A porcine parvovirus VP2 double antibody sandwich quantitative detection kit and application thereof

Abstract

The application discloses a double-antibody sandwich ELISA kit for specifically and quantitatively detecting porcine parvovirus effective antigen protein VP2 and application thereof. The kit comprises an enzyme-linked reaction plate coated with a monoclonal antibody capable of specifically combining with the porcine parvovirus VP2 antigen as a capture antibody and an enzyme-labeled antibody. The application immunizes mice with purified porcine parvovirus VP2 protein expressed by an insect baculovirus system, and screens hybridoma cell strains PPV-VP2-11F3 and PPV-VP2-12C4 which respectively secrete antibodies PPV-11F3 and PPV-12C4. The former is used as a capture antibody, and the latter is coupled with HRP to be used as a detection antibody to establish a double-antibody sandwich ELISA method. The method can specifically recognize PPV and does not have cross reactions with PRV, PCV2, CSFV and PRRSV viruses, has high sensitivity and good repeatability, and can effectively detect the content of the porcine parvovirus effective antigen protein VP2 in a sample.

Description

Technical Field

[0001] This invention belongs to the field of biodetection technology, and more specifically, relates to a double-antibody sandwich ELISA kit for porcine parvovirus VP2 protein, which is suitable for the specific, rapid and accurate quantitative detection of porcine parvovirus VP2 antigen. Background Technology

[0002] Porcine parvovirus (PPV) was first discovered by Mary and Mahnel in 1966. Since then, it has been detected in many countries and regions in Europe, America, and Asia, and is now widespread globally. PPV is susceptible to pigs of all ages. Infected pregnant sows can cause obvious clinical symptoms such as abortion, fetal malformations, and mummified fetuses. Boars, finishing pigs, and piglets can also be infected and carry the virus, but clinical symptoms are often not obvious, which poses a challenge to the prevention and control of the disease. The VP2 protein of PPV is the main protein constituting the viral capsid, containing the main B-cell epitopes and T-cell epitopes of PPV. It is the main immunogenic protein of PPV, therefore, the VP2 protein has become an important focus of research in the clinical diagnosis, immunology, and vaccines of porcine parvovirus disease.

[0003] The quality of a vaccine is closely related to the content of its effective antigens. Currently, the quantitative method for porcine parvovirus inactivated vaccine semi-finished products uses TCID50. 50 Two methods, hemagglutination and thrombosis, were used for finished product evaluation: blood titer measurement was performed using blood samples from immunized guinea pigs or pigs. TCID 50The assay is a classic method for evaluating viral load by observing the lesions produced in infected cells. However, this method is time-consuming and only applicable to the quantification of whole-virus vaccine semi-finished products. It is not suitable for subunit vaccines or other vaccines that do not contain live porcine parvovirus. The hemagglutination and hemagglutination inhibition assays utilize the hemagglutinin carried by intact PPV virus particles, which can cause agglutination of red blood cells in some animals in vitro. When antibodies against porcine parvovirus bind to the antigen, they eliminate the agglutination effect on red blood cells. This method has advantages such as ease of operation, short processing time, low cost, and suitability for batch testing. However, its sensitivity and specificity are relatively low. In clinical practice, some corporate clients use the simple quantitative fluorescence method to assess the quality of finished vaccines. This method relies on the specificity of primers and probes, offering advantages such as speed, sensitivity, and specificity. However, it often involves nucleic acid extraction, which is highly susceptible to aerosol contamination, leading to a high false-positive rate. Furthermore, the degree of damage to nucleic acids caused by inactivating agents during antigen production varies, making this method ineffective in reflecting vaccine quality. Therefore, establishing a simple, convenient detection method that accurately reflects the effective antigen content in vaccines is essential. Enzyme-linked immunosorbent assay (ELISA) is a solid-phase enzyme immunoassay that combines the specificity of antigen-antibody reactions with the high efficiency of enzyme-substrate reactions. Due to its strong specificity, high sensitivity, good repeatability, ease of operation, and batch testing capabilities, it is now widely used for the detection of various viruses.

[0004] This invention utilizes the monoclonal antibody PPV-11F3 of the porcine parvovirus VP2 protein as a capture antibody and the enzyme-labeled antibody prepared from the monoclonal antibody PPV-12C4 of the porcine parvovirus VP2 protein as a detection antibody to establish a rapid quantitative detection method for porcine parvovirus using a double-antibody sandwich ELISA. During the reaction, the two antibodies bind to different antigenic determinants of the antigen molecule, greatly improving the specificity of the detection and resulting in more reliable results. The double-antibody sandwich ELISA method is simple to operate, time-saving, and requires relatively low expertise from the operators. Furthermore, the reagents used in the double-antibody sandwich ELISA method are widely available and inexpensive, making the method universally applicable and suitable for large-scale sample testing, thus more suitable for widespread practical application. This method can not only be used for vaccine quality control in factory production but also can be used in conjunction with vaccines, which has profound significance for providing high-quality services to customers. Summary of the Invention

[0005] The purpose of this invention is to provide a double-antibody sandwich ELISA kit for the specific quantitative detection of porcine parvovirus effective antigen protein VP2. This kit utilizes a monoclonal antibody PPV-11F3 that specifically binds to the porcine parvovirus VP2 protein as a capture antibody, and an enzyme-labeled antibody prepared from a monoclonal antibody PPV-12C4 that specifically binds to the porcine parvovirus VP2 protein as a detection antibody. This establishes a method for the quantitative detection of porcine parvovirus effective antigen protein with good specificity, sensitivity, and repeatability. It is used to detect the content of porcine parvovirus effective antigen protein VP2 in culture medium, inactivation solution, concentrate, and demulsified finished vaccine during the production of whole-virus inactivated or subunit porcine parvovirus vaccines.

[0006] To achieve the above objectives, the present invention provides a double-antibody sandwich ELISA kit for the specific quantitative detection of porcine parvovirus effective antigen content, comprising an enzyme-linked immunosorbent assay (ELISA) plate coated with a capture antibody and a detection antibody; the capture antibody is a monoclonal antibody PPV-11F3 specifically binding to the porcine parvovirus VP2 protein; the detection antibody is an enzyme-labeled antibody prepared from a monoclonal antibody PPV-12C4 specifically binding to the porcine parvovirus VP2 protein. Preferably, the enzyme-labeled antibody is a horseradish peroxidase-labeled antibody, wherein the horseradish peroxidase can be cross-linked onto the antibody using the glutaraldehyde method.

[0007] Preferably, the capture antibody (monoclonal antibody PPV-11F3) contains the heavy chain variable region PPV-11F3-V. H and light chain variable region PPV-11F3-V L The PPV-11F3-V H and the PPV-11F3-V L The complementary regions of the determinant clusters are all composed of CDR1, CDR2, and CDR3; the PPV-11F3-V H The CDR1 amino acid sequence is shown as amino acids 31-35 of SEQ ID No. 1; the PPV-11F3-V H The CDR2 amino acid sequence is shown as amino acids 50-65 of SEQ ID No. 1; the PPV-11F3-V H The CDR3 amino acid sequence is shown as amino acids 99-111 of SEQ ID No. 1; the PPV-11F3-V L The CDR1 amino acid sequence is shown as amino acids 23-37 of SEQ ID No. 2; the PPV-11F3-V L The CDR2 amino acid sequence is shown as amino acids 52-59 of SEQ ID No. 2; the PPV-11F3-V LThe amino acid sequence of CDR3 is shown as amino acids 94-104 of SEQ ID No. 2.

[0008] Preferably, the detection antibody (monoclonal antibody PPV-12C4) contains the heavy chain variable region PPV-12C4-V. H and light chain variable region PPV-12C4-V L The PPV-12C4-V H and the PPV-12C4-V L The complementary regions of the determinant clusters are all composed of CDR1, CDR2, and CDR3; the PPV-12C4-V H The CDR1 amino acid sequence is shown as amino acids 31-35 of SEQ ID No. 3; the PPV-12C4-V H The CDR2 amino acid sequence is shown as amino acids 50-64 of SEQ ID No. 3; the PPV-12C4-V H The CDR3 amino acid sequence is shown as amino acids 99-105 of SEQ ID No. 3; the PPV-12C4-V L The CDR1 amino acid sequence is shown as amino acids 24-39 of SEQ ID No. 4; the PPV-12C4-V L The CDR2 amino acid sequence is shown as amino acids 55-61 of SEQ ID No. 4; the PPV-12C4-V L The amino acid sequence of CDR3 is shown as amino acids 94-102 of SEQ ID No. 4.

[0009] Preferably, the PPV-11F3-V H The amino acid sequence is shown in SEQ ID No. 1; the PPV-11F3-V L The amino acid sequence is shown in SEQ ID No. 2.

[0010] Preferably, the PPV-12C4-V H The amino acid sequence is shown in SEQ ID No. 3; the PPV-12C4-V L The amino acid sequence is shown in SEQ ID No. 4.

[0011] The optimal coating preparation method and conditions for the enzyme-linked reaction plate are as follows: the capture antibody (monoclonal antibody PPV-11F3) is diluted with carbonate solution at pH 9.6 to a coating working solution of 1 μg / ml, and then added to a 96-well polystyrene enzyme-linked reaction plate at 100 μl / well. The plate is incubated at 2-8°C for 8-12 hours to allow the capture antibody (monoclonal antibody PPV-11F3) to fully bind to the enzyme-linked reaction plate. Then, 300 μl of PBS buffer containing 10 mg / ml bovine serum albumin at pH 7.4 is added to the plate, and the plate is blocked at 37°C for 2-3 hours. After drying, the plate is sealed and stored at 2-8°C.

[0012] Preferably, the kit also includes a porcine parvovirus VP2 protein standard. The porcine parvovirus VP2 protein standard is obtained by inoculating recombinant porcine parvovirus VP2 baculovirus (deposited at the China General Microbiological Culture Collection Center, accession number CGMCC NO. 45384) into insect sf9 cells, then culturing them in a constant temperature shaking incubator at 27°C and 120 rpm. When the cell viability is below 20%, the cells are harvested. The harvested culture is centrifuged at 8,000 rpm for 10 minutes, and the supernatant is loaded onto an anion exchange chromatography column for purification to obtain purified porcine parvovirus VP2 protein with a purity of not less than 85% and a protein content of 50 μg / ml. The purified protein is aliquoted into 100 μl tubes, labeled, and stored below -70°C for later use. When using, it is serially diluted (1:500-1:32000) with the sample diluent. The measured OD... 450 The value is used to plot the standard curve.

[0013] The kit of this invention is a double-antibody sandwich enzyme-linked immunosorbent assay kit made with a monoclonal antibody specific to porcine parvovirus VP2 protein. It quantitatively detects the content of the effective antigen protein VP2 of porcine parvovirus in a sample by detecting the signal change generated by the enzyme catalyzing the substrate.

[0014] Furthermore, the kit also includes sample diluent, 20-fold concentrated wash buffer, substrate solution A, substrate solution B, and stop solution. The enzyme-linked reaction plate is a removable 96-well microplate. The sample diluent is a 0.01 mol / L phosphate buffer containing 5 mg / ml casein, pH 7.4. The 20-fold concentrated wash buffer is a 0.01 mol / L phosphate buffer containing 0.8%-1.2% (ml / ml) Tween-20, pH 7.4. Substrate solution A is a citrate phosphate buffer containing 0.6 mg / ml hydrogen peroxide urea, and substrate solution B is a 0.2 mg / ml tetramethylbenzidine solution, which are mixed at a 1:1 volume ratio before use. The stop solution is a 2 mol / L sulfuric acid solution.

[0015] This invention also claims protection for monoclonal antibodies that specifically bind to the porcine parvovirus effective antigen protein VP2, and are monoclonal antibodies according to any of the following:

[0016] (1) Contains PPV-11F3-V with heavy chain variable region H and light chain variable region PPV-11F3-V L The heavy chain variable region PPV-11F3-V H and light chain variable region PPV-11F3-V L Both are composed of cluster complement regions and frame regions; the PPV-11F3-V H and the PPV-11F3-V L The complementary regions of the determinant clusters are all composed of CDR1, CDR2, and CDR3; the PPV-11F3-V H The CDR1 amino acid sequence is shown as amino acids 31-35 of SEQ ID No. 1; the PPV-11F3-V H The CDR2 amino acid sequence is shown as amino acids 50-65 of SEQ ID No. 1; the PPV-11F3-V H The CDR3 amino acid sequence is shown as amino acids 99-111 of SEQ ID No. 1; the PPV-11F3-V L The CDR1 amino acid sequence is shown as amino acids 23-37 of SEQ ID No. 2; the PPV-11F3-V L The CDR2 amino acid sequence is shown as amino acids 52-59 of SEQ ID No. 2; the PPV-11F3-V L The amino acid sequence of CDR3 is shown as amino acids 94-104 of SEQ ID No. 2.

[0017] (2) Contains PPV-12C4-V with heavy chain variable region H and light chain variable region PPV-12C4-V L The heavy chain variable region PPV-12C4-V H and light chain variable region PPV-12C4-V L Both are composed of cluster complementary regions and frame regions; the PPV-12C4-V H and the PPV-12C4-V L The complementary regions of the determinant clusters are all composed of CDR1, CDR2, and CDR3; the PPV-12C4-V H The CDR1 amino acid sequence is shown as amino acids 31-35 of SEQ ID No. 3; the PPV-12C4-V HThe CDR2 amino acid sequence is shown as amino acids 50-64 of SEQ ID No. 3; the PPV-12C4-V H The CDR3 amino acid sequence is shown as amino acids 99-105 of SEQ ID No. 3; the PPV-12C4-V L The CDR1 amino acid sequence is shown as amino acids 24-39 of SEQ ID No. 4; the PPV-12C4-V L The CDR2 amino acid sequence is shown as amino acids 55-61 of SEQ ID No. 4; the PPV-12C4-V L The amino acid sequence of CDR3 is shown as amino acids 94-102 of SEQ ID No. 4.

[0018] (3) Contains PPV-11F3-V with heavy chain variable region H and light chain variable region PPV-11F3-V L The PPV-11F3-V H The amino acid sequence is shown in SEQ ID No. 1; the PPV-11F3-V L The amino acid sequence is shown in SEQ ID No. 2.

[0019] (4) Contains PPV-12C4-V with heavy chain variable region H and light chain variable region PPV-12C4-V L The PPV-12C4-V H The amino acid sequence is shown in SEQ ID No. 3; the PPV-12C4-V L The amino acid sequence is shown in SEQ ID No. 4.

[0020] By using the above-mentioned heavy chain variable region and light chain variable region sequences, they can be linked with animal-derived constant regions (such as the heavy chain and light chain constant regions of mouse antibodies) to prepare monoclonal antibodies that can specifically bind to the effective antigen protein VP2 of porcine parvovirus.

[0021] The application of the above-mentioned double-antibody sandwich ELISA kit in the specific detection of the content of porcine parvovirus effective antigen protein VP2 is also within the scope of protection of this invention.

[0022] The application of the monoclonal antibody that can specifically bind to the effective antigen protein VP2 of porcine parvovirus in the preparation of a kit for detecting porcine parvovirus is also within the scope of protection of this invention.

[0023] The method for obtaining the monoclonal antibody that can specifically bind to the effective antigen protein VP2 of porcine parvovirus is as follows: BALB / c mice are immunized with porcine parvovirus VP2 protein expressed by recombinant baculovirus. Spleen cells from the immunized mice are fused with SP2 / 0 cells. The supernatant of the fusion cells is screened by indirect immunofluorescence to identify monoclonal cell lines secreting PPV-11F3 and PPV-12C4 as monoclonal cell lines for specific detection of porcine parvovirus VP2 protein. The gene sequences of the two specific monoclonal cell lines are determined by gene sequencing. Stable monoclonal antibodies PPV-11F3 and PPV-12C4 are prepared by gene synthesis and construction of recombinant expression vectors. After pairing, monoclonal antibody PPV-11F3 is used as the capture antibody of the present invention, and enzyme-labeled antibody prepared from monoclonal antibody PPV-12C4 is used as the detection antibody of the present invention.

[0024] The detection procedure of the reagent kit of this invention is as follows:

[0025] (1) Equilibration: Remove the kit from the storage environment at 2-8℃ and let it equilibrate at room temperature for 30 minutes before use; mix the liquid reagents before use.

[0026] (2) Solution preparation: Dilute the 20-fold concentrated washing solution with distilled water or deionized water 20 times to obtain the washing buffer working solution.

[0027] (3) Sample dilution: The porcine parvovirus VP2 protein standard was diluted 1:500 to 1:32000 times with sample dilution buffer, corresponding to concentrations of 100ng / ml, 50ng / ml, 25ng / ml, 12.5ng / ml, 6.2ng / ml, 3.1ng / ml and 1.6ng / ml respectively. The test samples were also diluted 3 to 6 times with sample dilution buffer.

[0028] (4) Sample addition: Take out the required strips, put the remaining strips into an aluminum foil bag, seal it, and store it at 2-8℃ for later use. Add the diluted test sample, the diluted porcine parvovirus VP2 protein standard, and the negative control sample (only add sample diluent) to the coated plate, 100 μl / well, repeat for 3 wells. The sample addition process should be as short as possible.

[0029] (5) Incubation: Shake to mix well, place in a 37°C incubator, and react for 30 minutes.

[0030] (6) Washing: Discard the reaction solution, add 300 μl of washing buffer working solution per well, soak for 15 seconds, discard the washing solution, wash the plate 4 times and then pat dry.

[0031] (7) Add HRP-labeled detection antibody: Dilute HRP-labeled detection antibody at 1:4000, 100 μl / well.

[0032] (8) Incubation: Shake to mix well, place in a 37°C incubator, and react for 30 minutes.

[0033] (9) Washing: Discard the reaction solution, add 300 μl of washing buffer working solution per well, soak for 15 seconds, discard the washing solution, wash the plate 4 times and then pat dry.

[0034] (10) Color development: Add 100 μl of substrate working solution (the substrate working solution is obtained by mixing equal volumes of substrate solution A and substrate solution B, and should be prepared fresh before use), shake to mix, and place in a 37°C incubator for 15 minutes in the dark.

[0035] (11) Termination: Add 50 μl of termination solution per well and shake to terminate the reaction.

[0036] (12) Microplate reader detection: OD of each well was measured using a microplate reader. 450nm The value should be measured within 15 minutes after the stop solution is added to terminate the reaction.

[0037] (13) Results Analysis: Porcine parvovirus VP2 protein standard (100 ng / ml) well OD 450nm The value should be ≥2.9, otherwise it is invalid; OD of the cathode control aperture. 450nm The value should be ≤0.25, otherwise it is invalid; Concentration calculation: based on the OD of each well of the protein standard. 450nm Average value minus cathode control hole OD 450nm The average value was used as the Y-axis, and the protein concentration of each well of the protein standard was used as the X-axis to plot a standard curve. The content of porcine parvovirus effective antigen protein VP2 in each sample was calculated.

[0038] In the above detection methods, the selection of the test sample can be diverse, such as culture medium, inactivation solution, concentrate and finished vaccine after demulsification during the production of porcine parvovirus whole virus inactivated vaccine or subunit vaccine.

[0039] The result analysis method in step (13) can be as follows: use EXCEL program → "Insert" → "Scatter Plot" → use the OD of each well of the protein standard. 450nm Average value minus cathode control hole OD 450nm Use the average value as the Y-axis and the protein concentration of each well of the protein standard as the X-axis → Add a trendline → Select "Linear" → Select "Display Formula" and "Display R-squared". Typically, R... 2 A value ≥0.98 indicates a reliable standard curve. Each 96-well plate should include wells for porcine parvovirus VP2 protein standards, and a corresponding standard curve should be plotted. The OD values ​​of each well should be calculated according to the formula. 450nm Average value minus cathode control hole OD 450nmThe average value is used to calculate the VP2 protein concentration in the sample.

[0040] The positive effects of this invention are as follows: This invention provides a double-antibody sandwich ELISA kit for accurate quantification of porcine parvovirus effective antigen protein VP2. This kit is a double-antibody enzyme-linked immunosorbent assay kit made with two specific monoclonal antibodies against porcine parvovirus VP2 protein. It quantifies the content of porcine parvovirus effective antigen protein VP2 in a sample by detecting signal changes generated by enzyme catalysis of the substrate. It features high sensitivity, good specificity, good repeatability, and convenient operation, and does not exhibit cross-reactivity with PRV, PCV2, CSFV, or PRRSV. The development of this kit provides a more convenient and effective method for quality control in porcine parvovirus vaccine production, and has broad market prospects and good economic and social benefits. Attached Figure Description

[0041] Figure 1 SDS-PAGE results for expression and purification of porcine parvovirus VP2 protein.

[0042] M: Protein Marker; 1: Supernatant of porcine parvovirus VP2 protein recombinant baculovirus expression; 2: Purified porcine parvovirus VP2 protein.

[0043] Figure 2 The results are the indirect immunofluorescence results of two monoclonal antibodies and a recombinant baculovirus expressing porcine parvovirus VP2 protein.

[0044] Figure 3 SDS-PAGE results of purified porcine parvovirus VP2 protein-specific monoclonal antibodies PPV-11F3 and PPV-12C4.

[0045] A: SDS-PAGE of purified porcine parvovirus VP2 protein-specific monoclonal antibody PPV-11F3; M: Protein Marker.

[0046] B: SDS-PAGE of purified porcine parvovirus VP2 protein-specific monoclonal antibody PPV-12C4; M: Protein Marker.

[0047] Figure 4 Standard curve for the porcine parvovirus VP2 double antibody sandwich quantitative detection kit.

[0048] Preservation of biological materials

[0049] Accession number: CGMCC No. 45384

[0050] Name: Re-VP

[0051] Classification and nomenclature: Insect baculovirus

[0052] Deposit date: January 6, 2023

[0053] Preservation Institution: China General Microbiological Culture Collection Center (CGMCC)

[0054] Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing

[0055] Survival status: Yes. Detailed Implementation

[0056] Unless otherwise specified, the methods described in the following embodiments are conventional methods.

[0057] The methods for obtaining various biological materials described in the embodiments are merely to provide experimental methods for specific disclosure purposes and should not be construed as limiting the sources of biological materials used in this invention. In fact, the sources of biological materials used are wide-ranging, and any biological material that is obtainable without violating laws and ethics can be substituted and used according to the suggestions in the embodiments.

[0058] The embodiments are implemented based on the technical solution of the present invention, and provide detailed implementation methods and specific operation processes. The embodiments will help to understand the present invention, but the protection scope of the present invention is not limited to the following embodiments.

[0059] Example 1: Screening of hybridoma cell lines specific to porcine parvovirus VP2 protein monoclonal antibody

[0060] 1. Antigen preparation

[0061] Recombinant porcine parvovirus VP2 baculovirus (deposited at the China General Microbiological Culture Collection Center, accession number CGMCC NO.45384) constructed based on the VP2 protein sequence of porcine parvovirus strain LX isolated in the laboratory (SEQ ID No. 5) was inoculated into sf9 cells at 5% and then cultured in a constant temperature shaking incubator at 27°C and 120 rpm. When the cell viability was below 20%, the cells were harvested. The harvested culture medium was centrifuged at 8,000 rpm for 10 minutes, and the supernatant was filtered through a 0.22 μm filter membrane for later use.

[0062] The supernatant was purified using an anion exchange chromatography column. The column was loaded with equilibration buffer (50 mM Tris, pH 8.0) until baseline equilibration. The supernatant was then loaded onto the column, and the flow-through was collected. After sample loading, unbound proteins were eluted to baseline with equilibration buffer (50 mM Tris, pH 8.0). Impurities were eluted with washing buffer (50 mM Tris, 200 mM NaCl, pH 8.0), and the target protein was eluted with elution buffer (50 mM Tris, 500 mM NaCl, pH 8.0). This yielded the purified porcine parvovirus VP2 protein. Figure 1 The protein, with a purity of not less than 85%, is adjusted to a concentration of 50 μg / ml and used as an immunogen.

[0063] 2. Immunization of BALB / c mice

[0064] BALB / c mice (purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd.) were immunized with recombinant porcine parvovirus VP2 protein as an immunogen. The mice were immunized four times consecutively, with an interval of 14 days between each immunization. The first three immunizations were administered via subcutaneous injection at multiple sites, and the fourth immunization was administered via intraperitoneal injection. Each immunization was 50 μg per animal.

[0065] 3. Cell fusion

[0066] Seven days after the last immunization, serum was separated from tail blood of mice and detected by indirect ELISA. The indirect ELISA method was performed according to the antigen coating concentration (0.5 μg / ml) and enzyme-labeled secondary antibody dilution (1:5000) determined by the checkerboard titration method, and the steps are as follows:

[0067] (1) Coating: The purified porcine VP2 protein was diluted to 0.5 μg / ml with carbonate solution at pH 9.6, and then added to a 96-well polystyrene ELISA plate at 100 μl / well. The plate was placed at 2-8℃ for 8-12 hours to allow the coating antigen to fully bind to the ELISA plate.

[0068] (2) Blocking: Discard the coating solution, add 300 μl of PBS buffer containing 10 mg / ml bovine serum albumin at pH 7.4, block at 37°C for 2-3 hours, spin dry, and store at 2-8°C after the enzyme-linked reaction plate has dried.

[0069] (3) Add the sample to be tested: use sample dilution buffer (0.01mol / L phosphate buffer containing 5mg / ml casein, pH7.4) for serial dilution, 100μl / well, add 100μl SP2 / 0 culture supernatant to negative control well, shake to mix, and place in a 37℃ incubator for 30 minutes.

[0070] (4) Washing: Discard the reaction solution, add washing buffer working solution (containing 0.01mol / L phosphate buffer with a concentration of 0.8%-1.2% (ml / ml) Tween-20, pH 7.4, diluted 20 times with distilled water or deionized water before use), 300μl / well, soak for 15 seconds, discard the washing solution, wash the plate 4 times consecutively and then pat dry.

[0071] (5) Add enzyme-labeled secondary antibody: Dilute rabbit anti-mouse IgG-HRP enzyme-labeled secondary antibody (purchased from Sigma, USA) at a ratio of 1:5000, 100 μl / well, shake to mix, and place in a 37℃ incubator for 30 minutes.

[0072] (6) Washing: Discard the reaction solution, add 300 μl of washing buffer working solution per well, soak for 15 seconds, discard the washing solution, wash the plate 4 times and then pat dry.

[0073] (7) Color development: Add equal volumes of substrate working solution, namely substrate solution A (citric acid phosphate buffer containing 0.6 mg / ml hydrogen peroxide urea) and substrate solution B (0.2 mg / ml tetramethylbenzidine solution), mix 100 μl / well, shake to mix, and place in a 37°C incubator to react in the dark for 15 minutes.

[0074] (8) Termination: Add 50 μl of the termination solution (2 mol / L sulfuric acid solution) to each well and shake to mix and terminate the reaction.

[0075] (9) Microplate reader detection: OD of each well was measured using a microplate reader. 450nm The value should be measured within 15 minutes after the stop solution is added to terminate the reaction.

[0076] (10) Result determination: Based on P (sample positive well OD) 450nm Value) / N (sample negative well OD) 450nm A P / N value ≥ 2.1 is considered positive; a P / N < 2.1 is considered negative.

[0077] When the titer exceeds 1:25600, spleen cells from immunized animals can be isolated and prepared into a single-cell suspension. Under the induction of an appropriate fusion agent (such as polyethylene glycol), the suspension is fused with myeloma cells (preferably mouse myeloma cells SP2 / 0). The fused hybridoma cells are then cultured in HAT medium to screen for fusion.

[0078] 4. Indirect immunofluorescence screening of hybridoma cell supernatant

[0079] Hybridoma cell culture supernatant was used as the primary antibody to incubate sf9 cells inoculated with recombinant porcine parvovirus VP2. FITC-labeled goat anti-mouse IgG (purchased from ThermoFisher) was used as the secondary antibody for indirect immunofluorescence screening. The specific steps are as follows:

[0080] (1) Plating: Dilute insect sf9 cells to 2×10⁻⁶ 6 Add 100 μl per well, cells / ml, until the adherent cell density reaches 85% or more.

[0081] (2) Baculovirus infection: Discard the culture medium, add recombinant porcine parvovirus VP2, 100 μl / well, and incubate at 27°C for 3 days.

[0082] (3) Washing: Discard the virus solution, add PBS buffer, 200 μl / well, wash the plate 3 times consecutively, 2-3 minutes each time, and gently pat dry after washing.

[0083] (4) Fixation: Add cell fixation solution (e.g., 4% paraformaldehyde), 100 μl / well, and fix at -20℃ for 1 hour.

[0084] (5) Washing: Discard the fixative, add PBS buffer, 200 μl / well, and wash the plate 3 times consecutively, 2-3 minutes each time.

[0085] (6) Primary antibody: Add 80 μl of hybridoma cell culture supernatant to each well and incubate at 37°C for 1 hour.

[0086] (7) Washing: Discard the primary antibody, add PBS buffer, 200 μl / well, and wash the plate 3 times consecutively, 2-3 minutes each time.

[0087] (8) Secondary antibody: Add FITC-labeled goat anti-mouse IgG (1:400 dilution), 100 μl / well, and incubate at 37°C in the dark for 1 hour.

[0088] (9) Washing: Under light-protected conditions, discard the secondary antibody, add PBS buffer, 200 μl / well, and wash the plate 3 times consecutively, 2-3 minutes each time.

[0089] (10) Observation: Observe the fluorescence results using an inverted fluorescence microscope.

[0090] Wells exhibiting distinct green fluorescent cell morphology were selected by fluorescence microscopy. Figure 2 Positive hybridoma cell lines PPV-VP2-11F3 and PPV-VP2-12C4 were selected from 96-well cell cultures.

[0091] 5. Specific identification of positive hybridoma cell supernatant

[0092] The cross-reactivity of the selected positive hybridoma cell culture supernatant with porcine pseudorabies virus (PRV), porcine circovirus type 2 (PCV2), classical swine fever virus (CSFV), porcine reproductive and respiratory syndrome virus (PRRSV), recombinant porcine circocap protein (baculovirus expression), and sf9 cell culture medium was identified using the indirect ELISA method established in Example 1, and the results are shown in Table 1.

[0093] Table 1. Results of specific detection of positive hybridoma cell supernatant

[0094]

[0095] Note: "+" represents positive; "-" represents negative.

[0096] Example 2: Gene sequencing of a specific hybridoma cell line for porcine parvovirus VP2 protein monoclonal antibody and establishment of a recombinant monoclonal antibody expression system.

[0097] 1. Sequencing of specific hybridoma cell lines

[0098] (1) Extraction of total RNA from hybridoma cells

[0099] Take 250 μl of PPV-VP2-11F3 and PPV-VP2-12C4 hybridoma cell suspension, add 750 μl of Trizol reagent and mix well, add 200 μl of chloroform, mix well, centrifuge at 12,000 rpm for 15 minutes at 4℃, transfer the upper aqueous phase to a new 1.5 ml EP tube, add 600 μl of isopropanol, mix well, centrifuge at 12,000 rpm for 15 minutes at 4℃, discard the isopropanol, wash the RNA precipitate with 75% DEPC ethanol solution, centrifuge at 8,000 rpm for 10 minutes at 4℃, discard the ethanol, dry at room temperature, and dissolve in 20 μl of RNase-free water.

[0100] (2) Reverse transcription

[0101] Reverse transcription was performed according to the Invitrogen reverse transcription kit instructions to obtain cDNA from PPV-VP2-11F3 and PPV-VP2-12C4 hybridoma cells.

[0102] (3) PCR reaction and sequencing of its products

[0103] Universal primers were designed for the variable regions of the heavy and light chains, and their sequence information is shown in Table 2. PCR amplification was performed using cDNA as a template. The amplification products were subjected to 2% agarose gel electrophoresis, and the target band was recovered using a gel extraction kit. The gel was then ligated into vectors for sequencing to obtain the heavy and light chain variable region sequences of the monoclonal antibodies PPV-11F3 and PPV-12C4.

[0104] Table 2 Primers for the variable regions of heavy and light chains

[0105] Primer name Sequence (5'-3') <![CDATA[V H -F]]> GTGAATTCATGCAGGTGCAGCTGTTGGAGTCTGG <![CDATA[V H -R]]> ATGTCGACTGAGGAGACGGTGACCAGGGTGCC <![CDATA[V L -F]]> GTGAATTCATGGACATTGTGATGACCCAGTCTCC <![CDATA[V L -R]]> CAGTCGACTTACGTTTGATCTCCAGCTTGGTCCC

[0106] The monoclonal antibody PPV-11F3 contains a heavy chain variable region (PPV-11F3-V). H ), light chain variable region (PPV-11F3-V) L ), its PPV-11F3-V H The amino acid sequence is shown in SEQ ID No. 1; its PPV-11F3-V L The amino acid sequence is shown in SEQ ID No. 2.

[0107] The PPV-11F3-V Hand PPV-11F3-V L Both are composed of cluster complement regions and frame regions; the PPV-11F3-V H and the PPV-11F3-V L The complementary regions of the determinant clusters are all composed of CDR1, CDR2, and CDR3; the PPV-11F3-V H The CDR1 amino acid sequence is shown as amino acids 31-35 of SEQ ID No. 1; the PPV-11F3-V H The CDR2 amino acid sequence is shown as amino acids 50-65 of SEQ ID No. 1; the PPV-11F3-V H The CDR3 amino acid sequence is shown as amino acids 99-111 of SEQ ID No. 1; the PPV-11F3-V L The CDR1 amino acid sequence is shown as amino acids 23-37 of SEQ ID No. 2; the PPV-11F3-V L The CDR2 amino acid sequence is shown as amino acids 52-59 of SEQ ID No. 2; the PPV-11F3-V L The amino acid sequence of CDR3 is shown as amino acids 94-104 of SEQ ID No. 2.

[0108] The monoclonal antibody PPV-12C4 contains a heavy chain variable region (PPV-12C4-V). H ), light chain variable region (PPV-12C4-V) L ), its PPV-12C4-V H The amino acid sequence is shown in SEQ ID No. 3; its PPV-12C4-V L The amino acid sequence is shown in SEQ ID No. 4.

[0109] The PPV-12C4-V H and PPV-12C4-V L Both are composed of cluster complementary regions and frame regions; the PPV-12C4-V H and the PPV-12C4-V L The complementary regions of the determinant clusters are all composed of CDR1, CDR2, and CDR3; the PPV-12C4-V H The CDR1 amino acid sequence is shown as amino acids 31-35 of SEQ ID No. 3; the PPV-12C4-V H The CDR2 amino acid sequence is shown as amino acids 50-64 of SEQ ID No. 3; the PPV-12C4-V HThe CDR3 amino acid sequence is shown as amino acids 99-105 of SEQ ID No. 3; the PPV-12C4-V L The CDR1 amino acid sequence is shown as amino acids 24-39 of SEQ ID No. 4; the PPV-12C4-V L The CDR2 amino acid sequence is shown as amino acids 55-61 of SEQ ID No. 4; the PPV-12C4-V L The amino acid sequence of CDR3 is shown as amino acids 94-102 of SEQ ID No. 4.

[0110] 2. Synthesis of gene sequences for specific monoclonal antibodies and establishment of recombinant expression systems.

[0111] (1) Gene sequence synthesis

[0112] Based on the determined sequences of the variable regions of the heavy and light chains of monoclonal antibodies PPV-11F3 and PPV-12C4, the sequences of the constant regions of the mouse antibody heavy and light chains were supplemented into the variable regions. After insect codon optimization, the nucleotide sequence of the PPV-11F3 heavy chain is shown in SEQ ID No. 6, and the nucleotide sequence of the PPV-11F3 light chain is shown in SEQ ID No. 7; the nucleotide sequence of the PPV-12C4 heavy chain is shown in SEQ ID No. 8, and the nucleotide sequence of the PPV-12C4 light chain is shown in SEQ ID No. 9. The insect codon-optimized monoclonal antibody heavy and light chain sequences were then constructed into pFastBac. TM The gene sequence was synthesized by Genscript Biotech Inc. on the Dual vector.

[0113] (2) Screening and extraction of recombinant Bacmid

[0114] The correctly sequenced shuttle vector containing the target gene was transformed into DH10Bac competent cells, plated on triple-antibody plates (kanamycin, gentamicin, tetracycline), and incubated at 37°C for 48 hours. White spots were picked and identified using the corresponding primers (primer sequences are shown in Table 3). Positive clones showed bands of approximately 4600 bp, and negative clones showed bands of approximately 300 bp. Clones without any 300 bp bands were selected for amplification by shaking. The collected cells were used to extract recombinant Bacmids using the NucleoBond Xtra Midi kit (MACHEREY-NAGE1), and the concentration was determined by NanoDrop.

[0115] Table 3 Primers for identifying recombinant Bacmid

[0116] Primer name Sequence (5'-3') M13F CCCAGTCACGACGTTGTAAAACG M13R AGCGGATAACAATTTCACACAGG

[0117] (3) Recombinant baculovirus rescue

[0118] The cell density prepared before transfection was 2.0-3.0 × 10⁶ cells / year. 6 SF9 cells were cultured in suspension at a concentration of 1.25 μg / 10⁻¹³ cells / ml, using recombinant Bacmid. 6 Cells were transfected using a transfection reagent at a concentration of 2.5 μg / 10. 6 Transfected cells were cultured at 27°C and 120 rpm for 96 hours in a constant temperature shaking incubator to harvest the recombinant baculovirus P1 generation. 1% of the recombinant baculovirus P1 generation was seeded into SF9 cells and then cultured at 27°C and 120 rpm for 96 hours to harvest the recombinant baculovirus P2 generation. The same method was used for P3 and P4 generation viral amplification.

[0119] (4) Expression of specific monoclonal antibodies

[0120] P4 generation recombinant baculovirus was inoculated into insect sf9 cells at a ratio of 5%, and cultured in a constant temperature shaking incubator at 27°C and 120 rpm. When the cell viability was less than 20%, the cells were harvested. The harvested culture was centrifuged at 8,000 rpm for 1 hour, and the supernatant was filtered through a 0.22 μm filter membrane for later use.

[0121] (5) Purification of specific monoclonal antibodies

[0122] The processed cell expression supernatant was purified using Protein A affinity chromatography. The Protein A affinity chromatography column was equilibrated with 20 mM sodium phosphate solution (pH 7.0) for 3-5 column volumes. The sample was then loaded onto the column, and the flow-through was collected. Elution was then performed with 0.1 mol / L glycine solution (pH 2.7). To neutralize the acid in the eluent, 200 μl of 1 mol / L Tris-HCl solution (pH 9.0) was added to each collection tube beforehand, collecting 800 μl per tube. All eluents were mixed and centrifuged at 8,000 rpm for 30 minutes. The supernatant was then collected and used. Figure 3 The concentrations and titers of the purified monoclonal antibodies are shown in Table 4.

[0123] Table 4. Results of concentration and titer determination of purified monoclonal antibodies

[0124] Test content PPV-11F3 PPV-12C4 ELISA potency 1：64000 1：32000 Concentration (mg / ml) 3.9 3.1

[0125] 3. Antibody pairing

[0126] The two purified monoclonal antibodies (PPV-11F3 and PPV-12C4) were paired using a double-antibody sandwich ELISA method.

[0127] (1) HRP-labeled monoclonal antibody

[0128] Two screened and purified porcine parvovirus VP2-specific monoclonal antibodies were conjugated with horseradish peroxidase (HRP) using glutaraldehyde oxidation, thoroughly dialyzed against pH 7.4 PBS buffer, and then stored at -20°C or below after adding an equal volume of glycerol. The specific steps are as follows:

[0129] ① Dissolve 5 mg HRP in 0.2 ml of 0.1 mol / L pH 6.8 PBS buffer containing 1.25% glutaraldehyde, couple at room temperature for 18 hours, and dialyze thoroughly to remove excess glutaraldehyde.

[0130] ② Add physiological saline to 1 ml, then add 2.5 mg of purified porcine parvovirus VP2-specific monoclonal antibody and 0.1 ml of 1 mol / L carbonate buffer at pH 9.6, and place at 2-8℃ for 24 hours.

[0131] ③ Add 0.1 ml of 0.3 mol / L lysine solution and let stand at room temperature for 2 hours.

[0132] ④ Dialyze thoroughly with PBS buffer at pH 7.4, remove the precipitate by centrifugation, and the supernatant is the HRP-labeled monoclonal antibody.

[0133] (2) Antibody pairing experiment

[0134] Unlabeled PPV-11F3 and PPV-12C4 were used as capture antibodies, and HRP-labeled antibodies were used as detection antibodies for paired detection. The specific steps are as follows:

[0135] ① Capture antibody coating: Dilute the capture antibody to 1 μg / ml with coating buffer (pH 9.6 carbonate solution), then add 100 μl / well to a 96-well polystyrene ELISA plate and incubate at 2-8℃ for 8-12 hours.

[0136] ② Blocking: Discard the coating solution, add 300 μl of PBS buffer containing 10 mg / ml bovine serum albumin at pH 7.4, block at 37°C for 2-3 hours, spin dry, and store at 2-8°C after the ELISA plate has dried.

[0137] ③ Add purified porcine parvovirus VP2 protein: Dilute the purified porcine parvovirus VP2 protein to 0.1 μg / ml using sample dilution buffer (0.01 mol / L phosphate buffer containing 5 mg / ml casein, pH 7.4). Add 100 μl to each well and 100 μl to each negative control well. Shake to mix and incubate at 37°C for 30 minutes.

[0138] ④ Washing: Discard the reaction solution, add 300 μl of washing buffer working solution (containing 0.8%-1.2% (ml / ml) Tween-20 0.01 mol / L phosphate buffer, pH 7.4, diluted 20 times with distilled or deionized water before use), soak for 15 seconds, discard the washing solution, wash the plate 4 times consecutively and then pat dry.

[0139] ⑤ Add detection antibody: Dilute HRP-labeled detection antibody 1:2000, add 100 μl to each well, vortex to mix, and place in a 37℃ incubator for 30 minutes.

[0140] ⑥ Washing: Discard the reaction solution, add 300 μl of washing buffer working solution per well, soak for 15 seconds, discard the washing solution, wash the plate 4 times consecutively, and then pat dry.

[0141] ⑦ Color development: Add equal volumes of substrate working solution, i.e., substrate solution A (citric acid phosphate buffer containing 0.6 mg / ml hydrogen peroxide urea) and substrate solution B (0.2 mg / ml tetramethylbenzidine solution), 100 μl / well, shake to mix, and place in a 37°C incubator to react in the dark for 15 minutes.

[0142] ⑧ Termination: Add 50 μl of the termination solution (2 mol / L sulfuric acid solution) to each well and shake to mix and terminate the reaction.

[0143] ⑨ Microplate reader test: Use a microplate reader to measure the OD450nm value of each well. The test should be performed within 15 minutes after the stop solution is added to terminate the reaction.

[0144] ⑩ Result determination: Calculate the P (sample positive well OD450nm value) / N (negative control well OD450nm value) value for each pair of capture antibody and detection antibody, and select the antibody with the largest P / N value as the best paired antibody.

[0145] The P / N results from the pairing experiments are shown in Table 5. The P / N value was the highest when PPV-11F3 was used as the capture antibody and PPV-12C4-labeled HRP was used as the detection antibody.

[0146] Table 5 Antibody pairing results

[0147]

[0148] Example 3: Establishment of a double-antibody sandwich ELISA method for porcine parvovirus VP2 protein

[0149] 1. Determination of the optimal coating concentration of capture antibody and the optimal dilution of detection antibody

[0150] Based on the results of the three-antibody pairing screening in Example 2, a double-antibody sandwich ELISA method was established using PPV-11F3 as the capture antibody and PPV-12C4-labeled HRP as the detection antibody. The checkerboard method was used to determine the coating concentration of the capture antibody and the dilution of the detection antibody. The specific steps are as follows:

[0151] (1) Coating with capture antibody at different concentrations: The capture antibody PPV-11F3 was diluted with coating buffer (pH 9.6 carbonate solution) to 4 μg / ml, 2 μg / ml, 1 μg / ml and 0.5 μg / ml respectively, and then added to a 96-well polystyrene ELISA plate, 100 μl / well, and incubated at 2-8℃ for 8-12 hours.

[0152] (2) Blocking: Discard the coating solution, add 300 μl of PBS buffer containing 10 mg / ml bovine serum albumin at pH 7.4, block at 37°C for 2-3 hours, spin dry, and store at 2-8°C after the enzyme-linked reaction plate has dried.

[0153] (3) Add purified porcine parvovirus VP2 protein: Dilute the purified porcine parvovirus VP2 protein to 0.1 μg / ml using sample dilution buffer (0.01 mol / L phosphate buffer containing 5 mg / ml casein, pH 7.4), add 100 μl to each well, add 100 μl of sample dilution buffer to each negative control well, shake to mix, and place in a 37℃ incubator for 30 minutes.

[0154] (4) Washing: Discard the reaction solution, add washing buffer working solution (containing 0.01mol / L phosphate buffer with a concentration of 0.8%-1.2% (ml / ml) Tween-20, pH 7.4, diluted 20 times with distilled water or deionized water before use), 300μl / well, soak for 15 seconds, discard the washing solution, wash the plate 4 times consecutively and then pat dry.

[0155] (5) Add detection antibody: Dilute HRP-labeled detection antibody PPV-12C4 at 1:2000, 1:4000, 1:8000 and 1:16000, add 100 μl to each well, shake to mix, and place in a 37℃ incubator for 30 minutes.

[0156] (6) Washing: Discard the reaction solution, add 300 μl of washing buffer working solution per well, soak for 15 seconds, discard the washing solution, wash the plate 4 times and then pat dry.

[0157] (7) Color development: Add equal volumes of substrate working solution, namely substrate solution A (citric acid phosphate buffer containing 0.6 mg / ml hydrogen peroxide urea) and substrate solution B (0.2 mg / ml tetramethylbenzidine solution), mix 100 μl / well, shake to mix, and place in a 37°C incubator to react in the dark for 10 minutes.

[0158] (8) Termination: Add 50 μl of the termination solution (2 mol / L sulfuric acid solution) to each well and shake to mix and terminate the reaction.

[0159] (9) Microplate reader detection: OD of each well was measured using a microplate reader. 450nm The value should be measured within 15 minutes after the stop solution is added to terminate the reaction.

[0160] (10) Result determination: Calculate the P(sample positive well OD) of the capture antibody and the detection antibody. 450nm Value) / N (OD of negative control well) 450nm The optimal coating concentration of the capture antibody is determined by the group with the highest P / N value, and the optimal dilution of the detection antibody is determined by the dilution factor of the detection antibody.

[0161] Based on the P / N results (Table 6), the optimal coating concentration of the capture antibody PPV-11F3 was determined to be 1 μg / ml, 100 μl per well, and the optimal dilution of the detection antibody HRP-labeled PPV-12C4 was determined to be 1:4000, 100 μl per well.

[0162] Table 6. Results of exploring the optimal coating concentration and optimal dilution of capture antibody using the checkerboard method.

[0163]

[0164] 2. Determination of sample reaction time

[0165] The sample reaction time was set to 0.5 hours, 1 hour, and 2 hours respectively, with all other conditions remaining unchanged. The results (Table 7) show that the P / N ratios at each time point were not significantly different. Therefore, the sample reaction time was determined to be 0.5 hours.

[0166] Table 7 Results of Optimal Sample Reaction Time Exploration

[0167] 0.5 hours 1 hour 2 hours P / N 16.98 16.74 17.10

[0168] 3. Determination of antibody incubation time

[0169] The incubation time for the detection antibody was set to 15 minutes, 30 minutes, 60 minutes, and 90 minutes, with all other conditions remaining unchanged. The results (Table 8) show that the P / N ratio was the highest when the incubation time for the detection antibody was 30 minutes. Therefore, the incubation time for the detection antibody was determined to be 30 minutes.

[0170] Table 8 Results of the exploration of optimal antibody incubation time

[0171] 15 minutes 30 minutes 60 minutes 90 minutes P / N 14.72 18.07 16.59 16.11

[0172] 4. Determining the color development time

[0173] The display time was set to 10 minutes, 15 minutes, and 20 minutes respectively, with all other conditions remaining unchanged. The results are shown in Table 9. When the color development time was 15 minutes, the P / N ratio was the largest. Therefore, the display time was determined to be 15 minutes.

[0174] Table 9 Results of Exploration of Optimal Color Development Time

[0175] 10 minutes 15 minutes 20 minutes P / N 15.93 17.18 14.16

[0176] Example 4: Preparation of a porcine parvovirus VP2 double-antibody sandwich quantitative detection kit

[0177] 1. Preparation of capture antibody pre-coated plates

[0178] The purified porcine parvovirus VP2-specific monoclonal antibody PPV-11F3 was diluted with carbonate solution at pH 9.6 to prepare a 1 μg / ml coating working solution. Then, 100 μl was added to each well of a 96-well polystyrene ELISA plate and incubated at 2-8°C for 8-12 hours to allow the specific monoclonal antibody to fully bind to the ELISA plate. Then, 300 μl of PBS buffer containing 10 mg / ml bovine serum albumin at pH 7.4 was added to each well and the plate was blocked at 37°C for 2-3 hours. After drying, the ELISA plate was sealed and stored at 2-8°C.

[0179] 2. Preparation of horseradish peroxidase-labeled detection antibody

[0180] The purified porcine parvovirus VP2-specific monoclonal antibody PPV-12C4 was conjugated with horseradish peroxidase (HRP) using glutaraldehyde oxidation, thoroughly dialyzed against pH 7.4 PBS buffer, and then stored at -20°C or below with an equal volume of glycerol added. The specific steps are as follows:

[0181] (1) Dissolve 5 mg HRP in 0.2 ml of 0.1 mol / L pH 6.8 PBS buffer containing 1.25% glutaraldehyde, couple at room temperature for 18 hours, and dialyze thoroughly to remove excess glutaraldehyde.

[0182] (2) Add physiological saline to 1 ml, then add 2.5 mg of purified monoclonal antibody PPV-12C4 and 0.1 ml of 1 mol / L carbonate buffer at pH 9.6, and place at 2-8℃ for 24 hours.

[0183] (3) Add 0.1 ml of 0.3 mol / L lysine solution and let stand at room temperature for 2 hours.

[0184] (4) Dialyze thoroughly with PBS buffer at pH 7.4, remove the precipitate by centrifugation, and the supernatant is the HRP-labeled monoclonal antibody. When using, dilute at a ratio of 1:4000 to prepare the working solution for the detection antibody.

[0185] 3. Preparation of porcine parvovirus VP2 protein standard

[0186] Recombinant porcine parvovirus VP2 (deposited at the China General Microbiological Culture Collection Center, accession number CGMCC NO.45384) was inoculated into insect sf9 cells and then cultured in a constant temperature shaking incubator at 27°C and 120 rpm. When the cell viability was below 20%, the cells were harvested. The harvested culture was centrifuged at 8,000 rpm for 10 minutes, and the supernatant was loaded onto an anion exchange chromatography column for purification to obtain purified porcine parvovirus VP2 protein with a purity of not less than 85% and a protein content of 50 μg / ml. The purified protein was aliquoted into 100 μl tubes, labeled, and stored at -70°C or below for later use. When using, the cells were serially diluted with the sample diluent (1:500-1:32000).

[0187] 4. Preparation of sample diluent

[0188] The sample diluent was a 0.01 mol / L phosphate buffer containing 5 mg / ml casein, pH 7.4 (1 bottle, 24 ml / bottle).

[0189] 5. Preparation of substrate solution A

[0190] Substrate solution A is citrate phosphate buffer (1 bottle, 12 ml / bottle) containing 0.6 mg / ml hydrogen peroxide urea.

[0191] 6. Preparation of substrate solution B

[0192] Substrate solution B is a 0.2 mg / ml tetramethylbenzidine solution (1 bottle, 12 ml / bottle).

[0193] 7. Prepare a 20-fold concentrated washing solution

[0194] The 20x concentrated washing solution is a 0.01 mol / L phosphate buffer containing 0.8%-1.2% (ml / ml) Tween-20, pH 7.4 (2 bottles, 50 ml / bottle).

[0195] 8. Preparation of Termination Solution

[0196] The stop solution is a 2 mol / L sulfuric acid solution (1 bottle, 12 ml / bottle).

[0197] Example 5: Instructions for use of the porcine parvovirus VP2 double antibody sandwich quantitative detection kit

[0198] 1. Equilibration: Remove the reagent kit from its storage environment at 2-8℃ and allow it to equilibrate at room temperature for 30 minutes before use; mix liquid reagents thoroughly before use.

[0199] 2. Solution preparation: Dilute the 20-fold concentrated washing solution with distilled water or deionized water 20 times to obtain the washing buffer working solution.

[0200] 3. Sample dilution: The porcine parvovirus VP2 protein standard was diluted 1:500 to 1:32000 with sample dilution buffer, corresponding to concentrations of 100 ng / ml, 50 ng / ml, 25 ng / ml, 12.5 ng / ml, 6.2 ng / ml, 3.1 ng / ml, and 1.6 ng / ml, respectively. The test samples were also diluted 3 to 6 times with sample dilution buffer.

[0201] 4. Sample addition: Remove the required strips, seal the remaining strips in an aluminum foil bag, and store at 2-8℃ for later use. Add the diluted test sample, diluted porcine parvovirus VP2 protein standard, and negative control sample (with sample diluent only) to the coated plate, 100 μl / well, repeat for 3 wells. The sample addition process should be as short as possible.

[0202] 5. Incubation: Shake to mix well, place in a 37°C incubator, and react for 30 minutes.

[0203] 6. Washing: Discard the reaction solution, add 300 μl of washing buffer working solution per well, soak for 15 seconds, discard the washing solution, wash the plate 4 times and then pat dry.

[0204] 7. Add HRP-labeled detection antibody: Dilute the HRP-labeled detection antibody at a ratio of 1:4000, 100 μl / well.

[0205] 8. Incubation: Shake to mix well, place in a 37°C incubator, and react for 30 minutes.

[0206] 9. Washing: Discard the reaction solution, add 300 μl of washing buffer working solution per well, soak for 15 seconds, discard the washing solution, wash the plate 4 times and then pat dry.

[0207] 10. Color development: Add 100 μl of substrate working solution (the substrate working solution is obtained by mixing equal volumes of substrate solution A and substrate solution B, and should be prepared fresh before use), shake to mix, and place in a 37°C incubator to react for 15 minutes in the dark.

[0208] 11. Termination: Add 50 μl of stop solution per well and shake to mix and terminate the reaction.

[0209] 12. Microplate reader assay: The OD of each well was measured using a microplate reader. 450nm The value should be measured within 15 minutes after the stop solution is added to terminate the reaction.

[0210] 13. Results Analysis: Porcine parvovirus VP2 protein standard (100 ng / ml) well OD 450nm The value should be ≥2.9, otherwise it is invalid; OD of the cathode control aperture. 450nm The value should be ≤0.25, otherwise it is invalid; Concentration calculation: based on the OD of each well of the protein standard. 450nm Average value minus cathode control hole OD 450nm The average value was used as the Y-axis, and the protein concentration of each well of the protein standard was used as the X-axis to plot a standard curve. The content of porcine parvovirus effective antigen protein VP2 in each sample was calculated.

[0211] In the above detection methods, the selection of the test sample can be diverse, such as culture medium, inactivation solution, concentrate and finished vaccine after demulsification during the production of porcine parvovirus whole virus inactivated vaccine or subunit vaccine.

[0212] The result analysis method in step (13) can be as follows: use EXCEL program → "Insert" → "Scatter Plot" → use the OD of each well of the protein standard. 450nm Average value minus cathode control hole OD 450nm Use the average value as the Y-axis and the protein concentration of each well of the protein standard as the X-axis → Add a trendline → Select "Linear" → Select "Display Formula" and "Display R-squared". Typically, R... 2 A value ≥0.98 indicates a reliable standard curve. Each 96-well plate should include wells for porcine parvovirus VP2 protein standards, and a corresponding standard curve should be plotted. The OD values ​​of each well should be calculated according to the formula. 450nm Average value minus cathode control hole OD 450nm The average value is used to calculate the VP2 protein concentration in the sample.

[0213] Example 6: Sensitivity test of the porcine parvovirus VP2 double antibody sandwich quantitative detection kit

[0214] Negative samples (sample diluent) were tested according to the kit in Example 4 and the detection method in Example 5, 100 μl / well, repeated for 8 wells, and the OD of the negative samples was calculated. 450nm The mean (X) and standard deviation (SD) can be used to determine the positive criterion using the formula cut-off value = X + 3SD.

[0215] Porcine parvovirus VP2 protein standard was serially diluted to 100 ng / ml, 50 ng / ml, 25 ng / ml, 12.5 ng / ml, 6.2 ng / ml, 3.1 ng / ml, 1.6 ng / ml, and 0.8 ng / ml, 100 μl / well, repeated for 8 wells, and the OD was calculated. 450nmThe average value (X) is used as the sensitivity of this kit, with the lowest concentration that is greater than the positive judgment standard.

[0216] The test results (Table 10) show that the cut-off value of the negative sample (i.e., X+3SD) = 0.222 + 3 × 0.023 = 0.291, meaning that when OD 450nm A sample is considered positive when the OD value is ≥0.291; 450nm A concentration <0.291 indicates the sample is negative. Using the serial dilution concentration of the control porcine parvovirus VP2 protein standard, when the diluted sample concentration is not lower than 1.6 ng / ml, the OD... 450nm All values ​​above 0.291 are considered positive. When the diluted sample concentration is below 1.6 ng / ml, the OD... 450nm A value below 0.291 is considered negative; therefore, the detection sensitivity of this kit is 1.6 ng / ml, indicating that the method has high sensitivity.

[0217] Table 10 Sensitivity results of the porcine parvovirus VP2 double antibody sandwich quantitative detection kit

[0218]

[0219]

[0220] Example 7: Specificity test of the porcine parvovirus VP2 double antibody sandwich quantitative detection kit

[0221] Porcine pseudorabies virus (PRV), porcine circovirus type 2 (PCV2), classical swine fever virus (CSFV), porcine reproductive and respiratory syndrome virus (PRRSV), recombinant porcine circocap protein (baculovirus expression), and supernatant of suspension cultured sf9 cells were selected and detected according to the kit in Example 4 and the detection method in Example 5. Negative control wells (containing only sample diluent) were also set up. The detection results (Table 11) show that this kit has no cross-reactivity with porcine pseudorabies virus (PRV), porcine circovirus type 2 (PCV2), classical swine fever virus (CSFV), porcine reproductive and respiratory syndrome virus (PRRSV), proteins expressed by baculoviruses (such as porcine circocap protein), and sf9 cell culture medium, indicating that the method has high specificity.

[0222] Table 11 Specificity Detection Results of the Porcine Parvovirus VP2 Double Antibody Sandwich Quantitative Detection Kit

[0223]

[0224] Note: "+" represents positive; "-" represents negative.

[0225] Example 8: Repeatability test of the porcine parvovirus VP2 double antibody sandwich quantitative detection kit

[0226] Following the kit described in Example 4 and the detection method described in Example 5, serially diluted porcine parvovirus VP2 protein standards were used as test samples. Double-antibody sandwich ELISA kits prepared in the same batch were selected for detection, with three replicates for each protein dilution. The coefficient of variation (COP) for intra-batch repeatability was calculated. Three different batches of double-antibody sandwich ELISA kits were also selected for detection, and the COP for inter-batch repeatability was calculated. The results (Table 12) show that the intra-batch COP of this kit was 0.93%–5.73%, and the inter-batch COP was 1.18%–5.56%. Both the intra-batch and inter-batch COPs were less than 10%, indicating good repeatability and high stability of the method.

[0227] Table 12 Repeatability test results of the porcine parvovirus VP2 double antibody sandwich quantitative detection kit

[0228]

[0229] Example 9: Application of the porcine parvovirus VP2 double antibody sandwich quantitative detection kit

[0230] Following the kit in Example 4 and the detection method in Example 5, the content of porcine parvovirus VP2 protein in samples (including cell culture medium, virus inactivation solution, and concentrate) and the finished vaccine after demulsification of porcine parvovirus whole-virus inactivated vaccine at different production stages was detected. Following the kit in Example 4 and the detection method in Example 5, the supernatant of baculovirus-expressing PPV VP2 cells harvested from different batches in the laboratory and the antigen after demulsification of different batches of PPV VP2 subunit vaccines prepared in the laboratory were detected. The detection results (Table 13) show that this kit can detect the content of the effective antigen protein VP2 in cell culture medium, virus inactivation solution, virus concentrate, and the finished vaccine after demulsification of porcine parvovirus whole-virus inactivated vaccine or subunit vaccine at different production stages.

[0231] Table 13. Detection results of porcine parvovirus VP2 double antibody sandwich quantitative detection kit on samples from different production stages of porcine parvovirus whole virus inactivated vaccine or subunit vaccine.

[0232]

Claims

1. A double-antibody sandwich ELISA kit for the specific quantitative detection of porcine parvovirus effective antigen protein VP2, characterized in that, The kit comprises: an enzyme-linked immunosorbent assay (ELISA) plate coated with capture antibodies and enzyme-labeled detection antibodies; The capture antibody is a monoclonal antibody that can specifically bind to the effective antigen protein VP2 of porcine parvovirus; the enzyme-labeled detection antibody is an enzyme-labeled antibody made from a monoclonal antibody that can specifically bind to the effective antigen protein VP2 of porcine parvovirus. The capture antibody contains the heavy chain variable region PPV-11F3-V. H and light chain variable region PPV-11F3-V L The heavy chain variable region PPV-11F3-V H and light chain variable region PPV-11F3-V L Both consist of a cluster complement region and a frame region; The PPV-11F3-V H and the PPV-11F3-V L The complementary regions of the determinant clusters are all composed of CDR1, CDR2, and CDR3; The PPV-11F3-V H The amino acid sequence of CDR1 is shown as amino acids 31-35 of SEQ ID No. 1; The PPV-11F3-V H The CDR2 amino acid sequence is shown as amino acids 50-65 of SEQ ID No. 1; The PPV-11F3-V H The amino acid sequence of CDR3 is shown as amino acids 99-111 of SEQ ID No. 1; The PPV-11F3-V L The amino acid sequence of CDR1 is shown as amino acids 23-37 of SEQ ID No. 2; The PPV-11F3-V L The CDR2 amino acid sequence is shown as amino acids 52-59 of SEQ ID No. 2; The PPV-11F3-V L The amino acid sequence of CDR3 is shown as amino acids 94-104 of SEQ ID No. 2; The detection antibody contains the heavy chain variable region PPV-12C4-V. H and light chain variable region PPV-12C4-V L The heavy chain variable region PPV-12C4-V H and light chain variable region PPV-12C4-V L Both consist of a cluster complement region and a frame region; The PPV-12C4-V H and the PPV-12C4-V L The complementary regions of the determinant clusters are all composed of CDR1, CDR2, and CDR3; The PPV-12C4-V H The amino acid sequence of CDR1 is shown as amino acids 31-35 of SEQ ID No. 3; The PPV-12C4-V H The amino acid sequence of CDR2 is shown as amino acids 50-64 of SEQ ID No. 3; The PPV-12C4-V H The amino acid sequence of CDR3 is shown as amino acids 99-105 of SEQ ID No. 3; The PPV-12C4-V L The amino acid sequence of CDR1 is shown as amino acids 24-39 of SEQ ID No. 4; The PPV-12C4-V L The CDR2 amino acid sequence is shown as amino acids 55-61 of SEQ ID No. 4; The PPV-12C4-V L The amino acid sequence of CDR3 is shown as amino acids 94-102 of SEQ ID No.

4.

2. The double-antibody sandwich ELISA kit according to claim 1, characterized in that: The PPV-11F3-V H The amino acid sequence is shown in SEQ ID No. 1; the PPV-11F3-V L The amino acid sequence is shown in SEQ ID No. 2; And; the PPV-12C4-V H The amino acid sequence is shown in SEQ ID No. 3; the PPV-12C4-V L The amino acid sequence is shown in SEQ ID No.

4.

3. The double-antibody sandwich ELISA kit according to claim 1 or 2, characterized in that: The enzyme-linked immunosorbent assay (ELISA) plate is obtained by diluting the capture antibody with a carbonate solution at pH 9.6 to prepare a coating working solution of 1 μg / ml, and then adding it to a 96-well polystyrene ELISA plate at 100 μl / well. The plate is then incubated at 2-8°C for 8-12 hours to allow the capture antibody to fully bind to the plate. The coating solution is then discarded, and 300 μl of PBS buffer containing 10 mg / ml bovine serum albumin at pH 7.4 is added to each well. The plate is then blocked at 37°C for 2-3 hours. After drying, the 96-well polystyrene ELISA plate is sealed and stored at 2-8°C.

4. The double-antibody sandwich ELISA kit according to claim 1, characterized in that: The kit also includes substrate solution A, substrate solution B, and a stop solution; substrate solution A is citrate phosphate buffer containing 0.6 mg / ml hydrogen peroxide urea, substrate solution B is a 0.2 mg / ml tetramethylbenzidine solution, and the two are mixed at a volume ratio of 1:1 when used; the stop solution is a 2 mol / L sulfuric acid solution.

5. The double-antibody sandwich ELISA kit according to claim 1, characterized in that: The kit also includes a sample diluent and a 20-fold concentrated wash buffer; the sample diluent is a 0.01 mol / L phosphate buffer containing 5 mg / ml casein, pH 7.4; the 20-fold concentrated wash buffer is a 0.01 mol / L phosphate buffer containing 0.8%-1.2% Tween-20, pH 7.

4.

6. The double-antibody sandwich ELISA kit according to claim 1, characterized in that: The kit also includes a porcine parvovirus VP2 protein standard. The porcine parvovirus VP2 protein standard is obtained by inoculating recombinant porcine parvovirus VP2 baculovirus into insect sf9 cells, then culturing them in a constant temperature shaking incubator at 27°C and 120 rpm. When the cell viability is less than 20%, the cells can be harvested. The harvested culture medium is centrifuged at 8,000 rpm for 10 minutes, and the supernatant is loaded onto an anion exchange chromatography column for purification to obtain purified porcine parvovirus VP2 protein with a purity of not less than 85% and a protein content of 50 μg / ml. The recombinant porcine parvovirus VP2 is deposited at the China General Microbiological Culture Collection Center, with accession number CGMCC NO.45384.

7. The application of the double-antibody sandwich ELISA kit according to any one of claims 1-6 in the specific quantitative detection of porcine parvovirus effective antigen protein VP2, wherein the sample to be tested is the culture medium, inactivation solution, concentrate or demulsified finished vaccine produced during the production process of porcine parvovirus whole virus inactivated vaccine or porcine parvovirus subunit vaccine.

8. A monoclonal antibody that specifically binds to the porcine parvovirus effective antigen protein VP2, and is any one of the following monoclonal antibodies: (1) Contains heavy chain variable region PPV-11F3-V H and light chain variable region PPV-11F3-V L The heavy chain variable region PPV-11F3-V H and light chain variable region PPV-11F3-V L Both consist of a cluster complement region and a frame region; The PPV-11F3-V H and the PPV-11F3-V L The complementary regions of the determinant clusters are all composed of CDR1, CDR2, and CDR3; The PPV-11F3-V H The amino acid sequence of CDR1 is shown as amino acids 31-35 of SEQ ID No. 1; The PPV-11F3-V H The CDR2 amino acid sequence is shown as amino acids 50-65 of SEQ ID No. 1; The PPV-11F3-V H The amino acid sequence of CDR3 is shown as amino acids 99-111 of SEQ ID No. 1; The PPV-11F3-V L The amino acid sequence of CDR1 is shown as amino acids 23-37 of SEQ ID No. 2; The PPV-11F3-V L The CDR2 amino acid sequence is shown as amino acids 52-59 of SEQ ID No. 2; The PPV-11F3-V L The amino acid sequence of CDR3 is shown as amino acids 94-104 of SEQ ID No. 2; (2) Contains heavy chain variable region PPV-12C4-V H and light chain variable region PPV-12C4-V L The heavy chain variable region PPV-12C4-V H and light chain variable region PPV-12C4-V L Both consist of a cluster complement region and a frame region; The PPV-12C4-V H and the PPV-12C4-V L The complementary regions of the determinant clusters are all composed of CDR1, CDR2, and CDR3; The PPV-12C4-V H The amino acid sequence of CDR1 is shown as amino acids 31-35 of SEQ ID No. 3; The PPV-12C4-V H The amino acid sequence of CDR2 is shown as amino acids 50-64 of SEQ ID No. 3; The PPV-12C4-V H The amino acid sequence of CDR3 is shown as amino acids 99-105 of SEQ ID No. 3; The PPV-12C4-V L The amino acid sequence of CDR1 is shown as amino acids 24-39 of SEQ ID No. 4; The PPV-12C4-V L The CDR2 amino acid sequence is shown as amino acids 55-61 of SEQ ID No. 4; The PPV-12C4-V L The amino acid sequence of CDR3 is shown as amino acids 94-102 of SEQ ID No. 4; (3) Contains heavy chain variable region PPV-11F3-V H and light chain variable region PPV-11F3-V L The PPV-11F3-V H The amino acid sequence is shown in SEQ ID No. 1; the PPV-11F3-V L The amino acid sequence is shown in SEQ ID No. 2; (4) Contains heavy chain variable region PPV-12C4-V H and light chain variable region PPV-12C4-V L The PPV-12C4-V H The amino acid sequence is shown in SEQ ID No. 3; the PPV-12C4-V L The amino acid sequence is shown in SEQ ID No.

4.

9. The use of the monoclonal antibody according to claim 8 in the preparation of a kit for detecting the content of porcine parvovirus effective antigen protein VP2.

Images