Znf423 gene molecular marker related to chicken carcass traits and application thereof

By detecting the SNP site of the chicken ZNF423 gene, molecular markers and primer pairs for identifying chicken carcass traits were provided, solving the problem of low chicken breeding efficiency in existing technologies and achieving accurate identification of chicken carcass traits and improved breeding results.

CN120060490BActive Publication Date: 2025-11-07SOUTH CHINA AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510289637.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-12
Publication Date
2025-11-07
Estimated Expiration
2045-03-12

AI Technical Summary

Technical Problem

The lack of effective molecular markers in existing technologies for identifying chicken carcass traits affects the efficiency and effectiveness of chicken breeding.

Method used

We provide molecular markers for the ZNF423 gene associated with chicken carcass traits. By detecting the genotype of SNP loci, we can identify chicken carcass traits, including keel length, dressing percentage, pectoral muscle a value, pectoral muscle b value, and intramuscular fat width. We use specific primer pairs for gene amplification and analysis.

Benefits of technology

By analyzing multiple SNP sites in the ZNF423 gene, we can accurately identify the carcass traits of chickens, provide scientific data for chicken breeding, and improve the efficiency and effectiveness of selection and breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120060490B_ABST
    Figure CN120060490B_ABST
Patent Text Reader

Abstract

The application discloses a ZNF423 gene molecular marker related to chicken carcass traits and application, and belongs to the technical field of biology.The nucleotide sequence of the molecular marker is shown in SEQ ID NO:1, and four sites are present;SNP1 is a site at the 462th position, the site has a G>A mutation, is divided into three genotypes of GG, AA and GA;SNP2 is a site at the 510th position, the site has an A>G mutation, is divided into three genotypes of GG, AA and GA;SNP3 is a site at the 741th position, the site has an A>G mutation, is divided into three genotypes of GG, AA and GA;SNP4 is a site at the 753th position, the site has a T>C mutation, is divided into three genotypes of TT, CC and TC.The four SNP sites are significantly related to the carcass traits of chickens, the carcass traits of chickens can be accurately identified, and a new molecular marker is provided for molecular marker assisted selection breeding.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to a ZNF423 gene molecular marker related to chicken carcass traits and application thereof. BACKGROUND

[0002] In commercial production, chicken is one of the important poultry species, and its carcass performance such as abdominal fat, leg weight, half- and whole- eviscerated percentage are regarded as important indicators affecting its economic value. Single nucleotide polymorphism (SNP) is the most common genetic variation type in human and animal genomes, accounting for more than 90% of all known polymorphisms. SNP refers to the variation of a single nucleotide at the genome level, including base conversion, transversion, insertion or deletion. A large number of studies have shown that SNP in gene structure has a significant impact on the actual production performance of animals, and can be used as an important tool for molecular marker-assisted selection (Molecular Mark-assist Selection, MAS) to improve the efficiency and effectiveness of selection and breeding.

[0003] ZNF423 gene (Zinc Finger Protein 423 Gene, ZNF423) encodes zinc finger protein 423 belonging to the zinc finger protein family, which acts as a DNA-binding transcription factor by using different zinc fingers, and plays an important role in the signal transduction process of animal fat generation. Studies have shown that ZNF423 gene plays a regulatory role in the differentiation of chicken fat cells and the development of abdominal adipose tissue. However, there is no report on the correlation between ZNF423 gene and poultry carcass performance. SUMMARY

[0004] The present application relates to the field of biotechnology, in particular to a ZNF423 gene molecular marker related to chicken carcass traits and application thereof.

[0005] To achieve the above-mentioned purpose, the present application provides the following scheme:

[0006] The present application provides a ZNF423 gene molecular marker related to chicken carcass traits, the nucleotide sequence of the molecular marker is shown as SEQ ID NO: 1, and four sites of SNP1-SNP4 exist in the sequence shown in SEQ ID NO: 1;

[0007] SNP1: It is the site at position 462, which has G﹥A mutation, and is divided into three genotypes of GG, AA and GA;

[0008] SNP2: it is the site of 510th position, the site exists A﹥G mutation, is divided into GG, AA and GA three genotypes;

[0009] SNP3: it is the site of 741th position, the site exists A﹥G mutation, is divided into GG, AA and GA three genotypes;

[0010] SNP4: it is the site of 753th position, the site exists T﹥C mutation, is TT, CC and TC three genotypes.

[0011] The application also provides a primer pair for amplifying the molecular marker, and the nucleotide sequences of the primer pair are shown in SEQ ID NO:2-3.

[0012] The application also provides a kit for identifying chicken carcass traits, and the kit comprises a primer pair for detecting the molecular marker, and the nucleotide sequences of the primer pair are shown in SEQ ID NO:2-3.

[0013] The application also provides a method for identifying chicken carcass traits, comprising the following steps:

[0014] DNA of a chicken genome to be detected is used as a template to amplify the molecular marker by using a primer pair, the genotypes of four SNP sites on the nucleotide sequence of the molecular marker are analyzed, and the chicken carcass traits are judged according to the genotypes.

[0015] The nucleotide sequences of the primer pair are shown in SEQ ID NO:2-3, and the chicken carcass traits include keel length, dressing percentage, breast muscle a value, breast muscle b value and intermuscular fat width.

[0016] Preferably, the genotypes GG, AA and GA of the SNP1 site are all significantly related to the keel length and the dressing percentage, and the keel length of the GG genotype is higher than that of the AA genotype and the GA genotype; and the dressing percentage of the GG genotype is higher than that of the AA genotype.

[0017] The genotypes GG, AA and GA of the SNP2 site are all significantly related to the breast muscle a value and the breast muscle b value, and the breast muscle a value of the AA genotype is higher than that of the GG genotype and the AA genotype, and the breast muscle b value of the AA genotype is higher than that of the GG genotype and the AA genotype.

[0018] The genotypes GG, AA and GA of the SNP3 site are all significantly related to the intermuscular fat width, and the intermuscular fat width of the GG genotype is lower than that of the AA genotype and the GA genotype.

[0019] The genotypes TT, CC and TC of the SNP4 site are significantly related to the muscle fat width and keel length, and the muscle fat width of the CC genotype and the TC genotype is lower than that of the TT genotype, and the keel length of the TC genotype is higher than that of the TT genotype.

[0020] The application further provides application of the molecular marker or the primer pair or the kit in identifying chicken carcass traits, and the chicken carcass traits include the keel length, the dressing percentage, the breast muscle a value, the breast muscle b value and the muscle fat width.

[0021] Preferably, the genotypes GG, AA and GA of the SNP1 site are significantly related to the keel length and the dressing percentage, and the keel length of the GG genotype is higher than that of the AA genotype and the GA, and the dressing percentage of the GG genotype is higher than that of the AA genotype;

[0022] The genotypes GG, AA and GA of the SNP2 site are significantly related to the breast muscle a value and the breast muscle b value, and the breast muscle a value of the AA genotype is higher than that of the GG genotype and the AA genotype, and the breast muscle b value of the AA genotype is higher than that of the GG genotype and the AA genotype;

[0023] The genotypes GG, AA and GA of the SNP3 site are significantly related to the muscle fat width, and the muscle fat width of the GG genotype is lower than that of the AA genotype and the GA genotype;

[0024] The genotypes TT, CC and TC of the SNP4 site are significantly related to the muscle fat width and keel length, and the muscle fat width of the CC genotype and the TC genotype is lower than that of the TT genotype, and the keel length of the TC genotype is higher than that of the TT genotype.

[0025] The application further provides application of the molecular marker or the primer pair or the kit in chicken breeding.

[0026] Preferably, the chicken breeding is chicken carcass trait breeding, and the chicken carcass traits include the keel length, the dressing percentage, the breast muscle a value, the breast muscle b value and the muscle fat width.

[0027] Preferably, the genotypes GG, AA and GA of the SNP1 site are significantly related to the keel length and the dressing percentage, and the keel length of the GG genotype is higher than that of the AA genotype and the GA, and the dressing percentage of the GG genotype is higher than that of the AA genotype;

[0028] The genotypes GG, AA and GA of the SNP2 site are significantly related to the breast muscle a value and the breast muscle b value, and the breast muscle a value of the AA genotype is higher than that of the GG genotype and the AA genotype, and the breast muscle b value of the AA genotype is higher than that of the GG genotype and the AA genotype;

[0029] The genotypes GG, AA and GA of the SNP3 site are significantly related to the intermuscular fat width, and the intermuscular fat width of the GG genotype is lower than that of the AA genotype and the GA genotype;

[0030] The genotypes TT, CC and TC of the SNP4 site are significantly related to the intermuscular fat width and the keel length, and the intermuscular fat width of the CC genotype and the TC genotype is lower than that of the TT genotype, and the keel length of the TC genotype is higher than that of the TT genotype.

[0031] The present application discloses the following technical effects:

[0032] The present application discloses the following technical effects: BRIEF DESCRIPTION OF DRAWINGS

[0033] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the following will briefly introduce the drawings needed in the embodiments. Obviously, the drawings in the following description only constitute some embodiments of the present application, and for those skilled in the art, other drawings can be obtained from these drawings without any creative effort.

[0034] Figure 1 ZNF423 gene on the chromosome and primer design schematic diagram;

[0035] Figure 2 ZNF423 gene SNP site. DETAILED DESCRIPTION

[0036] The various exemplary embodiments of the present application will now be described in detail, which should not be considered as limiting the present application, but should be understood as a more detailed description of some aspects, characteristics and embodiments of the present application.

[0037] It should be understood that the terms described in the present application are only for describing the specific embodiments, and are not used to limit the present application. In addition, for the numerical range in the present application, it should be understood that each intermediate value between the upper limit and the lower limit of the range is also specifically disclosed. Each smaller range between any stated value or intermediate value in the stated range, and any other stated value or intermediate value in the stated range, is also included in the present application. The upper limit and the lower limit of these smaller ranges can be independently included or excluded from the range.

[0038] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present application pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, preferred methods and materials are described. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials in connection with which the documents are cited. In case of conflict between the content of the specification and that of any document incorporated herein by reference, the content of the specification prevails.

[0039] Many modifications and variations of the present application described in the specification are possible without departing from the scope or spirit of the present application, which will be apparent to those skilled in the art. Other implementations of the present application will be apparent to those skilled in the art from the specification. The specification and examples of the present application are only exemplary.

[0040] As used herein, "comprise", "comprising", "have", "having", "include", "including", "contain", "containing", and the like, are open-ended terms that are intended to mean including but not limited to.

[0041] EMBODIMENTS

[0042] 1. Materials and methods

[0043] 1.1 Animal samples

[0044] A total of 325 45-day-old small white-feathered broilers, slow-type yellow-feathered broilers and fast large white-feathered broilers were selected, 2 mL of subcutaneous venous blood was collected, and the blood was stored at -80℃ for use as DNA extraction samples. The following carcass traits of the selected population were recorded: breast angle, breast depth, breast width, live weight, tibia length, tibia girth, body slant length, keel length, crown height, carcass weight, subcutaneous fat thickness, intermuscular fat width, half-eviscerated weight, whole-eviscerated weight, abdominal fat weight, wing weight, breast muscle weight, leg muscle weight, claw weight, breast muscle shear force, leg muscle shear force, drip loss rate, cooking loss rate, breast muscle pH value, leg muscle pH value, breast muscle L value, breast muscle a value, breast muscle b value, leg muscle L value, leg muscle a value, leg muscle b value, dressing percentage, half-eviscerated percentage, whole-eviscerated percentage, abdominal fat percentage, breast muscle percentage, leg muscle percentage, etc.

[0045] Each of the above carcass traits is a common measurement index, and can be measured according to a conventional method without special instructions.

[0046] 1.2 Main reagents

[0047] Blood sample DNA extraction kit (brand: OMEGA; item number: D3392; Guangzhou Feiyang Biological Engineering Co., Ltd.), 2xRapid Taq Master Mix (Dye) (brand: Novozyme; item number: P222-01; Nanjing Novozyme Biological Technology Co., Ltd.), DNA marker (brand: Quansijin; item number: BM101-01; Beijing Quansijin Biological Technology Co., Ltd.), high-purity low-electrolyte agarose (brand: Qikexue; item number: TSJ001; Beijing Qikexue Biological Technology Co., Ltd.).

[0048] 1.3 Experimental methods

[0049] 1.3.1 Primer design

[0050] According to the sequence of the ZNF423 gene of Gallus gallus domesticus published by NCBI (National Center for Biotechnology Information Search database) (NC_052542.1), the Primer-BLAST tool of NCBI was used to design primers, and the primer synthesis service was provided by Guangzhou Qikexue Biological Technology Co., Ltd. The primer sequence related information is shown in Table 1.

[0051] Table 1 PCR amplification primer sequences

[0052]

[0053] 1.3.2 Blood sample DNA extraction

[0054] The blood sample DNA was extracted according to the blood sample DNA extraction kit operation manual.

[0055] 1.3.3 PCR amplification of ZNF423 gene sequence

[0056] The blood sample genomic DNA of the above-mentioned 325 chickens was used as a template, and the following reaction system was followed: template DNA 2 μL, 2x ES Taq Master Mix (Dye) 15 μL, upstream primer 1.2 μL, downstream primer 1.2 μL, ddH2O 10.6 μL.

[0057] Reaction procedure: 95°C pre-denaturation for 3 min; 95°C denaturation for 15 s, 58°C annealing for 15 s, 72°C extension for 15 s, 34 cycles; 72°C final extension for 5 min; 4°C storage. The PCR product was sent to Guangzhou Qikexin Biotechnology Co., Ltd. for Sanger first-generation sequencing.

[0058] 1.3.4 SNP determination and genotyping

[0059] The Sanger first-generation sequencing results of the PCR product were analyzed by the Seqman tool in the DNAStar software to determine the potential SNP site. The sequencing data of each sample was aligned by the SeqMan tool of the DNAStar software for genotyping.

[0060] 1.3.5 Genotype and carcass trait association analysis

[0061] The SNPs site and the genotype of the individual were associated with the carcass trait data, and SPSS 26.0 was used for association analysis.

[0062] 2、Results

[0063] 2.1 PCR amplification of ZNF423 gene sequence and SNP screening

[0064] The above-mentioned 325 chicken individuals were selected, and the blood sample DNA of each individual was used as a template for PCR amplification. The obtained PCR product (nucleotide sequence as shown in SEQ ID NO: 1) was subjected to Sanger first-generation sequencing, and the peak map after sequencing was analyzed. A total of 4 SNP sites were detected, which were: NC_052542.1: g.6451855 (rs312510956), NC_052542.1: g.6451903 (rs14960791), NC_052542.1: g.6452134 (rs14021029), NC_052542.1: g.6452146 (rs13745360) sites, as shown in Table 1.Figure 1 The four sites are as follows: NC_052542.1: g.6451855 (rs312510956) G>A, NC_052542.1: g.6451903 (rs14960791) A>G, NC_052542.1: g.6452134 (rs14021029) A>G, NC_052542.1: g.6452146 (rs13745360) T>C.

[0065] SEQ ID NO: 1 is as follows:

[0066] ACAGCCTGTAACTGGGATTTTAGGAAGGAGGTGGATCTCCAAATCCACGTGAAGCATAGTCATTTGGGGAATCCATCAAAGTCTCACAAATGTATCTTCTGTGGTGAGACTTTTAGCACAGAGGTAGAACTGCAGTGCCACATCACAACCCACAGCAAGAAATACAACTGCAAGTTTTGTAGCAAAGCTTTTCATGCCATCATCTTGCTTGAAAAACACTTGCGGGAAAAACACTGCGTTTTTGATGCGAGCACTGAAAATGGTACAGCTAATGGCATGACCCCAACAAATAAGAAGACAGAAGGGGCAGATATCCAGAACATGTTAATGAAGAATCCAGATACCTCCAACAGTCATGAGGCCAGTGAGGATGATGTAGATGCTTCTGAGCCCATGTACGGCTGTGACATCTGTGGCGCTGCCTACACTATGGAGGTCCTCTTGCAAAACCATCGCTTGAG G GATCATAACATCAGGCCTGGGGAGGACGACTGCTCTAGGAAGAAAGC AGAGTTCATCAAAGGTAGCCACAAGTGTAATATCTGCTCAAGGACCTTTTTCTCAGAAAATGGCCTGAGAGAGCACATGCAGACCCATCGAGGCCCAGCAAAGCACTACATGTGCCCCATCTGTGGGGAGCGCTTCCCGTCGCTCCTGACCCTCACTGAGCACAAAGTCACTCACAGCAAGAGTTTGGATACAGGAACGTGTCGGATCTGCAAAATGCCGCTGCAGAGTGA A GAGGAATTCAT T GAGCACTGCCAGATGCATCCAGACCTCAGAAACTCCCTCACTGGGTTTCGCTGCGTTGTC.

[0067] The underlined and bolded bases in the sequence are mutation sites.

[0068] 2.2 Association analysis of SNP sites of ZNF423 gene sequence and carcass traits

[0069] Association analysis was performed on the above-mentioned four SNP sites and carcass traits (breast angle, breast depth, breast width, live weight, shank length, shank circumference, body slant length, keel length, crown height, carcass weight, subcutaneous fat thickness, intermuscular fat width, half eviscerated weight, whole eviscerated weight, abdominal fat weight, wing weight, breast muscle weight, leg muscle weight, claw weight, breast muscle shear force, leg muscle shear force, drip loss rate, cooking loss rate, breast muscle pH value, leg muscle pH value, breast muscle L value, breast muscle a value, breast muscle b value, leg muscle L value, leg muscle a value, leg muscle b value, dressing percentage, half eviscerated percentage, whole eviscerated percentage, abdominal fat percentage, breast muscle percentage, leg muscle percentage, etc.).

[0070] As shown in Table 2, the results showed that the NC_052542.1:g.6451855 (rs312510956) site was significantly correlated with keel length and dressing percentage (P<0.05), wherein the keel length of the GG genotype was significantly different from that of the AA and GA genotypes (P<0.05), and GG was the dominant genotype; the dressing percentage of the GG genotype was significantly different from that of the AA genotype (P<0.05), and GG was the dominant genotype.

[0071] Table 2 Association of SNP sites and carcass traits

[0072]

[0073] Note: Different superscripts (a-b) indicate significant differences (P<0.05).

[0074] As shown in Table 3, the results show that the NC_052542.1: g.6451903 (rs14960791) site is significantly correlated with the breast muscle a value and the breast muscle b value (P<0.05), and the breast muscle b value of the GG genotype and the AA genotype is significantly different (P<0.05), and the AA genotype is the dominant genotype; the breast muscle a value of the AA genotype and the GG and GA genotypes is significantly different (P<0.05), and the AA genotype is the dominant genotype.

[0075] Table 3 Association of SNP sites with carcass traits

[0076]

[0077] Note: Different superscripts (a-b) indicate significant differences (P<0.05).

[0078] As shown in Table 4, the results show that the NC_052542.1: g.6452134 (rs14021029) site is significantly correlated with the intramuscular fat width (P<0.05), and the intramuscular fat width of the AA genotype and the GA genotype is significantly different (P<0.05); and the GG genotype is the dominant genotype.

[0079] Table 4 Association of SNP sites with carcass traits

[0080]

[0081]

[0082] Note: Different superscripts (a-b) indicate significant differences (P<0.05).

[0083] As shown in Table 5, the results show that the NC_052542.1: g.6452146 (rs13745360) site is significantly correlated with the intramuscular fat width and the keel length (P<0.05), and the intramuscular fat width of the TT genotype and the CC and TC genotypes is significantly different (P<0.05), and the CC genotype is the dominant genotype; and the keel length of the TC genotype and the TT genotype is significantly different (P<0.05), and the TC genotype is the dominant genotype.

[0084] Table 5 Association of SNP sites with carcass traits

[0085]

[0086] Note: Different superscripts (a-b) indicate significant differences (P<0.05).

[0087] The above described embodiments are only to illustrate the preferred modes of the present application, and are not intended to limit the scope of the present application. Any modification and improvement made by those skilled in the art to the technical solutions of the present application without departing from the design spirit of the present application shall fall within the protection scope of the present application.

Claims

1. A method of identifying carcass traits in chickens, characterized in that, The method comprises the following steps: The DNA of the chicken genome to be tested is used as a template to amplify a molecular marker by using a primer pair, the genotypes of four SNP sites on the nucleotide sequence of the molecular marker are analyzed, and the chicken carcass traits are determined according to the genotypes; The nucleotide sequence of the primer pair is shown in SEQ ID NO: 2-3, and the chicken carcass traits are keel length, dressing percentage, breast muscle a value, breast muscle b value and intermuscular fat width; The nucleotide sequence of the molecular marker is shown in SEQ ID NO: 1, and four SNP1-SNP4 sites exist in the sequence shown in SEQ ID NO: 1; SNP1: It is the 462th site, which has G﹥A mutation, and is divided into three genotypes of GG, AA and GA; SNP2: It is the 510th site, which has A﹥G mutation, and is divided into three genotypes of GG, AA and GA; SNP3: It is the 741th site, which has A﹥G mutation, and is divided into three genotypes of GG, AA and GA; SNP4: It is the 753th site, which has T﹥C mutation, and is divided into three genotypes of TT, CC and TC.

2. The method of claim 1, wherein, The genotypes of GG, AA and GA of the SNP1 site are all significantly related to the keel length and the dressing percentage, and the keel length of the GG genotype is higher than that of the AA genotype and the GA; the dressing percentage of the GG genotype is higher than that of the AA genotype; The genotypes of GG, AA and GA of the SNP2 site are all significantly related to the breast muscle a value and the breast muscle b value, and the breast muscle a value of the AA genotype is higher than that of the GG genotype and the AA genotype, and the breast muscle b value of the AA genotype is higher than that of the GG genotype and the AA genotype; The genotypes of GG, AA and GA of the SNP3 site are all significantly related to the intermuscular fat width, and the intermuscular fat width of the GG genotype is lower than that of the AA genotype and the GA genotype; The genotypes of TT, CC and TC of the SNP4 site are all significantly related to the intermuscular fat width and the keel length, and the intermuscular fat width of the CC genotype and the TC genotype is lower than that of the TT genotype, and the keel length of the TC genotype is higher than that of the TT genotype.

3. Use of a molecular marker in the identification of chicken carcass traits, characterized in that, The chicken carcass traits are keel length, dressing percentage, breast muscle a value, breast muscle b value and intermuscular fat width; The nucleotide sequence of the molecular marker is shown in SEQ ID NO: 1, and four SNP1-SNP4 sites exist in the sequence shown in SEQ ID NO: 1; SNP1: It is the 462th site, which has G﹥A mutation, and is divided into three genotypes of GG, AA and GA; SNP2: It is the 510th site, which has A﹥G mutation, and is divided into three genotypes of GG, AA and GA; SNP3: It is the 741th site, which has A﹥G mutation, and is divided into three genotypes of GG, AA and GA; SNP4: It is the 753th site, which has T﹥C mutation, and is divided into three genotypes of TT, CC and TC.

4. The use according to claim 3, wherein the compound is ###0002### The genotypes GG, AA and GA of the SNP1 site are significantly related to keel length and dressing percentage, and the keel length of the GG genotype is higher than that of the AA genotype and GA; the dressing percentage of the GG genotype is higher than that of the AA genotype; The genotypes GG, AA and GA of the SNP2 site are significantly related to breast muscle a value and breast muscle b value, and the breast muscle a value of the AA genotype is higher than that of the GG genotype and AA genotype, and the breast muscle b value of the AA genotype is higher than that of the GG genotype and AA genotype; The genotypes GG, AA and GA of the SNP3 site are significantly related to intermuscular fat width, and the intermuscular fat width of the GG genotype is lower than that of the AA genotype and GA genotype; The genotypes TT, CC and TC of the SNP4 site are significantly related to intermuscular fat width and keel length, and the intermuscular fat width of the CC genotype and TC genotype is lower than that of the TT genotype, and the keel length of the TC genotype is higher than that of the TT genotype.

5. Use of a molecular marker in chicken breeding, characterized in that, The chicken breeding is chicken carcass trait breeding, and the chicken carcass trait is keel length, dressing percentage, breast muscle a value, breast muscle b value and intermuscular fat width; The nucleotide sequence of the molecular marker is shown in SEQ ID NO: 1, and four sites SNP1-SNP4 exist in the sequence shown in SEQ ID NO: 1; SNP1: It is the 462th site, which has G﹥A mutation, and is divided into three genotypes of GG, AA and GA; SNP2: It is the 510th site, which has A﹥G mutation, and is divided into three genotypes of GG, AA and GA; SNP3: It is the 741th site, which has A﹥G mutation, and is divided into three genotypes of GG, AA and GA; SNP4: It is the 753th site, which has T﹥C mutation, and is divided into three genotypes of TT, CC and TC.

6. The use according to claim 5, wherein the compound is ###0002### The genotypes GG, AA and GA of the SNP1 site are significantly related to keel length and dressing percentage, and the keel length of the GG genotype is higher than that of the AA genotype and GA; the dressing percentage of the GG genotype is higher than that of the AA genotype; The genotypes GG, AA and GA of the SNP2 site are significantly related to breast muscle a value and breast muscle b value, and the breast muscle a value of the AA genotype is higher than that of the GG genotype and AA genotype, and the breast muscle b value of the AA genotype is higher than that of the GG genotype and AA genotype; The genotypes GG, AA and GA of the SNP3 site are significantly related to intermuscular fat width, and the intermuscular fat width of the GG genotype is lower than that of the AA genotype and GA genotype; The genotypes TT, CC and TC of the SNP4 site are significantly related to intermuscular fat width and keel length, and the intermuscular fat width of the CC genotype and TC genotype is lower than that of the TT genotype, and the keel length of the TC genotype is higher than that of the TT genotype.