Application of trnP gene in identification of C- and C+ strains of Bemisia tabaci (Homoptera: Aleyrodidae) single female line, primer pair and identification method
Through PCR amplification and restriction endonuclease digestion of specific primers of the trnP gene, the problems of complexity and high cost in identifying C- and C+ strains of Bemisia tabaci in the existing technology are solved, and rapid and accurate strain identification is achieved.
Patent Information
- Application Number
- CN202510264545.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-07
- Publication Date
- 2025-10-17
- Estimated Expiration
- 2045-03-07
AI Technical Summary
Existing technologies are difficult to quickly, accurately and cost-effectively identify the C- and C+ strains of Bemisia tabaci. They have problems such as complex operation, high cost, insufficient result stability and insufficient specificity.
PCR amplification was performed using a specific primer pair for the trnP gene, and restriction endonuclease SspI was used for digestion. The length and number of enzyme-digested fragments were detected by agarose gel electrophoresis to identify C- and C+ strains.
It has achieved rapid, accurate and intuitive identification of different strains of Bemisia tabaci, laying the foundation for the identification of heat-resistant monogynous strains of Bemisia tabaci and the study of population dynamics.
Smart Images
Figure CN120060489B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of agricultural biological detection, and particularly relates to application of a trnP gene in identifying C- and C+ strain Bemisia tabaci monogynous lines, a primer pair and an identification method. BACKGROUND
[0002] Bemisia tabaci is a global agricultural pest, and C- and C+ strains of Bemisia tabaci have significant differences in biological characteristics, host adaptability and drug resistance. Accurate identification of the two strains is of great significance for the prevention and control of Bemisia tabaci, drug resistance management and ecological research. However, the traditional morphological method is difficult to distinguish C- and C+ strains, so it is necessary to use molecular biology and genetic technology for accurate identification.
[0003] At present, methods for identifying C- and C+ strains of Bemisia tabaci mainly include PCR, AFLP, DNA sequencing, SDS-PAGE and Western Blot. Among them, the PCR method is simple and low in cost, but it depends on the design of specific primers, and may have false positive or false negative results; AFLP has high resolution, but is complex and high in cost; the DNA sequencing technology is accurate and reliable, but the data analysis is complex and high in cost; SDS-PAGE can directly show the detection results, but has limited resolution and is difficult to distinguish highly similar proteins; Western Blot depends on the quality and specificity of antibodies.
[0004] In summary, the existing methods for identifying C- and C+ strains of Bemisia tabaci have the defects of complex operation, high cost, insufficient stability of results and insufficient specificity, and it is urgent to develop a method for identifying C- and C+ strains of Bemisia tabaci which is simple in operation, low in cost, stable in results and high in specificity. SUMMARY
[0005] In view of the problems in the prior art, the purpose of the present application is to provide application of a trnP gene in identifying C- and C+ strain Bemisia tabaci monogynous lines, a primer pair and an identification method.
[0006] In order to achieve the above purpose, the technical scheme adopted by the present application is as follows:
[0007] The application of the trnP gene in identifying C- and C+ strain Bemisia tabaci monogynous lines is that, in the C- strain Bemisia tabaci monogynous line, the partial fragment of the trnP gene is as shown in SEQ ID NO. 3; and in the C+ strain Bemisia tabaci monogynous line, the partial fragment of the trnP gene is as shown in SEQ ID NO. 4.
[0008] A primer pair for identifying C- and C+ strain of Bemisia tabaci single female line, the primer pair is used for PCR amplification of sequence containing C- and C+ strain of Bemisia tabaci trnP gene difference site, in C- strain of Bemisia tabaci single female line, part of trnP gene fragment is as shown in SEQ ID NO. 3; in C+ strain of Bemisia tabaci single female line, part of trnP gene fragment is as shown in SEQ ID NO. 4.
[0009] On the basis of the above scheme, the primer pair sequence is as shown in SEQ ID NO. 1 and SEQ ID NO. 2.
[0010] A method for identifying C- and C+ strain of Bemisia tabaci single female line, extracting genomic DNA of the to-be-tested Bemisia tabaci as a template, using specific primer pairs for PCR amplification, using a restriction endonuclease for enzyme cutting of the PCR amplification product, and performing agarose gel electrophoresis detection of the length and band number of the product obtained by enzyme cutting; the primer pair sequence is as shown in SEQ ID NO. 1 and SEQ ID NO. 2; the restriction endonuclease is SspI.
[0011] On the basis of the above scheme, the Bemisia tabaci is Q type Bemisia tabaci.
[0012] On the basis of the above scheme, the agarose gel electrophoresis spectrum shows one band with a fragment length of 779bp, indicating that the to-be-tested Bemisia tabaci is C- strain; the agarose gel electrophoresis spectrum shows two bands with lengths of 524bp and 255bp, indicating that the to-be-tested Bemisia tabaci is C+ strain.
[0013] On the basis of the above scheme, the amplification system of the PCR amplification is: 2ul of genomic DNA solution, 1ul of 10um positive and negative sense primers, 12.5ul of premix Taq, and DEPC water is added to 25ul.
[0014] On the basis of the above scheme, the reaction conditions of the PCR amplification are: 95 DEG C pre-denaturation for 2 minutes; 98 DEG C denaturation for 10 seconds, 60 DEG C annealing for 30 seconds, 72 DEG C extension for 60 seconds, 35 cycles; 72 DEG C extension for 2 minutes.
[0015] On the basis of the above scheme, the enzyme cutting conditions of the restriction endonuclease are: 37 DEG C, 60 minutes.
[0016] Advantages of the technical scheme of the present application
[0017] The present application develops a primer pair containing the differential base sequence of the mitochondrial trnP gene in the mtDNA of the C- and C+ strain of Bemisia tabaci based on the differential base of the mitochondrial trnP gene in the mtDNA of the C- and C+ strain of Bemisia tabaci, and uses the primer pair to perform PCR amplification with the genomic DNA of Bemisia tabaci as a template, uses a restriction endonuclease to perform enzyme cutting on the amplification product, and detects the length and band number of the enzyme cutting fragment by agarose gel electrophoresis; and then the purpose of identifying the C- and C+ strain of Bemisia tabaci single female line is achieved.
[0018] The method for identifying the single female line of Bemisia tabaci based on PCR-RFLP can quickly, accurately and intuitively identify different strains of Bemisia tabaci, and lays a foundation for the identification of the heat-resistant single female line of Bemisia tabaci, the population dynamic identification of Bemisia tabaci, the research on the invasion mechanism and the biology. BRIEF DESCRIPTION OF DRAWINGS
[0019] Figure 1 is an agarose gel electrophoresis chart of the PCR product before and after enzyme cutting of SspI in Example 3 (wherein M: Marker 2000, from top to bottom, 2000bp, 1000bp, 750bp, 500bp, 250bp, 100bp);
[0020] Figure 2 is an agarose gel electrophoresis chart of the PCR product after enzyme cutting of SspI in Example 4 (wherein sample wells 1-5 are the C- strain of Bemisia tabaci in Shouguang region of Shandong province, and 6-10 are the C+ strain of Bemisia tabaci in Shouguang region of Shandong province);
[0021] Figure 3 is an agarose gel electrophoresis chart of the PCR product after enzyme cutting of SspI in Example 5 (wherein sample wells 1-5 are the C- strain of Bemisia tabaci in Lingshui region of Hainan province, and 6-10 are the C+ strain of Bemisia tabaci in Lingshui region of Hainan province). DETAILED DESCRIPTION
[0022] The terms used in the present application have the meanings generally understood by those of ordinary skill in the art unless otherwise specified. The present application is described in further detail below in conjunction with specific examples and with reference to the data. The following examples are only for the purpose of illustrating the present application, and do not limit the scope of the present application in any way.
[0023] The experimental methods in the following examples are all conventional methods, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The experimental materials, reagents, and drugs used in the following examples can be purchased through general channels, unless otherwise specified.
[0024] In the following examples, the SspI endonuclease was purchased from Yugong Bio, the Premix Taq (Ex Taq) was purchased from Takara, the autoclaved STE (TNE) buffer (pH 8.0) was purchased from Solarbio, the Proteinase K was purchased from Aikangrui, and other reagents and consumables were commercially available.
[0025] In the following examples, the whitefly was Q-type whitefly (MED cryptic species).
[0026] Example 1
[0027] Obtaining of trnP gene difference sites of different strains (C- and C+) of Bemisia tabaci
[0028] (1) Whiteflies were collected from Shouguang (SG) in Shandong Province and Lingshui (LS) in Hainan Province, respectively, and detected according to the method described in [Li H, Wei X, Ding T, Chu D. Genome-Wide Profiling of Cardinium-Responsive MicroRNAs in the Exotic Whitefly, Bemisia tabaci (Gennadius) Biotype Q. Front Physiol. 2018 Nov 12; 9: 1580. doi: 10.3389 / fphys.2018.01580. PMID: 30483149; PMCID: PMC6241202.], and divided into C- and C+ strains of Bemisia tabaci, and single-male lines C+ and C- with the same genetic background were constructed according to the method described therein, which were collected from Shouguang (SG) in Shandong Province and Lingshui (LS) in Hainan Province, respectively. The two strains have significant differences in biological characteristics, such as high temperature tolerance.
[0029] (2) Based on the two strains (C- and C+) of Bemisia tabaci mitochondrial genome established by the above method, the sequences of the mitochondrial genomes of the two strains were aligned using the molecular software SnapGene 5.2, and it was found that there was a restriction endonuclease recognition site in the trnP gene difference sequence of the two strains. In the C+ strain, it was the recognition site of the restriction endonuclease SspI (enzyme cleavage site 5'-AAT^ATT-3').
[0030] Example 2
[0031] Application of trnP gene difference site sequence of Bemisia tabaci in identifying C- and C+ strains of Bemisia tabaci single-male lines
[0032] Primers were designed based on the sequences before and after the different sites of trnP gene of B. tabaci C- and C+ strains (the primer sequences are shown as SEQ ID NO. 1 and SEQ ID NO. 2), and the partial fragment of trnP gene containing the sites was amplified by PCR using the B. tabaci genomic DNA as template. The partial fragment of trnP gene amplified by PCR in the C- strain of B. tabaci is shown as SEQ ID NO. 3, and the partial fragment of trnP gene amplified by PCR in the C+ strain of B. tabaci is shown as SEQ ID NO. 4.
[0033] Forward primer: 5'-TTATTCGCAATGGACCTCTACACT-3' (SEQ ID NO. 1);
[0034] Reverse primer: 5'-GAAGTATAAAACGTTGTGATTTTCCAT-3' (SEQ ID NO. 2);
[0035] SEQ ID NO. 3 (5'→ 3')
[0036] TTATTCGCAATGGACCTCTACACTTTTTGATAATTTCATAAATAATTAATAAACAGAGTAAAAGATAAAAGATAAGAAAAAATGAAAATAAACTAAAAGGAACTAACATAAATTTAAAAACAAAATAAAATTCATATAAGTTAATTTTAAAAGTTGAAACAAAAATAGAGAAATAAATAAAATTAGATTTAATAATTTGCCCAAATAAAACACCCAAAATTAAGATTCAGATAAATCTTAAATAAAATTTATAAATTATAGAAATTTTTTCAACAATGATTACACCACACATGTAAGCCAAAAGAATCACAGTTCCTCTTATAAATAACATAAATAATAAAAATCTATAAAAATAAGAATTAACAATAAATACAAGAGAAATTCTCGAAAAAATGAGACATAAAATAAAAAATAAAATTAAAATCACTGGATTAAACATTATAAAAACAACTAGAAAAGTCAATAACTTCAATCAGTAAATAATTTAAGATAAAATACTAATCTTGGAAATTAGAAATAATGATATTTTTACTGATACTTTAAACCTAGAAAAGATTTCATTGAATTACAAAATCAACATTTTTTTATAAACTACTAAAATTATGAAAATAGAAGAAATAGTTTTACCCATTTTATTAATAGTAATAATTTATCTGGTTTCAAAGATAAATATAATTAGCAGATTAATTATAATTGAATACATCTCTATCATAGTAATTATCACAATAATGATTTTAATTAAAACTGTGAATATGGAAAATCACAACGTTTTATACTTC
[0037] SEQ ID NO. 4 (5'→ 3')
[0038] TTATTCGCAATGGACCTCTACACTTTTTGATAATTTCATAAATAATTAATAAACAGAGTAAAAGATAAAAGATAAGAAAAAATGAAAATAAACTAAAAGGAACTAACATAAATTTAAAAACAAAATAAAATTCATATAAGTTAATTTTAAAAGTTGAAACAAAAATAGAGAAATAAATAAAATTAGATTTAATAATTTGCCCAAATAAAACACCCAAAATTAAGATTCAGATAAATCTTAAATAAAATTTATAAATTATAGAAATTTTTTCAACAATGATTACACCACACATGTAAGCCAAAAGAATCACAGTTCCTCTTATAAATAACATAAATAATAAAAATCTATAAAAATAAGAATTAACAATAAATACAAGAAAAATTCTCGAAAAAATGAGACATAAAATAAAAAATAAAATTAAAATCACTGGATTAAACATTATAAAAACAACTAGAAAAGTCAATAACTTCAATCAGTAAATAATTTAAGATAAAATACTAATCTTGGAAATTAGAAATAATAATATTTTTACTGATACTTTAAACCTAGAAAAGATTTCATTGAATTACAAAATCAACATTTTTTTATAAACTACTAAAATTATGAAAATAGAAGAAATAGTTTTACCCATTTTATTAATAGTAATAATTTATCTGGTTTCAAAGATAAATATAATTAGCAGATTAATTATAATTGAATACATCTCTATCATAGTAATTATCACAATAATGATTTTAATTAAAACTGTGAATATGGAAAATCACAACGTTTTATACTTC
[0039] Example 3
[0040] A method for discriminating C- and C+ strain of Bemisia tabaci single female line is as follows:
[0041] (1) Extracting Bemisia tabaci genomic DNA
[0042] Single female whitefly was placed in a 0.2 mL centrifuge tube containing 30 μL alkaline lysis solution, which was autoclaved STE (TNE) buffer (pH 8.0): Proteinase K = 35:2 (volume ratio), and was ground with a sealing gun head. After homogenization, the mixture was placed in a PCR instrument at 65°C for 15 min and at 95°C for 10 min to obtain a whitefly genomic DNA solution.
[0043] (2) PCR amplification of a partial fragment of the trnP gene of the whitefly
[0044] The genomic DNA solution of the C- strain of Lingshui, Hainan (LSC-), the C- strain of Shouguang, Shandong (SGC-), the C+ strain of Lingshui, Hainan (LSC+), and the C+ strain of Shouguang, Shandong (SGC+) was used as a template for PCR amplification to obtain a PCR amplification product. The primer sequences used in the amplification are shown in SEQ ID NO. 1 and SEQ ID NO. 2.
[0045] The PCR amplification system was as follows: 2 μL of the genomic DNA solution, 1 μL of each of the forward and reverse primers (10 μM), 12.5 μL of Premix Taq (Ex Taq), and DEPC water to make up 25 μL.
[0046] The PCR amplification conditions were as follows: 2 min of pre-denaturation at 95°C; 10 s of denaturation at 98°C, 30 s of annealing at 60°C, 60 s of extension at 72°C, 35 cycles; 2 min of extension at 72°C; and 4°C, ∞.
[0047] (3) Detection of the PCR amplification product obtained in step (2) by agarose gel electrophoresis (as shown in lanes 1-4). Figure 1
[0048] The PCR amplification product was sequenced to obtain the sequences of the PCR amplification product of the C- strain of Lingshui, Hainan and the C- strain of Shouguang, Shandong, which are shown in SEQ ID NO. 3, and the sequences of the PCR amplification product of the C+ strain of Lingshui, Hainan and the C+ strain of Shouguang, Shandong, which are shown in SEQ ID NO. 4.
[0049] (4) Enzymatic digestion of the PCR amplification product obtained in step (3) with the restriction enzyme SspI to obtain a digested product.
[0050] The enzyme digestion system was as follows: 2 μL of 10X CutOne Buffer, 5 μL of the PCR amplification product, 1 μL of SspI endonuclease, and DEPC water to make up 20 μL.
[0051] The reaction conditions were as follows: 37°C for 60 min in a PCR instrument.
[0052] (5) The enzyme cutting product prepared in step (4) is separated by agarose gel electrophoresis, imaged on a UV gel imaging instrument, and the polymorphism is observed.
[0053] The results show that the enzyme cutting results of restriction endonuclease SspI are that there is a band with a length of 779 bp on the imaged film of Hainan Lingshui C- strain (LSC-) and Shandong Shouguang C- strain (SGC-), and the electrophoretogram of Hainan Lingshui C+ strain (LSC+) and Shandong Shouguang C+ strain (SGC+) shows that the measured sample has two bands with lengths of 524 bp and 255 bp (as shown in lanes 6-9). Figure 1
[0054] Example 4
[0055] A method for identifying C- and C+ strains of Bemisia tabaci single female line, the steps are as follows:
[0056] (1) Extracting Bemisia tabaci genomic DNA
[0057] In the two single female lines of Shandong Shouguang C- and C+ established in the laboratory, 5 female Bemisia tabaci were randomly taken and placed in 0.2 mL centrifuge tubes containing 30 μL alkaline lysis solution. The alkaline lysis solution was autoclaved STE (TNE) buffer (pH 8.0): Proteinase K = 35:2 (volume ratio). After grinding and homogenizing with a sealing gun head, the mixture was placed in a PCR instrument at 65°C for 15 min and at 95°C for 10 min to prepare a Bemisia tabaci genomic DNA solution.
[0058] (2) PCR amplification of part of the trnP gene of Bemisia tabaci
[0059] The genomic DNA solution of Shandong Shouguang C- strain (SGC-) and Shandong Shouguang C+ strain (SGC+) was used as a template for PCR amplification to prepare PCR amplification products. The primer sequences used in the amplification are shown in SEQ ID NO. 1 and SEQ ID NO. 2.
[0060] The PCR amplification system was as follows: 2 μL of genomic DNA solution, 1 μL of forward and reverse primers each, 12.5 μL of Premix Taq (Ex Taq), and DEPC water was added to 25 μL.
[0061] The PCR amplification conditions were as follows: 95°C pre-denaturation for 2 min; 98°C denaturation for 10 s, 60°C annealing for 30 s, 72°C extension for 60 s, 35 cycles; 72°C extension for 2 min; 4°C, ∞.
[0062] (3) The PCR amplification product prepared in step (2) was cut with restriction endonuclease SspI to obtain an enzyme cutting product.
[0063] Enzyme digestion system: 10X CutOne Buffer 2 μL, PCR amplification product 5 μL, Ssp I endonuclease 1 μL, DEPC water to 20 μL.
[0064] Reaction condition: 37℃, 60 min in PCR instrument.
[0065] (4) The enzyme digestion product prepared in step (3) was separated by agarose gel electrophoresis, imaged on a UV gel imager, and the polymorphism was observed.
[0066] The results showed that sample wells 1-5 of the Shouguang C- strain had a 779 bp band on the imaging film; sample wells 6-10 of the Shouguang C+ strain had two bands of 524 bp and 255 bp (as shown in Figure 2 ) on the electrophoretogram.
[0067] Example 5
[0068] A method for identifying C- and C+ strains of Bemisia tabaci single females, comprising the following steps:
[0069] The C- and C+ single female strains of Bemisia tabaci established in the laboratory were used as detection samples, and their genomic DNA was extracted; the detection method was the same as in Example 4.
[0070] The results of agarose gel electrophoresis imaged on a UV gel imager showed that sample wells 1-5 of the Lingshui C- strain had a 779 bp band on the imaging film; sample wells 6-10 of the Lingshui C+ strain had two bands of 524 bp and 255 bp (as shown in Figure 3 ) on the electrophoretogram.
[0071] The above description is only a preferred embodiment of the present application, and is not intended to limit the present application in other forms. Any person skilled in the art can modify or change the above disclosed technical content to obtain equivalent embodiments. However, any simple modification, equivalent change and modification of the above embodiments without departing from the technical solution of the present application, and according to the technical essence of the present application, still belong to the protection scope of the present application.
Claims
1. The application of trnP gene in distinguishing C- and C+ strains of Bemisia tabaci monogyne, characterized in that: In the C- strain Bemisia tabaci monogynous line, a partial fragment of the trnP gene is shown as SEQ ID NO.3; in the C+ strain Bemisia tabaci monogynous line, a partial fragment of the trnP gene is shown as SEQ ID NO.4; the C- and C+ strain Bemisia tabaci monogynous lines are identified by identifying the base difference at position 522 of the nucleic acid sequences shown in SEQ ID NO.3 and SEQ ID NO.4; the C- strain Bemisia tabaci is not infected with Cardinium, and the C+ strain Bemisia tabaci is infected with Cardinium; the Bemisia tabaci is a Q-type Bemisia tabaci.
2. The use of a primer pair in distinguishing C- and C+ strains of Bemisia tabaci monogyne, characterized in that: The primer pair is used for PCR amplification of a sequence containing a differential site of the trnP gene between C- and C+ strains of Bemisia tabaci. In the monogynous line of the C- strain, a partial fragment of the trnP gene is shown as SEQ ID NO.3; in the monogynous line of the C+ strain, a partial fragment of the trnP gene is shown as SEQ ID NO.4; the differential site of the trnP gene between the C- and C+ strains of Bemisia tabaci is the 522nd base of the nucleic acid sequence shown as SEQ ID NO.3 and SEQ ID NO.4; the C- strain Bemisia tabaci is not infected with Cardinium, and the C+ strain Bemisia tabaci is infected with Cardinium; and the Bemisia tabaci is a Q-type Bemisia tabaci.
3. Use of the primer pair according to claim 2 in identifying C- and C+ strains of Bemisia tabaci monogyne, characterized in that: The primer pair sequences are shown in SEQ ID NO.1 and SEQ ID NO.
2.
4. A method for distinguishing C- and C+ strains of Bemisia tabaci monogyne, characterized in that: The genomic DNA of the tested whitefly is extracted as a template, and a specific primer pair is used to PCR amplify a partial fragment of the trnP gene. In the C- strain whitefly monogynous line, the partial fragment of the trnP gene is shown as SEQ ID NO.3; in the C+ strain whitefly monogynous line, the partial fragment of the trnP gene is shown as SEQ ID NO.4; the C- and C+ strain whitefly monogynous lines are identified by identifying the base difference at position 522 of the nucleic acid sequences shown in SEQ ID NO.3 and SEQ ID NO.4; the method for identifying the base difference at position 522 of the nucleic acid sequences shown in SEQ ID NO.3 and SEQ ID NO.4 is to use a restriction endonuclease to digest the PCR amplification product, and the product obtained by the digestion is subjected to agarose gel electrophoresis to detect the length of the fragment and the number of bands; the primer pair sequence is shown in SEQ ID NO.1 and SEQ ID NO. As shown in NO.2; the restriction endonuclease is SspI; the C- strain Bemisia tabaci is a whitefly not infected with Cardinium, the C+ strain Bemisia tabaci is a whitefly infected with Cardinium; the whitefly is a Q-type Bemisia tabaci.
5. The method for distinguishing C- and C+ strains of Bemisia tabaci monogyne according to claim 4, characterized in that: The agarose gel electrophoresis pattern showed a band with a fragment length of 779 bp, indicating that the tested whitefly was a C- strain; the agarose gel electrophoresis pattern showed two bands of 524 bp and 255 bp, indicating that the tested whitefly was a C+ strain.
6. The method for distinguishing C- and C+ strains of Bemisia tabaci monogyne according to any one of claims 4-5, characterized in that: The amplification system of the PCR amplification is as follows: 2 µL of genomic DNA solution, 1 µL each of 10 µM forward and antisense primers, 12.5 µL of Premix Taq, and DEPC water is added to 25 µL.
7. The method for distinguishing C- and C+ strains of Bemisia tabaci monogyne according to claim 6, characterized in that: The reaction conditions of the PCR amplification were as follows: pre-denaturation at 95°C for 2 minutes; denaturation at 98°C for 10 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 60 seconds, for 35 cycles; and extension at 72°C for 2 minutes.
8. The method for distinguishing C- and C+ strains of Bemisia tabaci monogyne according to claim 7, characterized in that: The restriction endonuclease digestion conditions are: 37° C., 60 minutes.