Construction method and application of expression of antibacterial peptide in pichia pastoris

Abstract

The invention discloses a construction method and application of expression of antibacterial peptide in pichia pastoris, and relates to the technical field of genetic engineering. The construction method for expression of the antibacterial peptide in pichia pastoris and the application of the antibacterial peptide comprise the following specific construction steps that selected antibacterial peptide genes and a P.pastoris alpha signal peptide sequence are combined into a whole to construct a signal peptide-antibacterial peptide whole sequence, an amplification product band A and an amplification product band B are obtained, and finally a recombinant expression plasmid is obtained; and completely mixing the recombinant expression plasmid with P.pastoris recipient bacteria, and culturing until a recombinant yeast single colony appears. According to the invention, amplification products generated by taking a designed primer as a gene template are connected into a whole to obtain a more adaptive recombinant expression plasmid, which is convenient for subsequent expression of antibacterial peptide, so that the recombinant expression plasmid is finally mixed with P.pastoris recipient bacteria completely to obtain an antibacterial drug and a feed additive suitable for breeding litopenaeus vannamei, and the antibacterial drug and the feed additive are suitable for breeding litopenaeus vannamei. In the verification direction, the release of the yeast cell wall to the PCR reaction is promoted, and the release of the antibacterial peptide DNA is accelerated.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and specifically to a construction method and application of expressing an antibacterial peptide in Pichia pastoris. Background Art

[0002] Litopenaeus vannamei is native to the Pacific coast of the Americas and is one of the three most farmed shrimp species in the world. Because of its good antibacterial and antiviral properties, it was introduced into China in the 1990s and is currently the main shrimp farming variety in China. Since shrimp lack an adaptive immune system, preventive therapies (such as vaccines) used in species with stronger immune capabilities cannot be used to protect shrimp from certain infectious diseases. At the same time, as people's concerns about antibiotic resistance increase, the use of antibiotics to help animal health is increasingly restricted, including in the shrimp farming industry.

[0003] Regarding shrimp farming, an association was found between the use of Pichia pastoris in the shrimp diet and its beneficial effects on physiological parameters and production performance. The specific morphology and special structure of Pichia pastoris may be the reason for these positive results. Therefore, Pichia pastoris may be a natural and cost-effective new method for shrimp farming, which can reduce the impact of health challenges and improve the farming performance of shrimp.

[0004] However, when directly consuming Pichia pastoris, the improvement of the immune defense of shrimp is often limited by digestion and absorption. Thus, antibacterial peptides, which are considered to be one of the main components of the shrimp defense system, have important scientific significance and practical application value for solving problems such as bacterial drug resistance in marine aquaculture production and aquatic product drug residues and water environmental pollution caused by the abuse of antibiotics in fish feed.

[0005] Therefore, for the aquaculture of shrimp such as Litopenaeus vannamei, it is urgent for us to express antibacterial peptides in Pichia pastoris to address the increasingly serious bacterial drug resistance in aquaculture production and the abuse of antibiotics in fish feed, and further improve the expression level and antibacterial ability of antibacterial peptides, providing new ideas for protecting aquatic products from infectious diseases. Summary of the Invention

[0006] In view of the deficiencies of the prior art, the present invention provides a construction method and application of expressing an antibacterial peptide in Pichia pastoris, solving the problems raised in the above background art.

[0007] To achieve the above objectives, the present invention is realized through the following technical solutions. A construction method and application of expressing an antibacterial peptide in Pichia pastoris includes the following specific construction steps.

[0008] S1. Combine the selected antimicrobial peptide genes with the P. pastoris α signal peptide sequence respectively to construct a signal peptide-antimicrobial peptide whole sequence, synthesize it, and integrate the signal peptide-antimicrobial peptide sequence onto a yeast expression vector as the selected gene template;

[0009] Among them, the antimicrobial peptide genes are discovered in the culture of Litopenaeus vannamei. Antimicrobial peptides such as penaeidin-3, ALF, CrustinB, PEN-3, PEN-4, etc. can all be used as genes to improve the immune defense of shrimp. Genes that are not disclosed above but can still enhance the immune defense of Litopenaeus vannamei are still applicable to the technical solutions disclosed in this application;

[0010] S2. Design primers to amplify using the selected gene template, obtain an amplification product with a 412bp band. After recovering the amplification product, perform double digestion with AsuⅡ and EcoRⅠ and recover to obtain band A. Meanwhile, use AsuⅡ and EcoRⅠ to perform double digestion on the yeast expression vector to obtain a 4900bp band. Gel-recover this band as band B. Connect the obtained band A and band B together through DNA ligase for transformation, spread on a Kan-resistant plate, pick single colonies, and verify with double digestion using AsuⅡ and EcoRⅠ. After correct verification, perform sequencing verification to finally obtain the recombinant expression plasmid;

[0011] Among them, the yeast expression vector includes but is not limited to plasmids pUC57, pPIC3.5L, pPCIZ, ELM-PMPW, etc. In S2, in order to facilitate subsequent expression in Pichia pastoris, the yeast expression vector is verified to obtain the recombinant expression plasmid to be more suitable for the P. pastoris receptor strain. P. pastoris is the English noun expression of Pichia pastoris;

[0012] S3. Mix the recombinant expression plasmid completely with the P. pastoris receptor strain, transfer it to a pre-chilled 0.2 cm electroporation cuvette on ice, place it on ice for 5 min, apply an electric shock for 5 ms, spread on a zeocin-resistant plate after removing E. coli, and culture at 30 °C until recombinant yeast single colonies appear. Uniformly spread the obtained recombinant yeast single colonies on YPD plates with different G418 concentrations and culture at 30 °C until recombinant yeast single colonies appear.

[0013] In the traditional PCR technology for detecting foreign genes in recombinant yeast, due to the thick cell wall of yeast cells hindering the release of its internal antimicrobial peptide DNA, the obtained recombinant yeast cannot be directly PCR like other fungi. Therefore, a method combining freezing and thawing is adopted to promote the release of yeast cell walls for PCR reactions, accelerate the release of antimicrobial peptide DNA, simplify the operation steps and reduce the operation difficulty, providing further operation steps for the activity detection of antimicrobial peptides expressed in Pichia pastoris;

[0014] The appearance of recombinant yeast single colonies was observed based on the following operations. After diluting the colony concentration by an appropriate multiple to make the colonies evenly spread, the absorbance value at a wavelength of 500 nm was measured using a UV-visible spectrophotometer; or the mixture was centrifuged at 8000 r / min for 15 min, the supernatant was taken and weighed, and then the population was washed and weighed again. The difference between the two was the type of the total recombinant yeast single colonies, and the wet cell weight could also be further calculated; or the mixture was serially diluted 8-fold with sterilized 0.85% saline. 100 μL of the diluted bacterial solution was taken and spread evenly on an MM plate, and cultured in a constant temperature incubator at 30 °C until single colonies appeared, then washed and counted. The number of yeast cells = the number of single colonies × the dilution factor.

[0015] S4, pick recombinant yeast single colonies into a PCR tube containing 10 μL of ddH 2 O, add 5 μL of 5 U / μL Lyticase and mix well. Incubate in a water bath at 30 °C for 10 min, and then in a water bath at -80 °C for 30 min to obtain yeast genomic DNA. PCR identification was performed using the obtained yeast genomic DNA as a template.

[0016] Therefore, as described above, it can be seen that by ligating the amplification products generated using the designed primers as gene templates into one body, a more suitable recombinant expression plasmid is obtained, which is convenient for the subsequent expression of antimicrobial peptides in Pichia pastoris. Thus, finally, the recombinant expression plasmid and the recipient bacteria are completely mixed to obtain antimicrobial drugs and feed additives suitable for the feeding of Litopenaeus vannamei, improving the expression level and antibacterial ability of antimicrobial peptides. In the verification direction, the method of combining freezing and thawing is used to promote the release of yeast cell walls for PCR reactions, accelerate the release of antimicrobial peptide DNA, simplify the operation steps and reduce the operation difficulty, providing further operation steps for the activity detection of antimicrobial peptide expression in Pichia pastoris.

[0017] The DNA sequences of the paired primers used in this application are disclosed in detail, which are respectively:

[0018] TTCGAAACGCCGCGGATGAGATTTCCAAGTATATTCACAG(2-1);

[0019] CTAGAAAGCTGGCGGTTAATTCTTTGCAAGTGCCGTT(2-2);

[0020] TTCGAAACGCCGCGGATGAGATTCCCATCAATTTTTACGG(2-3);

[0021] CTAGAAAGCTGGCGGTTAACCCAACTTCTTCATTCTCC(2-4);

[0022] CTAGAAAGCTGGCGGTTATTGAGATTCAGTTCTTGGAACC(2-5);

[0023] TTCGAAACGCCGCGGATGAGATTCCCATCTATTTTCACTG(2-6);

[0024] TATCTCTTGAAAAGAAAAGTTTTTGGTAGATGTGAATTGGC(2-7);

[0025] GAAAGCTGGCGGTTAACCACAACCCAATGGAATAGAA(2-8);

[0026] CCGGGTCTCAGAGAGGAAGGTTCCGTCG(2-9);

[0027] GTCAACTTGGCCATGGTTTAG(2-10);

[0028] AAAAAAACCCGTAAAAAGCTAAAAAAGATCGGA(2-11);

[0029] TTCGAAACGCCGCGGATGAGATTCCCTTCTATTTTCACTG(2-12);

[0030] CTAGAAAGCTGGCGGTTAACCCCACAAACCAAACA(2-13).

[0031] A further improvement of the technical solution of the present invention lies in that the yeast expression vector in S1 is the pPIC3.5K plasmid, the gene template in S2 is pPIC3.5K-penaeidin-3, the recombinant expression plasmid in S2 is pPIC3.5K-(his+Amp+3'AOX-DEL)penaeidin-3, and the antibacterial peptide genes in S1 include but are not limited to penaeidin-3, ALF, CrustinB, PEN-3, PEN-4.

[0032] A further improvement of the technical solution of the present invention lies in that the electric shock intensity in S3 is specifically 2000V, 25uF and 200Ω.

[0033] A further improvement of the technical solution of the present invention lies in that the designed primers used in S2 and their DNA sequences are specifically:

[0034] HIQ20191120F1-GGCTTCGAAACGATGAGATTCCCA(1-1);

[0035] HJO20191120R1 - GGCGAATTCTTACTGAACGGCTTCGGAT(1 - 2).

[0036] A further improvement of the technical solution of the present invention lies in that S4 further includes the cultivation and protein identification of recombinant yeast single colonies. The specific steps are as follows: The recombinant yeast colonies obtained in S3 are respectively cultured on BMGY medium at 30 °C for 2 - 3 d, and the cells are collected by centrifugation at 250 r / min. The cells are resuspended with 100 mL of BMGY medium to make OD 600 reach 1.0, and continue to shake - culture at 30 °C and 250 r / min. Methanol with a concentration of 0.5% is added every 24 h to induce the expression of the target gene. Finally, the obtained culture solution is centrifuged at 4 °C and 5000 r / min for 10 min, the supernatant is discarded, and the cells are subjected to protein identification.

[0037] A further improvement of the technical solution of the present invention lies in that S4 further includes the determination of the optimal culture time of recombinant yeast single colonies, including the following specific steps:

[0038] The collected cells are resuspended with 200 μL of lysis buffer, shaken vigorously for 30 s in an acid - washed state, ice - bathed for 30 s, and repeated 4 times. Then, they are centrifuged at 4 °C and 12000 r / min for 10 min. The supernatant is taken and mixed with an equal volume of buffer. After boiling water bath for 8 min, it is centrifuged at 10000 r / min for 5 min, and 15 μL of the supernatant is taken for electrophoresis to determine the optimal culture time for the expression of the target protein induced by methanol in P. pastoris;

[0039] The specific steps of protein identification are as follows: Prepare multiple groups of different BSA proteins according to the protein concentration detection kit. The supernatant containing cells is filtered through a 0.2 - μm filter membrane, diluted to an appropriate concentration, and the dilution factor is recorded. Different concentrations of BSA standard proteins and the supernatant containing cells are added to the protein standard wells of a 96 - well plate. G250 staining solution is added to each well, and after standing for 5 min, the absorbance at a wavelength of 59 nm is measured with an enzyme - linked immunosorbent assay (ELISA) reader. The protein concentration in the supernatant is calculated according to the standard curve and the above - recorded dilution factor to ensure the efficient expression of the antimicrobial peptide.

[0040] A further improvement of the technical solution of the present invention lies in that the preparation components of the BMGY medium are as follows: Add 20 g / L of Tryptone, 10 g / L of Yeast extract, sterilize at 121 °C for 20 min, and then add 4×10−4 g / L of sterile Biotin, 13.4 g / L of yeast nitrogen - free amino acid source, and 2% of methanol.

[0041] A further improvement of the technical solution of the present invention is that it also provides the application of the construction method for the expression of the above - mentioned antimicrobial peptide in Pichia pastoris in antimicrobial drugs and feed additives

[0042] A further improvement of the technical solution of the present invention lies in that the antibacterial drug and the feed additive have good antibacterial effects on Litopenaeus vannamei during treatment and growth.

[0043] Compared with the prior art, the beneficial effects of the present invention are as follows: the amplification products generated by using the designed primers as gene templates are ligated together to obtain a more suitable recombinant expression plasmid, which is convenient for the subsequent expression of antibacterial peptides in Pichia pastoris. As a result, the recombinant expression plasmid and the P. pastoris receptor bacteria are completely mixed to obtain antibacterial drugs and feed additives suitable for the feeding of Litopenaeus vannamei, improving the expression level and antibacterial ability of antibacterial peptides. In the verification direction, the method of combining freezing and thawing is adopted to promote the release of yeast cell walls for PCR reactions, accelerate the release of antibacterial peptide DNA, simplify the operation steps and reduce the operation difficulty, providing further operation steps for the activity detection of antibacterial peptides expressed in Pichia pastoris. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 It is a schematic diagram of the construction in the construction method of expressing antibacterial peptides in Pichia pastoris;

[0045] Figure 2 It is a gene sequence table related to the construction method of expressing antibacterial peptides in Pichia pastoris. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0046] Various exemplary embodiments, features, and aspects of the present application will be described in detail below with reference to the drawings. The same reference numerals in the drawings denote elements having the same or similar functions. Although various aspects of the embodiments are shown in the drawings, the drawings are not necessarily drawn to scale unless otherwise specified.

[0047] The special term "exemplary" here means "serving as an example, embodiment, or illustration". Any embodiment described as "exemplary" here does not have to be construed as superior to or better than other embodiments.

[0048] In addition, in order to better illustrate the present application, numerous specific details are given in the following specific embodiments. Those skilled in the art should understand that the present application can be implemented without some specific details. In some instances, methods, means, and elements well known to those skilled in the art are not described in detail in order to highlight the gist of the present application.

[0049] The present invention provides a construction method for expressing antibacterial peptides in Pichia pastoris, including the following specific construction steps:

[0050] S1. Combine the selected antimicrobial peptide genes with the P. pastoris α signal peptide sequence respectively to construct a signal peptide-antimicrobial peptide whole sequence, synthesize it, integrate the signal peptide-antimicrobial peptide sequence onto a yeast expression vector, and use it as the selected gene template;

[0051] Among them, the antimicrobial peptide genes are discovered in the culture of Litopenaeus vannamei. Antimicrobial peptides such as penaeidin-3, ALF, CrustinB, PEN-3, PEN-4, etc. can all be used as genes to improve the immune defense of shrimp. Genes that are not disclosed above but can still enhance the immune defense of Litopenaeus vannamei are still applicable to the technical solutions disclosed in this application;

[0052] S2. Design primers to amplify using the selected gene template, obtain an amplification product with a 412bp band. After recovering the amplification product, perform double digestion with AsuⅡ and EcoRⅠ and recover to obtain band A. Meanwhile, perform double digestion of the yeast expression vector with AsuⅡ and EcoRⅠ to obtain a 4900bp band, and recover this band by gel as band B. Connect the obtained band A and band B together through DNA ligase for transformation, spread on a Kan-resistant plate, pick single colonies, and verify with double digestion using AsuⅡ and EcoRⅠ. After correct verification, perform sequencing verification to finally obtain the recombinant expression plasmid;

[0053] Among them, the yeast expression vector includes but is not limited to plasmids pUC57, pPIC3.5L, pPCIZ, ELM-PMPW, etc. In S2, in order to facilitate subsequent expression in Pichia pastoris, the yeast expression vector is verified to obtain the recombinant expression plasmid to be more suitable for the P. pastoris receptor strain. P. pastoris is the English noun expression of Pichia pastoris;

[0054] S3. Mix the recombinant expression plasmid completely with the P. pastoris receptor strain, transfer it to a pre-cooled 0.2 cm electroporation cup on ice, place it on ice for 5 min, apply an electric shock for 5 ms, spread on a zeocin-resistant plate after removing E. coli, and culture at 30 °C until recombinant yeast single colonies appear. Uniformly spread the obtained recombinant yeast single colonies on YPD plates with different G418 concentrations and culture at 30 °C until recombinant yeast single colonies appear.

[0055] When the traditional PCR technology is used to detect foreign genes in recombinant yeast, due to the thick cell wall of yeast cells hindering the release of its internal antimicrobial peptide DNA, the obtained recombinant yeast cannot be directly PCR'd like other fungi. Therefore, a method combining freezing and thawing is adopted to promote the release of yeast cell walls for PCR reactions, accelerate the release of antimicrobial peptide DNA, simplify the operation steps and reduce the operation difficulty, providing further operation steps for the activity detection of antimicrobial peptides expressed in Pichia pastoris;

[0056] The appearance of recombinant yeast single colonies was observed based on the following operations. After diluting the colonies by an appropriate multiple according to the colony concentration to make the colonies spread evenly, the absorbance value at a wavelength of 500 nm was measured using a UV-visible spectrophotometer; or the mixture was centrifuged at 8000 r / min for 15 min, and the supernatant was taken and weighed. After washing the population and weighing again, the difference between the two was the type of the total recombinant yeast single colonies, and the wet cell weight could also be further calculated; or the mixture was serially diluted 8-fold with sterile 0.85% saline. 100 μL of the diluted bacterial solution was taken and spread evenly on an MM plate, and cultured in a constant temperature incubator at 30 °C until single colonies appeared and were counted. The number of yeast cells = the number of single colonies × the dilution multiple.

[0057] S4, pick recombinant yeast single colonies into a PCR tube containing 10 μL of ddH 2 O, add 5 μL of 5 U / μL Lyticase and mix well. After incubating in a water bath at 30 °C for 10 min, incubate in a water bath at -80 °C for 30 min to obtain yeast genomic DNA, and perform PCR identification using the obtained yeast genomic DNA as a template.

[0058] Therefore, as described above, the amplified products generated using the designed primers as gene templates are ligated together to obtain a more suitable recombinant expression plasmid, which is convenient for the subsequent expression of antimicrobial peptides in Pichia pastoris. Thus, finally, the recombinant expression plasmid and the recipient bacteria are completely mixed to obtain an antibacterial drug and a feed additive suitable for the feeding of Litopenaeus vannamei, improving the expression level and antibacterial ability of antimicrobial peptides. In the verification direction, the method of combining freezing and thawing is used to promote the release of the yeast cell wall for the PCR reaction and accelerate the release of antimicrobial peptide DNA, simplifying the operation steps and reducing the operation difficulty, providing further operation steps for the activity detection of antimicrobial peptides expressed in Pichia pastoris.

[0059] The DNA sequences of the paired primers used in this application are disclosed in detail, which are respectively:

[0060] TTCGAAACGCCGCGGATGAGATTTCCAAGTATATTCACAG; (2-1)

[0061] CTAGAAAGCTGGCGGTTAATTCTTTGCAAGTGCCGTT; (2-2)

[0062] TTCGAAACGCCGCGGATGAGATTCCCATCAATTTTTACGG; (2-3)

[0063] CTAGAAAGCTGGCGGTTAACCCAACTTCTTCATTCTCC; (2-4)

[0064] CTAGAAAGCTGGCGGTTATTGAGATTCAGTTCTTGGAACC;(2-5)

[0065] TTCGAAACGCCGCGGATGAGATTCCCATCTATTTTCACTG;(2-6)

[0066] TATCTCTTGAAAAGAAAAGTTTTTGGTAGATGTGAATTGGC;(2-7)

[0067] GAAAGCTGGCGGTTAACCACAACCCAATGGAATAGAA;(2-8)

[0068] CCGGGTCTCAGAGAGGAAGGTTCCGTCG;(2-9)

[0069] GTCAACTTGGCCATGGTTTAG;(2-10)

[0070] AAAAAAACCCGTAAAAAGCTAAAAAAGATCGGA;(2-11)

[0071] TTCGAAACGCCGCGGATGAGATTCCCTTCTATTTTCACTG;(2-12)

[0072] CTAGAAAGCTGGCGGTTAACCCCACAAACCAAACA。(2-13)

[0073] Example 1. In S1, the yeast expression vector is the pPIC3.5K plasmid. In S2, the gene template is pPIC3.5K-penaeidin-3, and the recombinant expression plasmid in S2 is pPIC3.5K-(his+Amp+3’AOX-DEL)penaeidin-3. The antimicrobial peptide genes in S1 include but are not limited to penaeidin-3, ALF, Crustin B, PEN-3, and PEN-4.

[0074] The specific electric shock intensity in S3 is 2000V, 25uF, and 200Ω.

[0075] The designed primers used in S2 and their DNA sequences are specifically as follows:

[0076] HIQ20191120F1-GGCTTCGAAACGATGAGATTCCCA(1-1);

[0077] HJO20191120R1 - GGCGAATTCTTACTGAACGGCTTCGGAT(1 - 2).

[0078] S4 also includes the cultivation and protein identification of recombinant yeast single colonies. The specific steps are as follows: The recombinant yeast colonies obtained in S3 are respectively cultured on BMGY medium at 30 °C for 2 - 3 d, and the cells are collected by centrifugation at 250 r / min. The cells are resuspended with 100 mL of BMGY medium to make the OD 600 reach 1.0, and continue to shake - culture at 30 °C and 250 r / min. Methanol with a concentration of 0.5% is supplemented every 24 h to induce the expression of the target gene. Finally, the obtained culture solution is centrifuged at 4 °C and 5000 r / min for 10 min, the supernatant is discarded, and the cells are subjected to protein identification.

[0079] S4 also includes the determination of the optimal culture time of recombinant yeast single colonies, including the following specific steps:

[0080] The collected cells are resuspended with 200 μL of lysis buffer, shaken vigorously for 30 s in an acid - washed state, ice - bathed for 30 s, and repeated 4 times. Then, they are centrifuged at 4 °C and 12000 r / min for 10 min. The supernatant is mixed with an equal volume of buffer, boiled in a water bath for 8 min, and then centrifuged at 10000 r / min for 5 min. 15 μL of the supernatant is taken for electrophoresis to determine the optimal culture time for the expression of the target protein induced by methanol in P. pastoris.

[0081] The components of the BMGY medium are as follows: Add 20 g / L of Tryptone, 10 g / L of Yeast extract, sterilize at 121 °C for 20 min, and then add 4×10−4 g / L of sterile Biotin, 13.4 g / L of yeast nitrogen - free source, and 2% of methanol.

[0082] Example 2, based on Example 1, further discloses the specific steps of the above - mentioned protein identification. Multiple groups of different BSA proteins are prepared according to the protein concentration detection kit. The obtained supernatant containing cells is filtered through a 0.2 - μm filter membrane, diluted to an appropriate concentration, and the dilution factor is recorded. Different concentrations of BSA standard proteins and the supernatant containing cells are added to the protein standard wells of a 96 - well plate. G250 staining solution is added to each well, and after standing for 5 min, the absorbance at a wavelength of 59 nm is measured with an enzyme - linked immunosorbent assay (ELISA) reader. The protein concentration in the supernatant is calculated according to the standard curve and the above - recorded dilution factor to ensure the efficient expression of the antimicrobial peptide.

[0083] The present invention also provides the application of the above - mentioned construction method for the expression of the antimicrobial peptide in Pichia pastoris in antimicrobial drugs and feed additives. The antimicrobial drugs and feed additives have good antibacterial effects on Litopenaeus vannamei during treatment and growth.

[0084] It should be noted that, in this document, relational terms such as first and second are only used to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any actual relationship or order between these entities or operations. Moreover, the terms "comprising", "including" or any other variant thereof are intended to cover non-exclusive inclusion, such that a process, method, article or device comprising a series of elements not only includes those elements but also includes other elements not expressly listed, or further includes elements inherent to such process, method, article or device.

[0085] Although embodiments of the present invention have been shown and described, it will be understood by those of ordinary skill in the art that various changes, modifications, substitutions and variations can be made to these embodiments without departing from the principles and spirit of the present invention, and the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A method for constructing an antimicrobial peptide expressed in Pichia pastoris, characterized in that: The following specific construction steps are included: S1: The selected antimicrobial peptide genes were combined with the P. pastoris α signal peptide sequence to construct a signal peptide-antimicrobial peptide overall sequence, and the signal peptide-antimicrobial peptide sequence was integrated into a yeast expression vector as a selected gene template; S2: Design primers to amplify the selected gene template to obtain a 412bp band of amplified product. After the amplified product is recovered, it is double-digested with AsuⅡ and EcoRⅠ to obtain band A. At the same time, the yeast expression vector obtained by double-digesting with AsuⅡ and EcoRⅠ is obtained to obtain a 4900bp band, which is recovered by gel as band B. The obtained bands A and B are connected together by DNA ligase for conversion, and single colonies are selected after coating on Kan resistance plates, and double-digested with AsuⅡ and EcoRⅠ for verification. After verification, sequencing is performed to finally obtain the recombinant expression plasmid; S3: The recombinant expression plasmid was mixed completely with the P. pastoris recipient bacteria, transferred to an ice-cooled 0.2 cm electric shock cup, placed on ice for 5 minutes, and electroporated for 5 ms. The culture was then spread on an E. coli zeocin-resistant plate and cultured at 30°C until a single recombinant yeast colony appeared. The obtained recombinant yeast colony was evenly spread on different G418 YPD plates and cultured at 30°C until a single recombinant yeast colony appeared. S4: Select a single recombinant yeast colony and place it in a PCR tube containing 10uL ddH2O, add 5uL 5U / uL Lyticase and mix well, incubate in a 30℃ water bath for 10min, and then incubate in a -80℃ water bath for 30min to obtain yeast genomic DNA. Use the obtained yeast genomic DNA as a template for PCR identification.

2. The method for constructing an antimicrobial peptide expressed in Pichia pastoris according to claim 1, characterized in that: The yeast expression vector in S1 is pPIC3.5K plasmid, the gene template in S2 is pPIC3.5K-penaeidin-3, the recombinant expression plasmid in S2 is pPIC3.5K-(his+Amp+3'AOX-DEL)penaeidin-3, and the antimicrobial peptide genes in S1 include but are not limited to penaeidin-3, ALF, CrustinB, PEN-3, and PEN-4.

3. The method for constructing an antimicrobial peptide expressed in Pichia pastoris according to claim 1, characterized in that: The electric shock intensity in S3 is specifically 2000V, 25uF and 200Ω.

4. The method for constructing an antimicrobial peptide expressed in Pichia pastoris according to claim 1, characterized in that: The designed primers and their DNA sequences used in S2 are specifically: HIQ20191120F1-GGCTTCGAAACGATGAGATTCCCA; HJO20191120R1-GGCGAATTCTTACTGAACGGCTTCGGAT.

5. The method for constructing an antimicrobial peptide expressed in Pichia pastoris according to claim 1, characterized in that: S4 also includes the cultivation and protein identification of the recombinant yeast single colony, and the specific steps are: the recombinant yeast colonies obtained in S3 are cultured on BMGY medium at 30°C for 2-3 days, and the bacteria are collected by centrifugation at 250r / min, and the bacteria are resuspended in 100mL BMGY medium to make OD 600 When the pressure reaches 1.0, continue shaking culture at 30℃ and 250r / min, add 0.5% methanol every 24h to induce the expression of target gene, and finally obtain the culture solution, centrifuge it at 4℃ and 5000r / min for 10min, discard the supernatant, and perform protein identification on the bacteria.

6. The method for constructing an antimicrobial peptide expressed in Pichia pastoris according to claim 5, characterized in that: The S4 also includes determining the optimal culture time of a single colony of recombinant yeast, including the following specific steps: The collected bacteria were resuspended in 200uL lysis buffer, shaken vigorously for 30s under acid washing state, ice bathed for 30s, repeated 4 times, and centrifuged at 4℃ and 12000r / min for 10min. The supernatant was mixed with an equal volume of buffer, boiled in water bath for 8min, centrifuged at 10000r / min for 5min, and 15uL of the supernatant was taken for electrophoresis. The optimal culture time for methanol-induced expression of the target protein in P. pastoris was obtained.

7. The method for constructing an antimicrobial peptide expressed in Pichia pastoris according to claim 5, characterized in that: The components of BMGY medium are as follows: add Tryptone 20g / L, Yeast extract 10g / L, sterilize at 121℃ for 20min, then add sterile Biotin 4×10-4g / L, yeast amino-free nitrogen source 13.4g / L, and methanol 2%.

8. Use of the construction method for expressing an antimicrobial peptide in Pichia pastoris according to any one of claims 1 to 7 in antimicrobial drugs and feed additives.

9. The use according to claim 8, wherein the antibacterial drug and feed additive have good antibacterial effects on the treatment and growth of Penaeus vannamei.

Images