed cells to obtain a crude cell extract;

[0092] (iv) Separating the solid and liquid of the crude cell extract to obtain the liquid part, which is the cell extract.

[0093] In the present invention, the solid-liquid separation method is not particularly limited. A preferred method is centrifugation.

[0094] In a preferred embodiment, the centrifugation is carried out in a liquid state.

[0095] In the present invention, the centrifugation conditions are not particularly limited. A preferred centrifugation condition is 5000-100000 g, preferably 8000-30000 g.

[0096] In the present invention, the centrifugation time is not particularly limited. A preferred centrifugation time is 0.5 min - 2 h, and preferably, 20 min - 50 min.

[0097] In the present invention, the temperature of the centrifugation is not particularly limited. Preferably, the centrifugation is carried out at 1 - 10 °C, and preferably, at 2 - 6 °C.

[0098] In the present invention, the washing treatment method is not particularly limited. A preferred washing treatment method is to carry out the treatment with a washing solution at a pH of 7 - 8 (preferably, 7.4). The washing solution is not particularly limited. Typically, the washing solution is selected from the group consisting of potassium 4-(2-hydroxyethyl)-1-piperazineethanesulfonate, potassium acetate, magnesium acetate, or a combination thereof.

[0099] In the present invention, the method of cell disruption treatment is not particularly limited. A preferred method of cell disruption treatment includes high-pressure disruption, freeze-thaw (such as liquid nitrogen cryogenic) disruption.

[0100] The nucleoside triphosphate mixture in the in vitro cell-free protein synthesis system is adenosine triphosphate, guanosine triphosphate, cytidine triphosphate, and uridine triphosphate. In the present invention, the concentration of each mononucleotide is not particularly limited. Generally, the concentration of each mononucleotide is 0.5 - 5 mM, and preferably 1.0 - 2.0 mM.

[0101] The amino acid mixture in the in vitro cell-free protein synthesis system may include natural or unnatural amino acids, and may include D-type or L-type amino acids. Representative amino acids include (but are not limited to) 20 natural amino acids: glycine, alanine, valine, leucine, isoleucine, phenylalanine, proline, tryptophan, serine, tyrosine, cysteine, methionine, asparagine, glutamine, threonine, aspartic acid, glutamic acid, lysine, arginine, and histidine. The concentration of each amino acid is generally 0.01 - 0.5 mM, and preferably 0.02 - 0.2 mM, such as 0.05, 0.06, 0.07, 0.08 mM.

[0102] In a preferred embodiment, the cell-free protein synthesis system further contains polyethylene glycol or its analog. The concentration of polyethylene glycol or its analog is not particularly limited. Generally, the concentration (w / v) of polyethylene glycol or its analog is 0.1-8%, preferably 0.5-4%, more preferably 1-2%, based on the total weight of the biosynthesis system. Representative examples of PEG include (but are not limited to): PEG3000, PEG8000, PEG6000, and PEG3350. It should be understood that the system of the present invention may also include polyethylene glycols of various other molecular weights (such as PEG200, 400, 1500, 2000, 4000, 6000, 8000, 10000, etc.).

[0103] In a preferred embodiment, the cell-free protein synthesis system further contains sucrose. The concentration of sucrose is not particularly limited. Generally, the concentration of sucrose is 0.03-40 wt%, preferably 0.08-10 wt%, more preferably 0.1-5 wt%, based on the total weight of the protein synthesis system.

[0104] A particularly preferred cell-free protein synthesis system, in addition to yeast cell extract, further contains the following components: 22 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid at pH 7.4, 30-150 mM potassium acetate, 1.0-5.0 mM magnesium acetate, 1.5-4 mM nucleoside triphosphate mixture, 0.08-0.24 mM amino acid mixture, 25 mM phosphocreatine, 1.7 mM dithiothreitol, 0.27 mg / mL creatine phosphokinase, 1%-4% polyethylene glycol, 0.5%-2% sucrose, 0.027-0.054 mg / mL T7 RNA polymerase.

[0105] The present invention will be further illustrated below in conjunction with specific examples. It should be understood that these examples are only for illustrating the present invention.

[0106] They are not intended to limit the scope of the present invention. The experimental methods without specific conditions noted in the following examples are generally carried out under conventional conditions, such as those described in Sam brook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise specified, percentages and parts are weight percentages and weight parts. The present invention uses Kluyveromyces lactis (abbreviated as K. lactis or kl) as an example, but the same design, analysis, and experimental methods are also applicable to other eukaryotic cells such as other yeasts and animal cells, as well as prokaryotic cells.

[0107] The present invention takes Kluyveromyces lactis (K. lactis) as an example, but the same design, analysis, and experimental methods are also applicable to other lower eukaryotic cells such as yeast and higher animal cells. The gene modification method in the present invention is the CRISPR-Cas9 technology, but it is not limited thereto and can be any known and existing gene modification method.

[0108] An in vitro protein synthesis reaction mixture system, also described as an in vitro protein synthesis reaction mixture, reaction mixture system, or reaction mixture, refers to a mixture system including an in vitro protein synthesis system and a nucleic acid template encoding a target protein; it can be homogeneous or heterogeneous and is allowed to be a liquid system such as a solution, emulsion, suspension, etc.

[0109] The final concentrations of the components in the Protein Factory described in the present invention are as follows: 80% (v / v) Kluyveromyces lactis extract, 15 mM glucose, 320 mM maltodextrin (molar concentration measured in glucose monomers), 24 mM tripotassium phosphate, 1.8 mM nucleoside triphosphate mixture (a mixture of adenosine triphosphate, guanosine triphosphate, cytidine triphosphate, and uridine triphosphate, with a final concentration of 1.8 mM for each nucleoside triphosphate), 0.7 mM amino acid mixture (glycine, alanine, valine, leucine, isoleucine, phenylalanine, proline, tryptophan, serine, tyrosine, cysteine, methionine, asparagine, glutamine, threonine, aspartic acid, glutamic acid, lysine, arginine, and histidine, with a final concentration of 0.7 mM for each amino acid), magnesium L-aspartate, 80 mM potassium acetate, 2% (w / v) polyethylene glycol 8000, 9.78 mM Tris·HCl buffer at pH 8.0, 6% (w / v) trehalose. Among them, the Kluyveromyces lactis extract includes endogenously expressed T7 RNA polymerase. The preparation process of the Kluyveromyces lactis cell extract adopts conventional technical means and is prepared with reference to the method described in CN109593656A. Generally speaking, the preparation steps include: providing an appropriate amount of raw materials of fermented and cultured Kluyveromyces lactis cells, quickly freezing the cells with liquid nitrogen, breaking the cells, and centrifuging to collect the supernatant, thus obtaining the cell extract. The protein concentration in the obtained Kluyveromyces lactis cell extract is 20 - 40 mg / mL.

[0110] Through CRISPR-Cas9-mediated gene editing means, the present invention replaces the promoters of several predicted flocculation genes in a Kluyveromyces lactis strain and expresses exogenous flocculation genes, obtaining a series of Kluyveromyces lactis strains with different flocculation abilities. These strains can all be used for cell-free protein synthesis.

[0111] The flocculation trait of yeast is controlled by the expression of a series of flocculation proteins. All flocculation proteins have obvious conserved structural features. Their N-terminals are conserved structures that can be highly mannosylated, while their C-terminals can anchor the protein to the cell membrane by forming a chemical bond with GPI, and there are multiple repeat structures near the C-terminus. The N-terminal glycosylation level of flocculation proteins and the number of repeat structures near the C-terminus are both related to the strength of strain flocculation. In the model fungus Saccharomyces cerevisiae, there are several major flocculation protein-encoding genes such as FLO1, FLO5, FLO9, FLO10, and FLO11. Among them, the expression intensity of FLO1 plays a dominant role in controlling the flocculation shape.

[0112] Gene sequence alignment showed that several putative endogenous flocculation protein-encoding genes were found in the genome of K. lactis Y1140, and their gene numbers were KLLA0_D00264g, KLLA0_A11935g, KLLA0_E14543g, KLLA0_D00275g, KLLA0_E25147g, KLLA0_B00308g, and KLLA0_B14916g, respectively. These genes are all located in the region near the telomere of the chromosome and their expression levels are all relatively low. Therefore, it is speculated that the low expression levels of these genes are the main reasons why the wild-type K. lactis Y1140 strain does not show flocculation traits.

[0113] The active substances for D2P mainly come from the extracts of yeast cells. Therefore, culturing and collecting yeast cells are indispensable steps in the preparation process of D2P active substances. However, free yeast cells usually need to be rapidly collected through a high-energy-consuming centrifugation step. Yeast cells that can form flocculation particles can greatly reduce the energy consumption for separating yeast cells from the fermentation broth after fermentation. Based on the existing platform technology, on the one hand, it can be attempted to improve the expression levels of these genes by replacing the original promoters of individual flocculation genes with strong promoters, so that the strain can obtain flocculation shapes. On the other hand, the strain can also be made to obtain flocculation traits by expressing exogenous active proteins in the genome of Kluyveromyces lactis.

[0114] By performing a conserved domain analysis on the amino acid sequences of the proteins encoded by the flocculation genes in the genome of K. lactis Y1140 (see Figure 1 ), it is speculated that only KLLA0_D00264g and KLLA0_A11935g may have flocculation activity. Therefore, the promoters of these two genes were selected for replacement.

[0115] The relevant sequence names and sequence information involved in the present invention are shown in Tables 1 to 4 below.

[0116] Table 1 Gene List

[0117] Gene ID Gene description KLLA0_D00264g Shows similarity to Saccharomyces cerevisiae FLO9 KLLA0_A11935g Shows similarity to Saccharomyces cerevisiae FLO1 KLLA0_E14543g Shows similarity to Saccharomyces cerevisiae FLO5 KLLA0_D00275g Shows similarity to Saccharomyces cerevisiae FLO9 KLLA0_E25147g Shows similarity to Saccharomyces cerevisiae FLO9 KLLA0_B00308g Shows similarity to Saccharomyces cerevisiae FLO1 KLLA0_B14916g Shows similarity to Saccharomyces cerevisiae FLO5

[0118] Table 2 gRNA List

[0119] gRNAs Sequence number Sequence PAM KlFLO1 - gRNA SEQ ID NO:1 acggtcacagacctattaga cgg KlFLO9 - gRNA SEQ ID NO:2 atacctgaaattacaagttg ggg UTR - A5 gRNA1 SEQ ID NO:3 tggagtctcatcgaaggaca tgg UTR - A5 gRNA2 SEQ ID NO:4 cagcgctggactgtatccaa cgg UTR - A5 gRNA3 SEQ ID NO:5 aagtcactccgtatattatg cgg

[0120] Table 3 Primer List

[0121]

[0122]

[0123] Table 4 Other Sequence List

[0124]

[0125]

[0126]

[0127]

[0128]

[0129]

[0130]

[0131]

[0132]

[0133]

[0134]

[0135]

[0136]

[0137]

[0138]

[0139] Example 1: Design of gRNA Target Sequences

[0140] Select the ORF region (100 - 2000 bp) of the gene to be designed with gRNA targeting, complete the design of gRNA on the CRISPOR (tefor.net) (http: / / crispor.tefor.net / ) website, and select the gRNAs with higher scores as alternative sequences. For each selected gene, the present invention selects 2 sequences with the highest comprehensive scores as the final gRNA sequences, and the specific information is shown in Table 2. According to the designed gRNA targeting sequences, synthesize the corresponding 24-base primer pairs, that is, add 4-base sequences of AATC and AAAC to the 5'-ends of the forward sequence and the reverse complementary sequence of each gRNA respectively. The finally obtained pair of 24-base primers constitutes a 24-base primer pair.

[0141] Example 2: Construction of gRNA_Cas9 expression vector

[0142] Dilute the paired 24-base primer pairs to 10 μM respectively. Take 10 μL of each and add them to a PCR tube and mix. Then complete the annealing process on a PCR instrument according to the following program: 95°C, 3 min; 72°C, 2 min; 65°C, 2 min; 60°C, 2 min; 55°C, 2 min; 50°C, 2 min; 16°C, 2 min. Take 0.5 μL of the annealed primer pairs and 20 ng of the pCasMFR vector digested with BsaI and purified (see Patent 2022115286538 or CN2023116023642 for details), mix them in a 10 μL T4 ligase system, and carry out a ligation reaction at 16°C for 1 h. Transform all the ligation products into Escherichia coli DH5α competent cells, and screen them on an LB plate containing 50 μg / mL kanamycin. Randomly select 2 single colonies for sequencing verification, and select the clones with correct sequencing, extract the gRNA_Cas9 co-expression plasmid and determine the concentration for subsequent electroporation experiments.

[0143] Example 3: Construction of double-stranded DNA donor

[0144] The DNA donor sequences used in the present invention are obtained by PCR method.

[0145] 1. Promoter replacement of endogenous flocculation genes KlFLO1 and KlFLO9, with 8 primers designed respectively. First, using the genomic DNA of K. lactis Y1140 strain as a template, PCR amplification was carried out with xxxN-p1 + xxxN-p2 and xxxN-p5 + xxxN-p6 as forward and reverse primers (xxxN is the corresponding gene name in Table 3) using Phanta Super Fidelity DNA polymerase to obtain PCR products HR1 and HR2; using the genomic DNA of S. cerevisiae S288c strain as a template, PCR amplification was carried out with xxxN-p3 + xxxN-p4 as the forward and reverse primer pair to obtain the PCR product for promoter replacement; then, using xxxN-p7 + xxxN-p8 as forward and reverse primers, and the PCR products HR1, HR2 and the PCR product for promoter replacement from the previous step as templates, a second round of PCR was carried out. The product of the second round of PCR was precipitated with 70% ethanol and dissolved in 50 μL ddH 2 O and stored at -20 °C for later use.

[0146] 2. Integrate the donor of the exogenous flocculation gene. Using a plasmid with an assembled synthetic gene expression cassette (including upstream and downstream homologous fragments A5-H1 and A5-H2, FLX (modified ScFLO1 gene), and promoter and terminator, specific information and sequences are shown in Tables 3-4) as a template, PCR amplification was carried out with FLX-p1 + FLX-p1 as the primer pair using Phanta Super Fidelity DNA polymerase to obtain a PCR product. The PCR product was precipitated with 70% ethanol and dissolved in 50 μL ddH 2 O and stored at -20 °C for later use.

[0147] Example 4: Transformation and screening of yeast strains

[0148] The transformation of Kluyveromyces lactis strains was completed by the electrotransformation method. According to the requirements of the electrotransformation method, competent cells were prepared using K. lactis Y1140 as the starting strain. Before electroporation, 40 μL of the competent cell mixture was fully mixed with the corresponding 500 ng gRNA_Cas9 expression plasmid and 1-2 μg DNA Donor, and the electrotransformation process was completed according to the standard operation procedure. The electrotransformed yeast cells were screened on YPD plates containing 250 μg / mL G418. Single colonies were picked for PCR verification, and the positive PCR products were sent to a sequencing company for sequencing; the single colonies with correct sequencing were streaked on plates, and single colonies were picked for a second round of PCR verification. Only the strains with correct verification in both rounds were prepared into glycerol cryotubes and stored in an -80 °C refrigerator.

[0149] Example 5: Comparison of flocculation shapes of different yeast strains

[0150] 1. According to the methods of Examples 3-4, replace the promoter of the endogenous flocculation gene KlFLO1 or KlFLO9 with the ScTEF1 promoter. After obtaining the modified strains, observe the sedimentation phenomenon of the strains. As Figure 4 described, it can be seen that after replacing the promoter of KlFLO9 with the ScTEF1 promoter, significant sedimentation phenomenon can be seen in the bacterial liquid after standing for 2 h, while obvious sedimentation phenomenon is not observed in the culture solution of the control strain. It shows that replacing the KlFLO9 promoter endows the strain with flocculation traits.

[0151] 2. According to the methods of Examples 3-4, the strains were modified to obtain several strains including TXL117 strain (ScENO2p-FLX, promoter is ScENO2), TXL145 strain (ScHSP26p-FLX, promoter is ScHSP26), TXL144 strain (ScADH2p-FLX, promoter is ScADH2), TXL146 (ScTPS1p-FLX, promoter is ScTPS1), and TXL147 strain (ScSPG4p-FLX, promoter is ScSPG4). The difference among these strains lies in the different promoters.

[0152] Figure 6 They are the mutant strains cultured in shake flasks and their control strains. It can be seen that by expressing the exogenous flocculation protein in Example 3, the strains obtained different strengths of flocculation traits. According to the size of the flocculation particles formed by the strains from large to small, it is TXL117>TXL145>TXL144>TXL146>TXL147>control. It can be seen that the strength of the flocculation traits of the mutant strains is related to the promoters used. The strain using the constitutive strong promoter (ScENO2p, TXL117) to control the expression of the exogenous flocculation protein obtained the strongest flocculation traits. During the shake flask culture process, it can be seen that yeast cells form flocculation particles on the millimeter scale. Only by standing for 20 s, the yeast cells forming flocculation particles can settle to the bottom of the flask, and the supernatant is almost completely clear. The strain using the inducible ScHSP26 promoter (TXL145) also obtained strong flocculation traits, but the flocculation particles formed by yeast cells are slightly smaller than those of TXL117. Standing for about 1 min, the yeast cells forming flocculation particles can settle to the bottom of the flask, but the supernatant is slightly turbid. While for TXL144, TXL146 and TXL147, it takes more than 10 min to show obvious cells. Therefore, for yeast strains with strong flocculation ability, most cells can be collected only by standing for a period of time, which can greatly reduce the energy consumption during cell collection.

[0153] Example 6: Preparation of lysate and detection of IVTT activity

[0154] The single colonies were picked after streaking the strain to be tested cryopreserved in an -80 °C refrigerator on a YPD plate and inoculated into a 250 mL Erlenmeyer flask containing 100 mL of seed medium, and cultured with shaking at 30 °C and 200 rpm for 24 h; an aliquot of the seed culture was transferred to a 1000 mL Erlenmeyer flask containing 400 mL of fermentation medium, and cultured with shaking at 30 °C and 200 rpm until the harvest period. The cells were collected by high-speed centrifugation, and cell lysates were prepared under liquid nitrogen protection for subsequent IVTT activity testing. A certain amount of the lysate prepared according to the standard procedure was taken, and the D2P expression activity of the lysate was detected and analyzed using mEGFP as the reporter protein according to the operating procedure, and the IVTT activity of the corresponding lysate was judged based on the detected reporter fluorescence intensity (RFU value).

[0155] It can be seen from Figure 5 that replacing the promoter of the flocculation gene had no significant effect on the IVTT activity. It can be seen from Figure 7 that the cell extracts prepared from the mutant strain TXL144 maintained similar IVTT activity to the control strain, while the IVTT activities of the cell extracts prepared from TXL117, TXL145, TXL146, and TXL147 were slightly lower than that of the control strain.

[0156] That is, the strain modified by the present invention can greatly shorten the time for collecting cells and effectively reduce the energy consumption during cell collection while keeping the overall IVTT activity of the cells almost unchanged.

[0157] Inspired by the ideal embodiments of the present application described above, through the above description, relevant staff can make various changes and modifications completely within the scope not deviating from the technical idea of this application. The technical scope of this application is not limited to the content in the specification, and its technical scope must be determined according to the scope of the claims.

Claims

1. A nucleic acid construct, characterized in that: the nucleic acid construct contains at least a nucleic acid sequence having a structure as shown in formula I: Z1-Z2 (I), wherein Z1 and Z2 are elements for constructing the construct respectively; "-" is independently a bond or a nucleotide linking sequence; Z1 is a promoter sequence, and Z2 is a gene sequence encoding a flocculating protein.

2. The nucleic acid construct according to claim 1, characterized in that: the gene encoding the flocculating protein is selected from the FLO gene.

3. The nucleic acid construct according to claim 1 or 2, characterized in that: the amino acid sequence of the flocculating protein is any one of SEQ ID NO: 37 to SEQ ID NO: 43, or has a consistency of ≥ 80%, ≥ 85%, ≥ 90%, ≥ 95%, ≥ 97% or ≥ 99% with any one of SEQ ID NO: 37 to SEQ ID NO:

43.

4. The nucleic acid construct according to any one of claims 1-3, characterized in that: the sequence of the gene encoding the flocculating protein is SEQ ID NO: 35; or the gene encoding the flocculating protein is a nucleotide having a homology of ≥ 85% (preferably, ≥ 90% homology; more preferably ≥ 95% homology; most preferably, ≥ 97% homology, such as above 98%, above 99%) with the nucleotide sequence shown in SEQ ID NO: 35 and having the same activity as the SEQ ID NO: 35 sequence.

5. The nucleic acid construct according to any one of claims 1-4, characterized in that: the strong promoter is selected from one or more of TEF1, ENO2, HSP26, SPG4, TPS1 or ADH2.

6. The nucleic acid construct according to any one of claims 1-5, characterized in that: the nucleic acid construct further comprises a terminator; preferably, the terminator is PRM9.

7. A recombinant protein, characterized in that: it is encoded by the nucleic acid construct according to any one of claims 1-6.

8. A vector, characterized in that: the vector contains the nucleic acid construct according to any one of claims 1-6.

9. A genetically engineered strain, characterized in that: one or more sites of the genome of the genetically engineered strain are integrated with the nucleic acid construct according to any one of claims 1-6, or the genetically engineered strain contains the vector according to claim 8.

10. The genetically engineered strain according to claim 9, characterized in that: the sequence of the site is SEQ ID NO: 26, or the flocculation gene is a nucleotide having a homology of ≥ 85% (preferably, ≥ 90% homology; more preferably ≥ 95% homology; most preferably, ≥ 97% homology, such as above 98%, above 99%) with the nucleotide sequence shown in SEQ ID NO: 26 and having the same activity as the SEQ ID NO: 26 sequence.

11. The genetically engineered strain according to claim 9 or 10, characterized in that: The strain described above is derived from one of bacteria, mammalian cells, human cells, plant cells, yeast cells, insect cells or any combination thereof; preferably yeast cells.

12. A cell-free reaction system, characterized in that: it comprises the nucleic acid construct according to any one of claims 1-5, or the recombinant protein according to claim 7, or the vector according to claim 8, or comprises a cell extract, and the cell extract is derived from the genetically engineered strain according to any one of claims 9-11.

13. A kit, characterized in that: the kit comprises the cell-free reaction system according to claim 12.

14. Use of the nucleic acid construct according to any one of claims 1-6, the genetically engineered strain according to any one of claims 9-11, the cell-free reaction system according to claim 12 or the kit according to claim 13 in the synthesis of a target protein.

15. A method for in vitro synthesizing a target protein, comprising; step 1), providing the reaction system according to claim 12 or the kit according to claim 13; step 2), adding a DNA molecule encoding the target protein to the reaction system or kit in step 1) to synthesize the target protein.

16. A method for collecting a genetically engineered strain, characterized in that it comprises the following steps: 1) culturing the genetically engineered strain according to any one of claims 9-11, 2) separating after standing still, and then the genetically engineered strain can be collected.

Images