An Indel molecular marker for identifying the strain of Monopterus albus and its application

By developing Indel molecular markers and using primer pairs of specific nucleic acid sequences for PCR amplification, the problem of regional identification of eel strains was solved, and rapid and accurate genetic identification and breeding were achieved.

CN120060500BActive Publication Date: 2025-07-18SHANGHAI OCEAN UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510533873.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-04-27
Publication Date
2025-07-18
Estimated Expiration
2045-04-27

AI Technical Summary

Technical Problem

The existing technology lacks effective methods to target eel strains in different regions, resulting in the destruction of the genetic resources of wild eels and making it difficult to achieve precise breeding.

Method used

An Indel molecular marker was developed, and PCR amplification was performed using primer pairs of nucleic acid sequences shown in SEQ ID NO:3 and SEQ ID NO:4, and the eel lines in Jiangxi and non-Jiangxi regions were identified by the differences in the amplified fragments.

Benefits of technology

It has achieved rapid and accurate identification of eel strains, promoted the domestication and breeding of wild germplasm resources, and improved the accuracy of breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120060500B_ABST
    Figure CN120060500B_ABST
Patent Text Reader

Abstract

The present invention belongs to the technical field of aquaculture molecular breeding, and particularly relates to an Indel molecular marker for identifying the strains of Monopterus albus and its application, which is particularly suitable for identifying the strains of Monopterus albus in Jiangxi region and non-Jiangxi region. The Indel molecular marker for identifying the strains of Monopterus albus is Indel molecular marker A, and Indel molecular marker A contains the nucleic acid sequences shown in SEQ ID NO:3 and SEQ ID NO:4. By using this molecular marker, the strains of Monopterus albus in Jiangxi region and non-Jiangxi region can be quickly identified, which helps to quickly achieve genetic identification, accelerate the domestication and breeding of wild germplasm resources, and achieve precision breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of aquaculture molecular breeding, and particularly relates to an Indel molecular marker for identifying the strains of Monopterus albus, and its application, which is particularly suitable for identifying the strains of Monopterus albus in Jiangxi region and non-Jiangxi region. Background Art

[0002] Monopterus albus, belonging to Synbranchiformes, Synbranchidae, and Monopterus, is widely distributed in paddy fields, swamps and mud ponds in East Asia, South Asia and Southeast Asia. It has many advantages such as good taste, high nutritional value and outstanding flavor, and is known as one of the "characteristic freshwater fish" with economic value in China because of its commercial importance and delicious meat. At present, the resource output is in short supply and the price is high, so its market potential is huge. Jiangxi region belongs to the middle reaches of the Yangtze River Basin, with many natural water systems and crisscrossing artificial canals, making this area one of the regions with the highest river network density in China, having rich Monopterus albus resources and a developed Monopterus albus aquaculture industry. However, the habitats of wild Monopterus albus are decreasing, and its genetic resources are severely damaged. Therefore, it is particularly necessary to accurately and directionally screen high-quality wild resources.

[0003] At present, there is no effective method to directionally screen the strains of Monopterus albus in different regions. Therefore, it is necessary to develop molecular markers for screening the strains of Monopterus albus in specific regions. Molecular markers are genetic markers based on nucleotide sequence variations in the genetic material among individuals, and can reflect specific DNA fragments with certain differences in the genomes among populations. Compared with other morphological markers, cytological markers, microsatellite markers, etc., Indel markers have the advantages of simple operation, high precision and efficiency, high repeatability, etc., and DNA in different tissues at different stages of biological development can be used for marker analysis. Summary of the Invention

[0004] The present invention provides an Indel molecular marker for identifying the strains of Monopterus albus. Using this molecular marker, the strains of Monopterus albus in Jiangxi region and non-Jiangxi region can be quickly identified, which helps to quickly achieve genetic identification, accelerate the domestication breeding of wild germplasm resources, and realize precision breeding.

[0005] On the one hand, the present invention provides an Indel molecular marker for identifying the strains of Monopterus albus.

[0006] On the other hand, the present invention provides an application of the Indel molecular marker for identifying the strains of Monopterus albus.

[0007] On still another hand, the present invention provides a method for identifying the strains of Monopterus albus.

[0008] The technical solution of the present invention is as follows:

[0009] An Indel molecular marker for identifying the strain of Monopterus albus is Indel molecular marker A, and Indel molecular marker A contains the nucleic acid sequences shown in SEQ ID NO:3 and SEQ ID NO:4.

[0010] The above-mentioned Indel molecular marker is used to accurately identify the strains of Monopterus albus in Jiangxi region and / or non-Jiangxi region. The nucleic acid sequence shown in SEQ ID NO:3 is used to accurately identify the strains of Monopterus albus in Jiangxi region, and the nucleic acid sequence shown in SEQ ID NO:4 is used to accurately identify the strains of Monopterus albus in non-Jiangxi region.

[0011] The Jiangxi region includes, but is not limited to, Yichun, Nanchang, Jiujiang, etc. in Jiangxi.

[0012] The non-Jiangxi region includes, but is not limited to, Chongqing, Changsha in Hunan, Weinan in Shaanxi, Ankang in Shaanxi, Kunming in Yunnan, Xiantao in Hubei, Zhanjiang in Guangdong, Zhengzhou in Henan, Nanning in Guangxi, Dandong in Liaoning, Dongying in Shandong, Huai'an in Jiangsu, Baoding in Hebei, Sanya in Hainan, Chengdu in Sichuan, etc.

[0013] Application of a product containing the Indel molecular marker for identifying the strain of Monopterus albus as described above in identifying the strain of Monopterus albus. The product includes, but is not limited to, any one or any combination of primers, probes, reagents, reagent kits, gene chips, devices or equipment, etc.

[0014] A primer of the Indel molecular marker for identifying the strain of Monopterus albus. The primer pair is shown as SEQ ID NO:1 and SEQ ID NO:2, and is used to identify the strain of Monopterus albus.

[0015] At least one of the following products contains the primer of the Indel molecular marker for identifying the strain of Monopterus albus as described above:

[0016] (1) A probe of the Indel molecular marker for identifying the strain of Monopterus albus;

[0017] (2) A reagent of the Indel molecular marker for identifying the strain of Monopterus albus;

[0018] (3) A reagent kit of the Indel molecular marker for identifying the strain of Monopterus albus;

[0019] (4) A gene chip of the Indel molecular marker for identifying the strain of Monopterus albus;

[0020] (5) A device or equipment of the Indel molecular marker for identifying the strain of Monopterus albus.

[0021] A method for identifying eel strains, the steps include: using the eel genomic DNA as a template, amplifying with the primer pairs shown in SEQ ID NO: 1-2 to obtain an amplification product; comparing the amplification product with the Indel molecular marker of the eel strain to identify the eel strain.

[0022] Further, when the nucleic acid sequence of the amplification product is consistent with the Indel molecular marker of the eel strain shown in SEQ ID NO: 3, or the band of the amplification product is 137 bp, it is the eel strain in Jiangxi region; when the nucleic acid sequence of the amplification product is consistent with the Indel molecular marker of the eel strain shown in SEQ ID NO: 4, or the band of the amplification product is 160 bp, it is the eel strain in non-Jiangxi region.

[0023] The advantages of the solution of the present invention are as follows:

[0024] The present invention provides an Indel molecular marker for identifying the eel strain in Jiangxi region. Using the molecular marker primer pairs required for detection provided by the present invention to perform PCR amplification on eel strains in different regions, it can quickly identify whether it is the eel strain in Jiangxi region according to the amplified fragment. Applying the Indel marker provided by the present invention to practice is beneficial to quickly realizing genetic identification, accelerating the domestication and breeding of wild germplasm resources, and realizing precision breeding. Description of the Drawings

[0025] Figure 1 It is the gel electrophoresis diagram of PCR amplification of DNA of 18 eel strains using primer pair 1.

[0026] Among them, the numbers 1-18 respectively represent the following 18 eel strains:

[0027] 1. Yichun, Jiangxi; 2. Nanchang, Jiangxi; 3. Jiujiang, Jiangxi; 4. Chongqing; 5. Changsha, Hunan; 6. Weinan, Shaanxi; 7. Ankang, Shaanxi; 8. Kunming, Yunnan; 9. Xiantao, Hubei; 10. Zhanjiang, Guangdong; 11. Zhengzhou, Henan; 12. Nanning, Guangxi; 13. Dandong, Liaoning; 14. Dongying, Shandong; 15. Huai'an, Jiangsu; 16. Baoding, Hebei; 17. Sanya, Hainan; 18. Chengdu, Sichuan. Detailed Embodiments

[0028] The following examples are only used to further illustrate the content of the present invention, but should not be construed as a limitation to the present invention. Without departing from the spirit and essence of the present invention, the modifications or substitutions made to the methods, steps or conditions of the present invention all belong to the scope of the present invention. The experimental methods without specific conditions and the reagents and materials without the description of the formula in the examples are all according to the conventional conditions in the art, and the reagents used can all be obtained commercially.

[0029] The present invention provides Indel markers for identifying whether the rice field eel is a rice field eel strain in Jiangxi region. The method for obtaining the molecular markers is as follows: Based on the existing rice field eel genome sequence, by re-sequencing the rice field eel strains in different regions, genome-wide association analysis is used to identify the genomic regions where the rice field eel strain in Jiangxi region is different from the rice field eel strains in other regions, which are located at the physical positions of 48875995-48876017 on chromosome 2 (Chr2) and 7926193-7926213 on chromosome 9 (Chr9) of the rice field eel. Select the flanking sequences of 200bp before and after the Indel variation in this genomic region for primer development. After PCR amplification of the Indel markers with the primers, whether the tested rice field eel is a rice field eel strain in Jiangxi region is identified by the difference in the amplified fragments. The amplified fragments that respectively conform to the nucleotide sequence of the Indel marker SEQ ID NO:3 of the present invention are rice field eel strains in Jiangxi region.

[0030] The present invention provides primer pairs for detecting the Indel molecular markers, and their forward and reverse primer sequences are respectively shown in SEQ ID NO:1-2.

[0031] Table 1 Nucleotide sequences of primer pairs

[0032]

[0033] Example 1: Identification of rice field eel strains in 18 regions

[0034] (1) Extraction of genomic DNA of rice field eel samples

[0035] Cut a small piece of tail muscle about 0.5 g of the tested rice field eel, extract genomic DNA using a tissue genomic DNA extraction kit (brand: Tiangen, product number: 69504), detect the purity and concentration of the obtained DNA sample using a NanoDrop2000 spectrophotometer, and the extracted DNA can be stored at -20°C for a long time.

[0036] (2) PCR amplification of Indel marker fragments

[0037] Using the above-obtained genomic DNA of rice field eel as a template, PCR amplification is carried out using the primer pair with the nucleotide sequences shown in primer pair 1 SEQ ID NO:1-2 in Table 1.

[0038] Use a pre-mixed PCR kit with dye (brand: TaKaRa, product number: RR903A) to prepare the following 20μl reaction system: Premix Taq 10μl, 0.5μl of 10μM forward primer, 0.5μl of 10μM reverse primer, 1μl of template DNA, and supplement ddH2O to a total volume of 20μl.

[0039] The procedure for PCR amplification is as follows: pre-denaturation at 98°C for 10 min, denaturation at 98°C for 10 s, annealing at 60°C for 30 s, extension at 72°C for 1 min, with 35 cycles, and extension at 72°C for 5 min.

[0040] (3)Perform agarose gel electrophoresis on the amplified product

[0041] Prepare a 2% agarose gel, add the above PCR amplified product and use 50 bp DNA marker as a label for electrophoresis. Set the electrophoresis conditions as voltage 110V and electrophoresis time 60 min. Use a gel imaging system to take pictures of the bands to obtain gel pictures.

[0042] (4)Identify the amplified product

[0043] Identify according to the bands on the gel picture or the sequencing results of the PCR amplified product (sequencing was performed by Shanghai Sangon Biotech Co., Ltd.).

[0044] When the band shown on the electrophoresis gel of primer pair 1 is at 137 bp or the sequencing result of the amplified product is as shown in SEQ ID NO:3, the eel tested is the eel strain from Jiangxi region; if the band shown is at 160 bp or the sequencing result of the amplified product is as shown in SEQ ID NO:4, the eel tested is the eel strain from non-Jiangxi region.

[0045] CACTGCTGTGAAATTCCTGCTTGACCTGCCACATTATTCAGAGAAACAACTAATGGTAAGTCCATTCATTTCCTTTGTTTTAACAAGCTTATACAAATTCTCTTTTTATAATCTGAACGAGCATGGATTGGAGAAGT (SEQ ID NO:3)

[0046] CACTGCTGTGAAATTCCTGCTTGACCTGCCACATTATTCAGAGAAACAACTAATGGTAAGTCCATGTCAGCATGTTTTAAAAGTTCATTCATTTCCTTTGTTTTAACAAGCTTATACAAATTCTCTTTTTATAATCTGAACGAGCATGGATTGGAGAAGT (SEQ ID NO:4)

[0047] There is a deletion of the following sequence at the 63 - 85 bp of the sequence shown in SEQ ID NO:4: CATGTCAGCATGTTTTAAAAGTT, and the corresponding one is SEQ ID NO:3.

[0048] The experimental results are respectively as Figure 1 shown below.

[0049] Figure 1 For the amplification product bands of Samples 1-3, they are located at 137 bp, and for Samples 4-18, the amplification bands are located at 160 bp.

[0050] It can be clearly seen from Figure 1 that Samples 1-3 from Yichun, Nanchang and Jiujiang in Jiangxi are indeed the rice field eel strains in Jiangxi region, while Samples 4-18 of rice field eels are from other regions respectively.

[0051] The above results indicate that the Indel marker A described above can effectively identify whether it is a rice field eel strain in Jiangxi region. Therefore, the Indel marker provided by the present invention can be applied to the rapid identification of germplasm resources of specific geographical strains, so as to obtain the excellent traits of the strain and finally achieve precision breeding.

Claims

1. An Indel molecular marker for identifying the strain of Monopterus albus, characterized in that, It is Indel molecular marker A, and Indel molecular marker A contains the nucleic acid sequences shown in SEQ ID NO:3 and SEQ ID NO:

4.

2. Use of the product for identifying the Indel molecular marker according to claim 1 in identifying the strain of Monopterus albus.

3. The application according to claim 2, wherein The product includes primers, and / or probes, and / or kits, and / or devices.

4. A primer for identifying the Indel molecular marker according to claim 1, characterized in that, The primer pair is shown as SEQ ID NO:1 and SEQ ID NO:

2.

5. At least one of the following products contains the primer according to claim 4: (1) Probe for Indel molecular marker for identifying the strain of Monopterus albus; (2) Kit for Indel molecular marker for identifying the strain of Monopterus albus; (3) Gene chip for Indel molecular marker for identifying the strain of Monopterus albus; (4) Device for Indel molecular marker for identifying the strain of Monopterus albus.

6. A method for identifying a rice field eel strain, characterized in that the steps It includes: Using the genomic DNA of Monopterus albus as a template, amplifying with the primer according to claim 4 or the product according to claim 5 to obtain an amplification product; Comparing the amplification product with the Indel molecular marker described in claim 1 to identify the strain of Monopterus albus.

7. The identification method according to claim 6, characterized in that When the nucleic acid sequence of the amplification product is consistent with the Indel molecular marker shown in SEQ ID NO:3 in claim 1, or when the band of the amplification product is 137bp, it is the strain of Monopterus albus in Jiangxi region; when the nucleic acid sequence of the amplification product is consistent with the Indel molecular marker shown in SEQ ID NO:4 in claim 1, or when the band of the amplification product is 160bp, it is the strain of Monopterus albus in non-Jiangxi region.

Citation Information

Patent Citations

  • Indel molecular marker for identifying ricefield eel strain in southwest region and application of Indel molecular marker

    CN119265316A

  • Indel molecular marker for identifying ricefield eel strains in two Guangdong regions and application of Indel molecular marker

    CN119639914A