Modified promoter sequences
By inserting or replacing neutral nucleic acid sequences in the promoter of eukaryotic organisms, the problem of insufficient gene expression levels in the prior art is solved, and the effect of significantly improving transcription rate and protein yield is achieved.
Patent Information
- Application Number
- CN202380071881.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2022-10-10
- Filing Date
- 2023-10-10
- Publication Date
- 2025-05-30
AI Technical Summary
The prior art is difficult to effectively increase gene expression levels in eukaryotes, especially when protein expression is limited by the amount of transcripts that can be used for translation in cells.
A specific site in the promoter is inserted or replaced by inserting neutral nucleic acid sequences such as GATAX1X2X3X4X5X6(X7)m, ATCCTTTTAG (SEQ ID No. 1) and AAA to modify the promoter, thereby improving transcription rate and protein yield.
A significantly improved transcription rate and protein yield compared to unmodified promoters is achieved, providing a method to effectively improve gene expression levels.
Smart Images

Figure CN120077141A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of promoters, in particular promoter variants that exhibit enhanced gene expression levels. Background Art
[0002] At the most basic level, protein expression is limited by the amount of transcripts available for translation in a cell. The total transcript level depends on the gene copy number and the amount of transcripts produced, which in turn is strongly influenced by the promoter. Due to this direct effect on expression, promoter sequences are the most intensively studied regulatory elements in eukaryotes, and promoter engineering is used as a way to fine-tune gene expression.
[0003] Engineering of promoter sequences is a broad field, and particularly for eukaryotic promoters, it mainly focuses on modifying existing sequences. Deletion of short DNA segments, base exchanges, and truncations provide opportunities to improve promoter performance through genetic engineering. Modification of promoters is most often done to generate particularly strong promoter sequences to maximize transcription.
[0004] Engineering methods can be random, rational, or a combination of both. Although random methods are more likely to generate a large number of variants with reduced strength, they require much less knowledge and understanding of the modified sequence. To date, saturation mutagenesis of spacer regions, random mutagenesis by error-prone PCR, hybrid promoter engineering, and direct modification of transcription factor binding sites (TFBS) have been used for promoter engineering. The basic goal of all these strategies is to affect transcription by altering the TFBS of the promoter sequence, which can be a specific single promoter sequence, their combination in a sequence, or the context in which they occur. However, based on the analysis of expression, it must also be remembered that alternative effects, such as differences in mRNA stability or translation initiation, are potential causes of changes in the yield of the target protein.
[0005] Accordingly, an object of the present invention is to provide methods for obtaining such promoters that exhibit excellent characteristics compared to the corresponding wild-type promoters from which they are derived. Another object of the present invention is to provide such promoters that have excellent characteristics compared to the corresponding wild-type promoters from which they are derived. Summary of the Invention
[0006] The present invention relates to a method for modifying a promoter to obtain a promoter variant, the method comprising the following steps:
[0007] a. providing a promoter,
[0008] b. modifying the promoter by the following process:
[0009] - selecting from the group consisting of GATAX 1X 2 X 3 X 4 X 5 X 6 (X 7 ) m at least one nucleic acid sequence of the group consisting of ATCCTTTTAG (SEQ ID No.1) and AAA is inserted into the promoter, and / or
[0010] - substituting nucleotides of the promoter sequence to select from GATAX 1 X 2 X 3 X 4 X 5 X 6 (X 7 ) m at least one nucleic acid sequence of the group consisting of ATCCTTTTAG (SEQ ID No.1) and AAA is introduced into the promoter,
[0011] wherein X 1 、X 2 、X 3 、X 4 、X 5 、X 6 and X 7 are independently nucleotides selected from the group consisting of A, C, G, and T, and wherein m is an integer between 0 and 10.
[0012] Surprisingly, it has been found that inserting "neutral" nucleic acid sequences (such as GATAX 1 X 2 X 3 X 4 X 5 X 6 (X 7 ) m 、ATCCTTTTAG (SEQ ID No.1) and / or AAA) into the promoter can be used to obtain promoter variants that show an increased transcription rate compared to the corresponding wild-type promoter. These neutral nucleic acid sequences may have the advantage of not affecting the binding of transcription factors to the promoter in the cell. In addition, the use of neutral nucleic acid sequences may prevent the formation of new transcription factor binding sites that have unpredictable effects on transcription in the cell. It was found that the nucleic acid sequence GATAX 1 X 2 X 3 X 4 X 5 X 6 (X 7 ) m, ATCCTTTTAG (SEQ ID No.1) and AAA are considered neutral nucleic acid sequences. These sequences have been identified as not containing possible binding sites for eukaryotic transcription factors. These nucleic acid sequences are very useful in identifying and producing promoter variants that have excellent effects compared to unmodified promoters. These nucleic acid sequences can be longer or shorter, but preferably contain 10 bases, which may support a neutral effect on the three-dimensional structure of promoter DNA (including bound transcription factors) when inserted without replacing a sequence of the same length. These nucleic acid sequences can be used to obtain promoters with higher promoter activity compared to unmodified promoters. Therefore, the method of the present invention is suitable for identifying and / or obtaining, for example, promoters / promoter variants that show enhanced promoter activity in protein expression compared to unmodified promoters. Therefore, the present invention also relates to a method for identifying promoter variants that show enhanced promoter activity compared to unmodified promoters and / or for screening promoter variant libraries modified by inserting at least one nucleic acid sequence selected from the group consisting of GATAX 1 X 2 X 3 X 4 X 5 X 6 (X 7 ) m , ATCCTTTTAG (SEQ ID No.1) and AAA into a promoter and / or by substituting nucleotides of the promoter sequence to introduce at least one nucleic acid sequence selected from the group consisting of GATAX 1 X 2 X 3 X 4 X 5 X 6 (X 7 ) m , ATCCTTTTAG (SEQ ID No.1) and AAA into the promoter. In both cases, the promoter variant can be operably linked to the target sequence to be transcribed, and the amount of the transcription product (i.e., RNA or protein / polypeptide) shows whether the promoter activity is increased or decreased compared to the unmodified promoter.
[0013] The promoter modified by the method of the present invention can be of any origin. Thus, the promoter can be a human or animal, bacterial, fungal, viral or artificial promoter. The method of the present invention can also be used to introduce modifications into already modified or optimized promoters. The claimed method is another tool for improving such promoters in terms of transcription rate or other characteristics.
[0014] Another aspect of the present invention relates to promoter variants obtainable by the method according to the present invention.
[0015] The promoters obtainable by the method of the present invention may exhibit a much higher transcription rate compared to their respective unmodified promoters from which they are derived. The promoters obtainable by the method of the present invention may produce a much higher protein yield or specific productivity compared to their respective unmodified promoters from which they are derived. The promoters obtained by the method of the present invention can be considered promoter variants.
[0016] Another aspect of the present invention relates to nucleic acid molecules or vectors comprising the promoter variants of the present invention or promoter variants obtainable by the method of the present invention.
[0017] The nucleic acid molecules according to the present invention may comprise a promoter according to the present invention and a nucleic acid sequence encoding a protein or polypeptide operably linked thereto. Thus, the transcription of the coding region of such nucleic acid molecules is controlled by the promoter. Such nucleic acid molecules or promoter variants of the present invention can be comprised in a vector. The vector containing the nucleic acid molecule of the present invention or the promoter of the present invention can be a linear expression construct, plasmid, cosmid or viral vector for genomic integration.
[0018] Another aspect of the present invention relates to host cells comprising the promoter variants, nucleic acid molecules or vectors according to the present invention. The host cells containing the promoter variants according to the present invention can be human, animal, plant or fungal cells. The promoters introduced into these cells directly or via the nucleic acid molecules and / or vectors according to the present invention should be functionally active in these cells and thus comprise the respective functional elements.
[0019] Another aspect of the present invention relates to a method for producing a polypeptide or protein, which comprises the step of culturing a host cell comprising a promoter variant obtainable by the method of the present invention, a nucleic acid molecule or a vector according to the present invention. The nucleic acid sequence encoding the polypeptide or protein is operably linked to the promoter of the present invention, thereby allowing its expression in the host cell and optionally allowing its secretion from the host cell. BRIEF DESCRIPTION OF THE DRAWINGS
[0020] Figure 1 Shows the lipase activity (A) of PCAT variant #19, the original PCAT promoter and the reference promoter PDF, and the fold change (B) of the target gene (CalB).
[0021] Figure 2 Shows some P for determining the ABTS activity of HspUPO expression screened from 24-well plate cultures PDCVariants. The 10 bp promoter sequence was exchanged with 5ˊ-GATAACCGTG-3ˊ (SEQ ID No. 2) at different positions within the promoter. The original sequence named PDC (SEQ ID No. 33) was used as a control. The given values show the mean of approximately 23 cultured transformants for each variant, showing the standard deviation. Detailed Description
[0022] The method according to the invention was designed to modify promoters using "neutral" nucleic acid sequences. A "neutral" nucleic acid sequence is a nucleic acid molecule that does not itself contain any properties that may affect promoter activity. This means that these neutral nucleic acid sequences neither contain transcription factor binding sites (TFBS) and / or repressor or activator protein binding sites, nor can they form TFBS as well as repressor and activator protein binding sites together with any other nucleic acid sequences present in the promoter to be modified. Thus, neutral nucleic acid sequences are advantageous because they cannot form new TFBS in the promoter sequence, which may have an undesirable effect on promoter activity.
[0023] The neutral nucleic acid sequences can be introduced into the promoter by insertion or substitution. These nucleic acid sequences can be introduced into the promoter at one or more sites of the promoter, where preferably they are introduced into 1 to 10 sites of the promoter, preferably 1 to 8 sites, more preferably 1 to 6 sites, more preferably 1 to 4 sites, more preferably 1 to 3 sites, more preferably 1 or 2 sites. To identify modified promoters that exhibit altered properties compared to the unmodified promoter, one or more neutral nucleic acid sequences can be randomly introduced into the promoter sequence. Alternatively, they can also be introduced step by step systematically from the 5' end to the 3' end of the promoter. This introduction can be an additional insertion in the promoter sequence or replacement of a part of the original promoter sequence by substitution. The modified promoters obtained by both methods can be operably linked to a nucleic acid molecule encoding a polypeptide or protein and introduced into a host cell to measure the polypeptide or protein expression rate. Alternatively, it is also possible to determine the amount of RNA, especially mRNA, transcribed under the control of the promoter variants obtainable by the method of the invention and the unmodified promoter. An increase or decrease in the protein and / or polypeptide expression rate and / or transcription rate indicates whether a particular modification results in the modified promoter showing an increased or decreased expression / transcription rate and thus shows promoter activity. Thus, the method of the invention can also be defined as a method for identifying promoter variants that show an increased or decreased expression rate when operably linked to a nucleic acid sequence encoding a polypeptide or protein, for example.
[0024] As used herein, the term "operably linked" refers to a functional relationship between polynucleotide elements. A nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. If a promoter affects transcription of a coding sequence, it is operably linked to the coding sequence. Operably linked can mean that the nucleic acid sequences being linked are contiguous.
[0025] As used herein, a "promoter" refers to a nucleic acid fragment that functions to control the transcription of one or more nucleic acid molecules. A promoter is typically located upstream (5') relative to the transcriptional direction of the transcriptional start site of a gene and is structurally identified by the presence of a binding site for DNA-dependent RNA polymerase, a transcriptional start site, and may also contain any other nucleic acid sequences, including but not limited to transcription factor binding sites, repressor and activator protein binding sites, and any other sequences of nucleotides known to those skilled in the art that act directly or indirectly to regulate the amount of transcription from the promoter. A "promoter variant" is a promoter modified by the methods of the present invention.
[0026] Insertion of at least one nucleic acid sequence is understood to mean inserting a nucleic acid sequence into an existing promoter sequence. The sequence can be inserted at any position within the promoter sequence. Insertion of a nucleic acid sequence only adds nucleotides to the original promoter sequence; no nucleotides of the original promoter sequence are removed. By this modification, the length of the promoter sequence changes with the number of nucleotides inserted by the insertion. The positions of the nucleotides before the insertion site remain unchanged. The positions of the nucleotides after the insertion site change with the number of nucleotides inserted. If multiple insertions occur, the position of each nucleotide is determined by adding the number of nucleotides inserted before them to the original position.
[0027] Substituting nucleotides of a promoter sequence for insertion of at least one nucleic acid sequence is an exchange of a portion of the existing promoter sequence with a nucleic acid sequence. During substitution, the same number of nucleotides in the original promoter sequence are removed as new nucleotides are added. This does not change the positions of the individual nucleotides upstream and downstream. Since the promoter length can have an impact on its activity and overall behavior, it is preferred to modify the promoter by substitution such that the promoter is modified by substituting nucleotides of the promoter sequence to introduce at least one nucleic acid sequence selected from the group consisting of GATAX 1 X 2 X 3 X 4 X 5 X 6 (X 7 ) m , ATCCTTTTAG (SEQ ID No.1), and AAA into the promoter.
[0028] In the first step of the method for modifying a promoter, a promoter must be provided. The promoter can be of any origin. The promoter can be a naturally occurring promoter, but can also be a variant of such a naturally occurring sequence. Hybrid forms of several naturally occurring promoters are also suitable. Synthetically produced promoter sequences can also be used. Those skilled in the art know how to produce such sequences.
[0029] One of the neutral nucleic acid sequences that can be used in the method of the present invention consists of the nucleic acid sequence GATAX 1 X 2 X 3 X 4 X 5 X 6 (X 7 ) m This nucleic acid sequence can be used to modify the original promoter by insertion or substitution. X 1 to X 7 represent nucleotides. These nucleotides are preferably selected from the group consisting of A, C, G, and T.
[0030] According to a particularly preferred embodiment of the present invention, X 1 is A or T, X 2 is C or G, X 3 is C or G, X 4 is C or G, X 5 is A or T, and X 6 is C or G, where X 1 is even more preferably A, X 2 is even more preferably C, X 3 is even more preferably C, X 4 is even more preferably G, X 5 is even more preferably T, and X 6 is even more preferably G.
[0031] The nucleic acid sequence GATAX 1 X 2 X 3 X 4 X 5 X 6 (X 7 ) mIt can consist of 10 to 20 nucleotides, where the variable m defines the length of the nucleic acid sequence. m is defined as an integer between 0 and 10, and in a preferred embodiment of the present invention, m is an integer between 0 and 8, more preferably between 0 and 6, more preferably between 0 and 4, more preferably between 0 and 2. In a particularly preferred embodiment, m is 0, such that the nucleic acid sequence to be incorporated into the promoter has a length of 10 nucleotides. The change in the length of the nucleic acid sequence also changes the number of nucleotides substituted in the promoter.
[0032] In a particularly preferred embodiment of the present invention, the nucleic acid sequence to be incorporated into the promoter consists of GATAACCGTG (SEQ ID No.2). Such a nucleic acid sequence can be inserted into the promoter or replace the nucleotides of the promoter.
[0033] The nucleic acid sequence incorporated into the promoter by insertion and / or substitution can also consist of ATCCTTTTAG (SEQ ID No.1) and / or AAA. These nucleic acid sequences are also considered neutral nucleic acid sequences and can cause the modified promoter to exhibit an altered, preferably increased, transcription rate of the nucleic acid molecule encoding a polypeptide or protein.
[0034] In a particularly preferred embodiment of the present invention, the promoter can be modified by incorporating (by substitution or insertion) the nucleic acid sequence GATAX 1 X 2 X 3 X 4 X 5 X 6 (X 7 ) m 、ATCCTTTTAG (SEQ ID No.1) and AAA in various combinations. Particularly preferred is the incorporation of GATAX 1 X 2 X 3 X 4 X 5 X 6 (X 7 ) m and ATCCTTTTAG (SEQ ID No.1), GA-TAX 1 X 2 X 3 X 4 X 5 X 6 (X 7 ) m and AAA, ATCCTTTTAG (SEQ ID No.1) and AAA, or even all three of these nucleic acid sequences (i.e., GATAX 1 X 2 X 3X 4 X 5 X 6 (X 7 ) m , ATCCTTTTAG (SEQ ID No.1), and AAA).
[0035] According to a particularly preferred embodiment of the present invention, the promoter is modified in the regulatory region of the promoter. Modifications in the regulatory region of the promoter make it possible to identify potential regulatory hotspots and create modified promoters with an altered regulatory profile and increased promoter strength. The "regulatory region" of a promoter contains and / or consists of TFBSs and / or repressor binding sites. A transcription factor binding site is a region within the promoter that affects transcription. The regulatory region can be identified using semi-rational methods. A repressor binding site binds a polypeptide or protein that represses and thus reduces the transcription rate of the promoter. Modifications of the promoter sequence upstream or downstream of the TFBS or repressor binding site are particularly preferred.
[0036] According to another preferred embodiment of the present invention, the promoter is a eukaryotic promoter, i.e., a promoter directly derived from a eukaryotic cell or having functional activity in a eukaryotic cell. In an even more preferred embodiment of the present invention, the promoter to be modified is a fungal promoter. A fungal promoter is a promoter that naturally occurs in or has functional activity in cells of the fungal kingdom. Particularly preferred fungal promoters are yeast promoters, more preferably promoters of methylotrophic yeast cells.
[0037] According to an even more preferred embodiment of the present invention, the fungal promoter is a promoter from fungal cells of the phylum Ascomycota. Ascomycetes are very important to humans because they cause many diseases and are also relevant in medicine, the food industry, and ecosystems. Some representatives of the phylum Ascomycota are used for the production of recombinant proteins and polypeptides.
[0038] Promoters from fungal cells of the phylum Ascomycota are preferably from the genus Komagataella, more preferably from Komagataella phaffii. Other preferred promoters are DNA sequences that are active as promoters in filamentous fungi such as Trichoderma sp., Myceliophthora sp., Myceliophthora thermophila (e.g., Myceliophthora thermophila C1), and Aspergillus sp.
[0039] Due to its wide popularity, strength, and tight regulation, the alcohol oxidase 1 promoter of Komagataella phaffii (Pichia pastoris) is a prime example of promoter engineering. Using random engineering methods, variants with increased repression and higher expression can be generated.
[0040] Komagataella phaffii is one of the most important eukaryotic hosts for recombinant protein production, with the ability to produce and secrete high levels of proteins, glycosylation patterns, and a low amount of endogenous secreted proteins. The classical promoter sequences for the Komagataella phaffii expression system are still often used. New alternatives include promoters of genes related to the methanol utilization pathway. Thus, the catalase promoter of Komagataella phaffii has been described, which is not only methanol-inducible but also activated upon consumption of carbon sources in a process called derepression, thereby increasing the feasibility of protein production without methanol.
[0041] The modified promoter according to the present invention can be used to increase the expression of proteins or polypeptides in fungi, preferably Komagataella phaffii. In particular, the modified promoter of the present invention can increase the protein expression of antibodies and other binding proteins or fragments thereof, enzymes, food and feed proteins, biopharmaceutical proteins, structural proteins, and proteins for materials and cosmetics.
[0042] Even more preferably, the promoter according to the present invention is a yeast promoter, preferably related to the gene encoding catalase, preferably catalase from Komagataella phaffii, or heat shock protein, preferably heat shock protein 12, more preferably heat shock protein 12 from Komagataella phaffii.
[0043] Pichia farinosa is one of the most important eukaryotic hosts for recombinant protein production, with the ability to produce and secrete high levels of protein, a favorable glycosylation pattern, and a low amount of endogenous secreted proteins, to name just a few advantages. Although it has been shown that fine-tuning gene expression by employing promoter sequences with appropriate regulatory elements and strength is a viable method to increase the yield of the protein of interest, the classical promoter sequences of the Pichia farinosa (PAOX1 and PGAP) expression systems are still often used. Alternatives include promoters of genes associated with the MUT pathway. Among them, the catalase promoter of Pichia farinosa (such as PCTA1 (also known as PCAT)) was first described as a strong regulatory promoter with an interesting response to various carbon sources. These promoters can be induced not only by methanol but also activated when the carbon source is depleted, a mechanism known from regulatory sequences associated with carbon metabolism and called derepression. Due to the favorable qualities of PCTA1, it was selected as a target for promoter engineering to identify potential regulatory regions and generate new sequence-diversified promoter variants. Another very strong regulatory sequence is the promoter of heat shock protein (HSP12), called PDH, which can also be used as a promoter modified by the method of the present invention.
[0044] Filamentous fungi are commonly used as industrial protein production hosts for heterologous and homologous protein production, and they have great potential for the efficient large-scale production of recombinant gene products. Therefore, the promoters of the present invention can also be used in such cells.
[0045] For example, fungi of the genus Myceliophthora (such as Myceliophthora thermophila (also known as Chrysosporium thermophilum, Sporotrichum thermophile, Thiellavia heterothallica, and Corynascus heterothallicus), especially Myceliophthora thermophila C1) are filamentous fungi and can be used to produce, for example, thermostable enzymes, food and feed proteins, therapeutic proteins, and protein-based biomaterials. The high product titer of the protein makes it an interesting expression host for biotechnological applications.
[0046] Efficient protein expression depends on several factors, such as regulatory sequences, such as promoters, which have a great impact on the expression level. Therefore, promoter engineering is an effective tool to positively affect the gene expression level and increase the protein titer. For Myceliophthora thermophila, there are various published constitutive promoters and promoters of pyruvate decarboxylase-like genes, P PDC (MYCTH_112121; Gene ID: 11511210) is a target for promoter engineering to generate optimized promoter variants.
[0047] Thus, the promoter used in the present invention preferably comprises or consists of a nucleic acid sequence having at least 80% identity, preferably at least 90% identity, more preferably at least 95% identity with SEQ ID No. 3, SEQ ID No. 4 or SEQ ID No. 33, wherein particularly preferably, the promoter used in the present invention comprises or consists of the nucleic acid sequence SEQ ID No. 3, SEQ ID No. 4 or SEQ ID No. 33.
[0048] PCTA1 (SEQ ID No. 3):
[0049] TAATCGAACTCCGAATGCGGTTCTCCTGTAACCTTAATTGTAGCATAGATCACTTAAATAAACTCATGGCCTGACATCTGTACACGTTCTTATTGGTCTTTTAGCAATCTTGAAGTCTTTCTATTGTTCCGGTCGGCATTACCTAATAAATTCGAATCGAGATTGCTAGTACCTGATATCATATGAAGTAATCATCACATGCAAGTTCCATGATACCCTCTACTAATGGAATTGAACAAAGTTTAAGCTTCTCGCACGAGACCGAATCCATACTATGCACCCCTCAAAGTTGGGATTAGTCAGGAAAGCTGAGCAATTAACTTCCCTCGATTGGCCTGGACTTTTCGCTTAGCCTGCCGCAATCGGTAAGTTTCATTATCCCAGCGGGGTGATAGCCTCTGTTGCTCATCAGGCCAAAATCATATATAAGCTGTAGACCCAGCACTTCAATTACTTGAAATTCACCATAACACTTGCTCTAGTCAAGACTTACAATTAAA
[0050] PDH (SEQ ID No. 4):
[0051] CTTCAGTAAGAGAAGGAAGCTTGGTGACGATCACAGCTATGATGTAATAGAAATTGCTAAGCAATTGTGAGGTGTGATGTATTTTGCAGAGCAATTGTGCGGTACAACGGGGTGTTATTGTCTTCACAAGGCATTTATTGCGAATTTCGTAGTTGAAAGAATATTTTAGCACAGGGTGCTTGACCCCTATTGTTGCTCGCTAAACCATGATTGCTAAATGATGACATAGCAATCACTTTACTAAGATTGCTATAAGGACACCTTTCTTAGTATAAATGGACACTCTTTTCCCCTGCTAAACTTCTTTTATTTTTCACACTTAAACAGTTACAAAACACAAACACAACTAGAA
[0052] PDC (SEQ ID No. 33):
[0053] CCGAGTGTACTCCGTAAGGAGGGTTGGTCTCATGCCTCTTGGCGGGAGCCGCCCGATAACTAGTATAACTAGTTGTAACTCCGTATCCGGTTACGGAAACGGAAAGGCCCGCTCGGCTGTTCTCCGGCGGCTCCCCGATCGCTGATCAGAGCATGGAACAGATGTCAATTACATCACTCCCGCGTAAACGAACCATAGTTATCGAACCACAGTTATCGAACCACAGAGCCAGCCCATGGGAACGTCTGAACAGCTCGGAGGATGCAACCGATATTGCAATGCAAAACGTCACCCATGCTACAATTAATTCCCTGCACAACTACTTGTAAGCCGCGAGGCCTAGAACACAGTTGCAGAACCTGGGTATCGTGCCTGTGGTCTGATGCAGATATGTGTCACCACTCAAGACCCCGCCAACACGCCGCTTCGAGGCCCTGAACAGTACAAAGGGCGCTTCAAATTCGTACAAGCCCCCCCGAGGCCGTTTTCAAGTCTTTGTATGACCATCTATTTTCCGATTGACGTCCCTCACGGATTCTCTTTCGTTGCTGACCTCCTTGTGACCACAAACATCGCCAACAACAGAC
[0054] The "identity" of two or more nucleic acid sequences can be determined by aligning these nucleic acid sequences. Alignment can be performed using version 2.13.0 of the BLAST (National Center for Biotechnology Information (NCBI) Basic Local Alignment Search Tool) software with default parameters. The % nucleic acid sequence identity between nucleic acid sequences can be determined using standard nucleotide BLAST with the following default parameters: maximum target sequences: 100; short queries: automatically adjust parameters for short input sequences; expected threshold: 10; word size: 28; Max matches in query range: 0; match / mismatch scores: 1, -2; gap costs: linear; filter: low complexity regions; mask: mask only for lookup tables. Using the NCBI BLAST version 2.13.0 algorithm with default parameters, a sequence with an identity score of XX% (e.g., 80%) relative to a reference sequence is considered to be at least XX% identical to the reference sequence, or equivalently, to have XX% sequence identity.
[0055] Also covered are promoter variants truncated at the 5' end and / or 3' end of the promoter, which are derived from the promoter. Thus, the truncated forms of the promoter variants of the present invention may include 5'-deletions and / or 3'-deletions of 1 to 200, preferably 1 to 150, more preferably 1 to 100, more preferably 1 to 50 nucleotides, provided that the truncation does not include a nucleic acid sequence insertion and / or substitution at a site selected from the group consisting of GATAX 1 X 2 X 3 X 4 X 5 X 6 (X 7 ) m 、ATCCTTTTAG (SEQ ID No.1) and AAA into the promoter.
[0056] The following modifications of the promoter comprising or consisting of a nucleic acid sequence having at least 80% identity to SEQ ID No. 3 or SEQ ID No. 4 are preferably substitutions of nucleotides of the promoter sequence to introduce at least one nucleic acid sequence selected from the group consisting of GATAX 1 X 2 X 3 X 4 X 5 X 6 (X 7 ) m 、ATCCTTTTAG (SEQ ID No.1) and AAA into the promoter.
[0057] A promoter comprising or consisting of a nucleic acid sequence having at least 80% identity to SEQ ID No. 3 can be modified according to the present invention. Modification of the promoter according to the present invention results in a promoter that exhibits improved properties compared to the wild-type / unmodified promoter, in particular it results in increased transcriptional efficiency and thus increased protein expression. According to the present invention, the promoter can be further improved by making multiple modifications.
[0058] According to a particularly preferred embodiment of the present invention, a promoter comprising or consisting of a nucleic acid sequence having at least 80% identity to SEQ ID No. 3 is modified within at least one promoter region selected from the group consisting of positions 1 to 20, positions 131 to 150, positions 251 to 270, positions 371 to 390, positions 401 to 410, and positions 461 to 480 of SEQ ID No. 3. Even more preferably, a promoter comprising or consisting of a nucleic acid sequence having at least 80% identity to SEQ ID No. 3 is modified within at least one promoter region selected from the group consisting of positions 1 to 10, positions 131 to 140, positions 251 to 260, positions 371 to 380, positions 401 to 410, and positions 471 to 480 of SEQ ID No. 3. In an even more preferred embodiment, positions 1 to 10 are thereby preferably modified with ATCCTTTTAG (SEQ ID No. 1), and positions 131 to 140, 251 to 260, 371 to 380, positions 401 to 410, and 471 to 480 are preferably modified with GATAX 1 X 2 X 3 X 4 X 5 X 6 (X 7 ) m modification.
[0059] By introducing at least one nucleic acid sequence selected from the group consisting of GATAX 1 X 2 X 3 X 4 X 5 X 6 (X 7 ) m 、ATCCTTTTAG (SEQ ID No. 1) and AAA, or substituting nucleotides of the promoter to introduce at least one nucleic acid sequence selected from the group consisting of GATAX 1 X 2 X 3 X 4 X 5 X 6 (X 7 )m 、at least one nucleic acid sequence of the group consisting of ATCCTTTTAG (SEQ ID No.1) and AAA and comprising a nucleic acid sequence having at least 80% identity with SEQ ID No.3 or consisting thereof at one or more of the above sites results in a promoter variant showing a significantly increased transcription rate compared to the wild-type promoter, whereby the nucleic acid sequence GATAX 1 X 2 X 3 X 4 X 5 X 6 (X 7 ) m is preferably used for promoter modification.
[0060] According to another particularly preferred embodiment of the invention, a promoter comprising a nucleic acid sequence having at least 80% identity with SEQ ID No.3 or consisting thereof is simultaneously modified at the following positions: positions 1 to 10, 131 to 140 and 251 to 260; or 131 to 140, 251 to 260 and 401 to 410; or 131 to 140, 251 to 260 and 471 to 480; or 1 to 10, 131 to 140, 251 to 260 and 371 to 380; or 1 to 10, 131 to 140, 251 to 260 and 471 to 480; or 1 to 10, 131 to 140, 251 to 260, 371 to 380, 401 to 410 and 471 to 480.
[0061] According to the invention, the promoter can also be additionally modified by deletion. Modifying the promoter sequence by deletion means that certain nucleotides of the original promoter sequence are eliminated. No new nucleotides are added to the promoter sequence. Deletion of a single nucleotide or a nucleic acid fragment within the promoter to be modified can also affect the transcription rate of a nucleic acid sequence operably linked to such a promoter. Thus, it is particularly preferred to delete one or more, preferably one, two, three, four, five, six or even all of the nucleotides within positions 89 - 101, 137, 138, 162, 176 and / or 448 to 468 of a promoter comprising a nucleic acid sequence having at least 80% identity with SEQ ID No.3 or consisting thereof. Deletion at a putative transcription factor binding site is particularly preferred.
[0062] According to a particularly preferred embodiment of the invention, a promoter comprising or consisting of a nucleic acid sequence having at least 80% identity with SEQ ID No. 3 is modified by substitution at positions 371 to 380 and by deletion at positions 89 to 101, 137, 138, 162 and 176, or is modified by substitution at positions 251 to 260 and by deletion at positions 89 to 101, 137, 138, 162 and 176, or is modified by substitution at positions 131 to 140 and 251 to 260 and by deletion at positions 448 to 468, or is modified by substitution at positions 1 to 10 and 251 to 260 and by deletion at positions 448 to 468.
[0063] These promoter modifications result in improved product expression characteristics, in particular an increased expression rate. In particular, the multiple modifications according to the invention are particularly advantageous. If these multiple modifications are carried out at defined positions, the characteristics of the promoter can be further improved.
[0064] According to a particularly preferred embodiment of the invention, a promoter comprising or consisting of a nucleic acid sequence having at least 80% identity with SEQ ID No. 4 is modified in at least one region selected from the group consisting of positions 1 to 20, positions 151 to 170 and positions 171 to 190, preferably at positions 1 to 20, positions 161 to 170 and positions 171 to 180. In so doing, even more preferably, a promoter comprising or consisting of a nucleic acid sequence having at least 80% identity with SEQ ID No. 4 is simultaneously modified at positions 161 to 170 and 171 to 180 or at positions 11 to 20, 161 to 170 and 171 to 180.
[0065] The results show that the modification of the aforementioned regions of the PDH promoter as defined results in the modified promoter showing an increased transcription rate of the nucleic acid sequence operably linked thereto compared to the wild-type promoter.
[0066] To further increase the transcription rate, a promoter comprising or consisting of a nucleic acid sequence having at least 80% identity with SEQ ID No. 4 is modified with the nucleic acid sequence AAA in a specific region. Thus, the characteristics of the promoter can be further improved by multiple modifications with the nucleic acid sequence AAA at specific positions.
[0067] According to a particularly preferred embodiment of the invention, a promoter comprising or consisting of a nucleic acid sequence having at least 80% identity with SEQ ID No. 4 is modified with nucleic acid AAA in at least one promoter region selected from the group consisting of positions 235 to 237 and positions 349 to 351.
[0068] According to a particularly preferred embodiment of the present invention, a promoter comprising or consisting of a nucleic acid sequence having at least 80% identity to SEQ ID No. 4 is modified, preferably substituted, with the nucleic acid AAA within at least one promoter region selected from the group consisting of positions 37 to 39, positions 103 to 105, positions 109 to 111, positions 178 to 180, positions 235 to 237, and positions 349 to 351.
[0069] According to a particularly preferred embodiment of the present invention, a promoter comprising or consisting of a nucleic acid sequence having at least 80% identity to SEQ ID No. 4 is modified within at least one promoter region selected from the group consisting of positions 161 to 170, positions 171 to 180, positions 37 to 39, positions 103 to 105, positions 109 to 111, positions 121 to 130, positions 178 to 180, positions 235 to 237, and positions 349 to 351, wherein positions 121 to 130, 161 to 170, and positions 171 to 180 are preferably modified with the nucleic acid GATAX 1 X 2 X 3 X 4 X 5 X 6 (X 7 ) m and positions 37 to 39, positions 103 to 105, positions 109 to 111, positions 178 to 180, positions 235 to 237, and positions 349 to 351 are preferably modified with the nucleic acid AAA.
[0070] According to a preferred embodiment of the present invention, a promoter comprising or consisting of a nucleic acid sequence having at least 80% identity to SEQ ID No. 33 is within at least one promoter region selected from the group consisting of positions 1 to 10, positions 21 to 30, positions 141 to 150, positions 461 to 470, positions 61 to 70, positions 281 to 290, positions 361 to 370, positions 301 to 310, and positions 561 to 570 of SEQ ID No. 33, preferably within positions 1 to 10 and / or positions 461 to 470 of SEQ ID No. 33, and is modified.
[0071] According to another preferred embodiment of the present invention, a promoter comprising or consisting of a nucleic acid sequence having at least 80% identity to SEQ ID No. 33 is modified with GATAX 1 X 2 X 3 X 4 X 5 X 6 (X 7 ) m, preferably modified with SEQ ID No.2. These aforementioned regions are preferably GATAX 1 X 2 X 3 X 4 X 5 X 6 (X 7 ) m substituted, preferably substituted with SEQ ID No.2.
[0072] The present invention also relates to promoter variants obtainable by the methods described in the present invention. The resulting promoters have improved properties compared to the original promoters from which they are derived. Compared to the original promoters, the promoter variants according to the present invention preferably exhibit a higher transcription rate of the nucleic acid sequence operably linked thereto. The promoter variants according to the present invention can be used in all fields requiring high-level protein production.
[0073] Compared to their respective original promoters, the promoters produced and / or identified using the methods of the present invention have improved properties. Preferably, these promoters have an increased transcription rate, particularly they exhibit a higher transcription rate under methanol induction conditions and / or under derepression conditions.
[0074] According to a particularly preferred embodiment of the present invention, these promoter variants comprise or consist of a nucleic acid sequence selected from the group consisting of SEQ ID No.5, SEQ ID No.6, SEQ ID No.7, SEQ ID No.8, SEQ ID No.9, SEQ ID No.10, SEQ ID No.11, SEQ ID No.12, SEQ ID No.13, SEQ ID No.14, SEQ ID No.15, SEQ ID No.16, SEQ ID No.17, SEQ ID No.18, SEQ ID No.19, SEQ ID No.20, SEQ ID No.21, SEQ ID No.22, SEQ ID No.23 and SEQ ID No.24. These promoters are preferably used in yeast cells to control the expression of homologous and / or heterologous proteins and / or peptides.
[0075] SEQ ID No.5:
[0076] ATCCTTTTAGCCGAATGCGGTTCTCCTGTAACCTTAATTGTAGCATAGATCACTTAAA-TAAACTCATGGCCTGACATCTGTACACGTTCTTATTGGTCTTTTAGCAATCTTGAAGTCTTTCTATTGTTCCGGTCGGCATTACCTAATAAATTCGAATCGAGATTGCTAGTAC-CTGA-TATCATATGAAGTAATCATCACATGCAAGTTCCATGATACCCTCTACTAATGGAATTGAACAAAGTTTAAGCTTCTCGCACGAGACCGAATCCATACTATGCACCCCTCAAAGTT-GG-GATTAGTCAGGAAAGCTGAGCAATTAACTTCCCTCGATTGGCCTGGACTTTTCGCTTAGCCTGCCGCAATCGGTAAGTTTCATTATCCCAGCGGGGTGATAGCCTCTGTT-GCTCATCAGGCCAAAATCATATATAAGCTGTAGACCCAGCACTTCAATTACTTGAAATTCACCATAACACTTGCTCTAGTCAAGACTTACAATTAAA
[0077] SEQ ID No.6:
[0078] TAATCGAACTCCGAATGCGGTTCTCCTGTAACCTTAATTGTAGCATAGATCACTTAAA-TAAACTCATGGCCTGACATCTGTACACGTTCTTATTGGTCTTTTAGCAATCTTGAAGTCTTTCTATTGTTCCGATAACCGTGACCTAATAAATTCGAATCGAGATTGCTAGTAC-CTGA-TATCATATGAAGTAATCATCACATGCAAGTTCCATGATACCCTCTACTAATGGAATTGAACAAAGTTTAAGCTTCTCGCACGAGACCGAATCCATACTATGCACCCCTCAAAGTT-GG-GATTAGTCAGGAAAGCTGAGCAATTAACTTCCCTCGATTGGCCTGGACTTTTCGCTTAGCCTGCCGCAATCGGTAAGTTTCATTATCCCAGCGGGGTGATAGCCTCTGTT-GCTCATCAGGCCAAAATCATATATAAGCTGTAGACCCAGCACTTCAATTACTTGAAATTCACCATAACACTTGCTCTAGTCAAGACTTACAATTAAA
[0079] SEQ ID No.7:
[0080] TAATCGAACTCCGAATGCGGTTCTCCTGTAACCTTAATTGTAGCATAGATCACTTAAA-TAAACTCATGGCCTGACATCTGTACACGTTCTTATTGGTCTTTTAGCAATCTTGAAGTCTTTCTATTGTTCCGGTCGGCATTACCTAATAAATTCGAATCGAGATTGCTAGTAC-CTGA-TATCATATGAAGTAATCATCACATGCAAGTTCCATGATACCCTCTACTAATGGAATTGAACAAAGTTTAAGCTTGATAACCGTGACCGAATCCATACTATGCACCCCTCAAAGTT-GG-GATTAGTCAGGAAAGCTGAGCAATTAACTTCCCTCGATTGGCCTGGACTTTTCGCTTAGCCTGCCGCAATCGGTAAGTTTCATTATCCCAGCGGGGTGATAGCCTCTGTT-GCTCATCAGGCCAAAATCATATATAAGCTGTAGACCCAGCACTTCAATTACTTGAAATTCACCATAACACTTGCTCTAGTCAAGACTTACAATTAAA
[0081] SEQ ID No.8:
[0082] TAATCGAACTCCGAATGCGGTTCTCCTGTAACCTTAATTGTAGCATAGATCACTTAAA-TAAACTCATGGCCTGACATCTGTACACGTTCTTATTGGTCTTTTAGCAATCTTGAAGTCTTTCTATTGTTCCGGTCGGCATTACCTAATAAATTCGAATCGAGATTGCTAGTAC-CTGA-TATCATATGAAGTAATCATCACATGCAAGTTCCATGATACCCTCTACTAATGGAATTGAACAAAGTTTAAGCTTCTCGCACGAGACCGAATCCATACTATGCACCCCTCAAAGTT-GG-GATTAGTCAGGAAAGCTGAGCAATTAACTTCCCTCGATTGGCCTGGACTTTTCGCTTAGCCTGCCGCAATCGGTAAGGATAACCGTGCCAGCGGGGTGATAGCCTCTGTT-GCTCATCAGGCCAAAATCATATATAAGCTGTAGACCCAGCACTTCAATTACTTGAAATTCACCATAACACTTGCTCTAGTCAAGACTTACAATTAAA
[0083] SEQ ID No.9:
[0084] TAATCGAACTCCGAATGCGGTTCTCCTGTAACCTTAATTGTAGCATAGATCACTTAAA-TAAACTCATGGCCTGACATCTGTACACGTTCTTATTGGTCTTTTAGCAATCTTGAAGTCTTTCTATTGTTCCGGTCGGCATTACCTAATAAATTCGAATCGAGATTGCTAGTAC-CTGA-TATCATATGAAGTAATCATCACATGCAAGTTCCATGATACCCTCTACTAATGGAATTGAACAAAGTTTAAGCTTCTCGCACGAGACCGAATCCATACTATGCACCCCTCAAAGTT-GG-GATTAGTCAGGAAAGCTGAGCAATTAACTTCCCTCGATTGGCCTGGACTTTTCGCTTAGCCTGCCGCAATCGGTAAGTTTCATTATCCCAGCGGGGTGATAGCCTCTGTT-GCTCATCAGGCCAAAATCATATATAAGCTGTAGACCCAGCACTTCAATTACTTGAAATTCACCATAAGATAACCGTGAGTCAAGACTTACAATTAAASEQ ID No.10:
[0085] TAATCGAACTCCGAATGCGGTTCTCCTGTAACCTTAATTGTAGCATAGATCACTTAAA-TAAACTCATGGCCTGACATCTGTACACGTTCTTATTGGTCTTTTAGCAATCTTGAAGTCTTTCTATTGTTCCGATAACCGTGACCTAATAAATTCGAATCGAGATTGCTAGTAC-CTGA-TATCATATGAAGTAATCATCACATGCAAGTTCCATGATACCCTCTACTAATGGAATTGAACAAAGTTTAAGCTTGATAACCGTGACCGAATCCATACTATGCACCCCTCAAAGTT-GG-GATTAGTCAGGAAAGCTGAGCAATTAACTTCCCTCGATTGGCCTGGACTTTTCGCTTAGCCTGCCGCAATCGGTAAGTTTCATTATCCCAGCGGGGTGATAGCCTCTGATAAC-CGTGAGGCCAAAATCATATATAAGCTGTAGACCCAGCACTTCAATTACTTGAAATTCACCATAACACTTGCTCTAGTCAAGACTTACAATTAAA
[0086] SEQ ID No.11:
[0087] TAATCGAACTCCGAATGCGGTTCTCCTGTAACCTTAATTGTAGCATAGATCACTTAAA-TAAACTCATGGCCTGACATCTGTACACGTTCTTATTGGTCTTTTAGCAATCTTGAAGTCTTTCTATTGTTCCGATAACCGTGACCTAATAAATTCGAATCGAGATTGCTAGTAC-CTGA-TATCATATGAAGTAATCATCACATGCAAGTTCCATGATACCCTCTACTAATGGAATTGAACAAAGTTTAAGCTTGATAACCGTGACCGAATCCATACTATGCACCCCTCAAAGTT-GG-GATTAGTCAGGAAAGCTGAGCAATTAACTTCCCTCGATTGGCCTGGACTTTTCGCTTAGCCTGCCGCAATCGGTAAGTTTCATTATCCCAGCGGGGTGATAGCCTCTGTT-GCTCATCAGGCCAAAATCATATATAAGCTGTAGACCCAGCACTTCAATTACTTGAAATTCACCATAAGATAACCGTGAGTCAAGACTTACAATTAAASEQ ID No.12:
[0088] ATCCTTTTAGCCGAATGCGGTTCTCCTGTAACCTTAATTGTAGCATAGATCACTTAAA-TAAACTCATGGCCTGACATCTGTACACGTTCTTATTGGTCTTTTAGCAATCTTGAAGTCTTTCTATTGTTCCGATAACCGTGACCTAATAAATTCGAATCGAGATTGCTAGTAC-CTGA-TATCATATGAAGTAATCATCACATGCAAGTTCCATGATACCCTCTACTAATGGAATTGAACAAAGTTTAAGCTTGATAACCGTGACCGAATCCATACTATGCACCCCTCAAAGTT-GG-GATTAGTCAGGAAAGCTGAGCAATTAACTTCCCTCGATTGGCCTGGACTTTTCGCTTAGCCTGCCGCAATCGGTAAGTTTCATTATCCCAGCGGGGTGATAGCCTCTGTT-GCTCATCAGGCCAAAATCATATATAAGCTGTAGACCCAGCACTTCAATTACTTGAAATTCACCATAACACTTGCTCTAGTCAAGACTTACAATTAAA
[0089] SEQ ID No.13:
[0090] ATCCTTTTAGCCGAATGCGGTTCTCCTGTAACCTTAATTGTAGCATAGATCACTTAAATAAACTCATGGCCTGACATCTGTACACGTTCTTATTGGTCTTTTAGCAATCTTGAAGTCTTTCTATTGTTCCGATAACCGTGACCTAATAAATTCGAATCGAGATTGCTAGTACCTGATATCATATGAAGTAATCATCACATGCAAGTTCCATGATACCCTCTACTAATGGAATTGAACAAAGTTTAAGCTTGATAACCGTGACCGAATCCATACTATGCACCCCTCAAAGTTGGGATTAGTCAGGAAAGCTGAGCAATTAACTTCCCTCGATTGGCCTGGACTTTTCGCTTAGCCTGCCGCAATCGGTAAGGATAACCGTGCCAGCGGGGTGATAGCCTCTGTTGCTCATCAGGCCAAAATCATATATAAGCTGTAGACCCAGCACTTCAATTACTTGAAATTCACCATAACACTTGCTCTAGTCAAGACTTACAATTAAA
[0091] SEQ ID No.14:
[0092] ATCCTTTTAGCCGAATGCGGTTCTCCTGTAACCTTAATTGTAGCATAGATCACTTAAATAAACTCATGGCCTGACATCTGTACACGTTCTTATTGGTCTTTTAGCAATCTTGAAGTCTTTCTATTGTTCCGATAACCGTGACCTAATAAATTCGAATCGAGATTGCTAGTACCTGATATCATATGAAGTAATCATCACATGCAAGTTCCATGATACCCTCTACTAATGGAATTGAACAAAGTTTAAGCTTGATAACCGTGACCGAATCCATACTATGCACCCCTCAAAGTTGGGATTAGTCAGGAAAGCTGAGCAATTAACTTCCCTCGATTGGCCTGGACTTTTCGCTTAGCCTGCCGCAATCGGTAAGTTTCATTATCCCAGCGGGGTGATAGCCTCTGTTGCTCATCAGGCCAAAATCATATATAAGCTGTAGACCCAGCACTTCAATTACTTGAAATTCACCATAAGATAACCGTGAGTCAAGACTTACAATTAAA
[0093] SEQ ID No.15:
[0094] ATCCTTTTAGCCGAATGCGGTTCTCCTGTAACCTTAATTGTAGCATAGATCACTTAAATAAACTCATGGCCTGACATCTGTACACGTTCTTATTGGTCTTTTAGCAATCTTGAAGTCTTTCTATTGTTCCGATAACCGTGACCTAATAAATTCGAATCGAGATTGCTAGTACCTGATATCATATGAAGTAATCATCACATGCAAGTTCCATGATACCCTCTACTAATGGAATTGAACAAAGTTTAAGCTTGATAACCGTGACCGAATCCATACTATGCACCCCTCAAAGTTGGGATTAGTCAGGAAAGCTGAGCAATTAACTTCCCTCGATTGGCCTGGACTTTTCGCTTAGCCTGCCGCAATCGGTAAGGATAACCGTGCCAGCGGGGTGATAGCCTCTGATAACCGTGAGGCCAAAATCATATATAAGCTGTAGACCCAGCACTTCAATTACTTGAAATTCACCATAAGATAACCGTGAGTCAAGACTTACAATTAAA
[0095] SEQ ID No.16:
[0096] CTTCAGTAAGGATAACCGTGTTGGTGACGATCACAGCTATGATGTAATAGAAATT-GCTAA-GCAATTGTGAGGTGTGATGTATTTTGCAGAGCAATTGTGCGGTACAACGGGGTGTTATTGTCTTCACAAGGCATTTATTGCGAATTTCGTAGTTGAAAGAATATTTTAG-CACAGGGTGCTTGACCCCTATTGTTGCTCGCTAAACCATGATTGCTAAATGATGACATAGCAATCACTTTACTAAGATTGCTATAAGGACACCTTTCTTAGTATAAATGGACAC-TCTTTTCCCCTGCTAAACTTCTTTTATTTTTCACACTTAAACAGTTACAAAACACAAACACAACTAGAA
[0097] SEQ ID No.17:
[0098] CTTCAGTAAGAGAAGGAAGCTTGGTGACGATCACAGCTATGATGTAATAGAAATT-GCTAA-GCAATTGTGAGGTGTGATGTATTTTGCAGAGCAATTGTGCGGTACAACGGGGTGTTATTGGATAACCGTGGCATTTATTGCGAATTTCGTAGTTGAAAGAATATTTTAG-CACAGGGTGCTTGACCCCTATTGTTGCTCGCTAAACCATGATTGCTAAATGATGACATAGCAATCACTTTACTAAGATTGCTATAAGGACACCTTTCTTAGTATAAATGGACAC-TCTTTTCCCCTGCTAAACTTCTTTTATTTTTCACACTTAAACAGTTACAAAACACAAACACAACTAGAA
[0099] SEQ ID No.18:
[0100] CTTCAGTAAGAGAAGGAAGCTTGGTGACGATCACAGCTATGATGTAATAGAAATT-GCTAA-GCAATTGTGAGGTGTGATGTATTTTGCAGAGCAATTGTGCGGTACAACGGGGTGTTATTGTCTTCACAAGGCATTTATTGCGAATTTCGTAGTTGAAAGAGATAAC-CGTGACAGGGTGCTTGACCCCTATTGTTGCTCGCTAAACCATGATTGCTAAATGATGACATAGCAATCACTTTACTAAGATTGCTATAAGGACACCTTTCTTAG-TATAAATGGACAC-TCTTTTCCCCTGCTAAACTTCTTTTATTTTTCACACTTAAACAGTTACAAAACACAAACACAACTAGAA
[0101] SEQ ID No.19:
[0102] CTTCAGTAAGAGAAGGAAGCTTGGTGACGATCACAGCTATGATGTAATAGAAATT-GCTAA-GCAATTGTGAGGTGTGATGTATTTTGCAGAGCAATTGTGCGGTACAACGGGGTGTTATTGTCTTCACAAGGCATTTATTGCGAATTTCGTAGTTGAAAGAATATTTTAGCGATAAC-CGTGTGACCCCTATTGTTGCTCGCTAAACCATGATTGCTAAATGATGACATAGCAATCACTTTACTAAGATTGCTATAAGGACACCTTTCTTAGTATAAATGGACAC-TCTTTTCCCCTGCTAAACTTCTTTTATTTTTCACACTTAAACAGTTACAAAACACAAACACAACTAGAA
[0103] SEQ ID No.20:
[0104] CTTCAGTAAGAGAAGGAAGCTTGGTGACGATCACAGCTATGATGTAATAGAAATT-GCTAA-GCAATTGTGAGGTGTGATGTATTTTGCAGAGCAATTGTGCGGTACAACGGGGTGTTATTGTCTTCACAAGGCATTTATTGCGAATTTCGTAGTTGAAAGAGATAACCGTGGATAAC-CGTGTGACCCCTATTGTTGCTCGCTAAACCATGATTGCTAAATGATGACATAGCAATCACTTTACTAAGATTGCTATAAGGACACCTTTCTTAGTATAAATGGACAC-TCTTTTCCCCTGCTAAACTTCTTTTATTTTTCACACTTAAACAGTTACAAAACACAAACACAACTAGAA
[0105] SEQ ID No.21:
[0106] CTTCAGTAAGGATAACCGTGTTGGTGACGATCACAGCTATGATGTAATAGAAATT-GCTAA-GCAATTGTGAGGTGTGATGTATTTTGCAGAGCAATTGTGCGGTACAACGGGGTGTTATTGTCTTCACAAGGCATTTATTGCGAATTTCGTAGTTGAAAGAGATAACCGTGGATAAC-CGTGTGACCCCTATTGTTGCTCGCTAAACCATGATTGCTAAATGATGACATAGCAATCACTTTACTAAGATTGCTATAAGGACACCTTTCTTAGTATAAATGGACAC-TCTTTTCCCCTGCTAAACTTCTTTTATTTTTCACACTTAAACAGTTACAAAACACAAACACAACTAGAA
[0107] SEQ ID No.22:
[0108] CTTCAGTAAGAGAAGGAAGCTTGGTGACGATCACAGCTATGATGTAATAGAAATT-GCTAA-GCAATTGTGAGGTGTGATGTATTTTGCAGAGCAATTGTGCGGTACAACGGGGTGTTATTGTCTTCACAAGGCATTTATTGCGAATTTCGTAGTTGAAAGAATATTTTAGCACAGGG-TAAATGACCCCTATTGTTGCTCGCTAAACCATGATTGCTAAATGATGACATAGCAATCAAATTACTAAGATTGCTATAAGGACACCTTTCTTAGTATAAATGGACAC-TCTTTTCCCCTGCTAAACTTCTTTTATTTTTCACACTTAAACAGTTACAAAACACAAACACAACTAAAA
[0109] SEQ ID No.23:
[0110] CTTCAGTAAGAGAAGGAAGCTTGGTGACGATCACAGAAATGATGTAATAGAAATT-GCTAA-GCAATTGTGAGGTGTGATGTATTTTGCAGAGCAATTGTGCGGAAAAACAAAGTGTTATTGTCTTCACAAGGCATTTATTGCGAATTTCGTAGTTGAAAGAATATTTTAGCACAGGG-TAAATGACCCCTATTGTTGCTCGCTAAACCATGATTGCTAAATGATGACATAGCAATCAAATTACTAAGATTGCTATAAGGACACCTTTCTTAGTATAAATGGACAC-TCTTTTCCCCTGCTAAACTTCTTTTATTTTTCACACTTAAACAGTTACAAAACACAAACACAACTAAAA
[0111] SEQ ID No.24:
[0112] CTTCAGTAAGAGAAGGAAGCTTGGTGACGATCACAGCTATGATGTAATAGAAATT-GCTAA-GCAATTGTGAGGTGTGATGTATTTTGCAGAGCAATTGTGCGGTACAACGGGGTGTTATTGTCTTCACAAGGCATTTATTGCGAATTTCGTAGTTGAAAGAGATAACCGTGGATAAC-CGTGTGACCCCTATTGTTGCTCGCTAAACCATGATTGCTAAATGATGACATAGCAATCAAATTACTAAGATTGCTATAAGGACACCTTTCTTAGTATAAATGGACAC-TCTTTTCCCCTGCTAAACTTCTTTTATTTTTCACACTTAAACAGTTACAAAACACAAACACAACTAAAA
[0113] According to another preferred embodiment of the present invention, these promoter variants comprise or consist of a nucleic acid sequence selected from the group consisting of SEQ ID No.34, SEQ ID No.35, SEQ ID No.36, SEQ ID No.37, SEQ ID No.38, SEQ ID No.39, SEQ ID No.40, SEQ ID No.41 and SEQ ID No.42, wherein SEQ ID No.34, SEQ ID No.35, SEQ ID No.36 and SEQ ID No.37 are most preferred. These promoters are preferably used in fungal cells (except yeast cells) to control the expression of homologous and / or heterologous proteins and / or peptides. In particular, promoter variants comprising or consisting of the nucleic acid sequences SEQ ID No.34 and SEQ ID No.35 have proven capable of increasing the expression of a protein / peptide operably linked thereto several-fold.
[0114] SEQ ID No.34:
[0115] CCGAGTGTACTCCGTAAGGAGGGTTGGTCTCATGCCTCTTGGCGGGAGCCGCCCGA-TAACTAGTATAACTAGTTGTAACTCCGTATCCGGTTACGGAAACGGAAAGGCCCGCTCGGCTGTTCTCCGGCGGCTCCCCGATCGCTGATCAGAG-CATGGAACAGATGTCAATTACATCACTCCCGCGTAAACGAACCATAGTTATCGAACCACAGTTATCGAACCACAGAGCCAGCCCATGGGAACGTCTGAACAGCTCGGAG-GATGCAACCGA-TATTGCAATGCAAAACGTCACCCATGCTACAATTAATTCCCTGCACAACTACTTGTAAGCCGCGAGGCCTAGAACACAGTTGCAGAACCTGGG-TATCGTGCCTGTGGTCTGATGCAGA-TATGTGTCACCACTCAAGACCCCGCCAACACGCCGCTTCGAGGCCCTGAACAGTACAAAGGGCGCTTCAAAGATAACCGTGCCCCCCCGAGGCCGTTTTCAAGTCTTTGTATGAC-CATCTATTTTCCGATTGACGTCCCTCACGGATTCTCTTTCGTTGCTGACCTCCTTGTGACCACAAACATCGCCAACAACAGAC
[0116] SEQ ID No.35:
[0117] GATAACCGTGTCCGTAAGGAGGGTTGGTCTCATGCCTCTTGGCGGGAGCCGCCCGA-TAACTAGTATAACTAGTTGTAACTCCGTATCCGGTTACGGAAACGGAAAGGCCCGCTCGGCTGTTCTCCGGCGGCTCCCCGATCGCTGATCAGAG-CATGGAACAGATGTCAATTACATCACTCCCGCGTAAACGAACCATAGTTATCGAACCACAGTTATCGAACCACAGAGCCAGCCCATGGGAACGTCTGAACAGCTCGGAG-GATGCAACCGA-TATTGCAATGCAAAACGTCACCCATGCTACAATTAATTCCCTGCACAACTACTTGTAAGCCGCGAGGCCTAGAACACAGTTGCAGAACCTGGG-TATCGTGCCTGTGGTCTGATGCAGA-TATGTGTCACCACTCAAGACCCCGCCAACACGCCGCTTCGAGGCCCTGAACAGTACAAAGGGCGCTTCAAATTCGTACAAGCCCCCCCGAGGCCGTTTTCAAGTCTTTGTATGAC-CATCTATTTTCCGATTGACGTCCCTCACGGATTCTCTTTCGTTGCTGACCTCCTTGTGACCACAAACATCGCCAACAACAGAC
[0118] SEQ ID No.36:
[0119] CCGAGTGTACTCCGTAAGGAGATAACCGTGCATGCCTCTTGGCGGGAGCCGCCCGA-TAACTAGTATAACTAGTTGTAACTCCGTATCCGGTTACGGAAACGGAAAGGCCCGCTCGGCTGTTCTCCGGCGGCTCCCCGATCGCTGATCAGAG-CATGGAACAGATGTCAATTACATCACTCCCGCGTAAACGAACCATAGTTATCGAACCACAGTTATCGAACCACAGAGCCAGCCCATGGGAACGTCTGAACAGCTCGGAG-GATGCAACCGA-TATTGCAATGCAAAACGTCACCCATGCTACAATTAATTCCCTGCACAACTACTTGTAAGCCGCGAGGCCTAGAACACAGTTGCAGAACCTGGG-TATCGTGCCTGTGGTCTGATGCAGA-TATGTGTCACCACTCAAGACCCCGCCAACACGCCGCTTCGAGGCCCTGAACAGTACAAAGGGCGCTTCAAATTCGTACAAGCCCCCCCGAGGCCGTTTTCAAGTCTTTGTATGAC-CATCTATTTTCCGATTGACGTCCCTCACGGATTCTCTTTCGTTGCTGACCTCCTTGTGACCACAAACATCGCCAACAACAGAC
[0120] SEQ ID No.37:
[0121] CCGAGTGTACTCCGTAAGGAGGGTTGGTCTCATGCCTCTTGGCGGGAGCCGCCCGA-TAACTAGTATAACTAGTTGTAACTCCGTATCCGGTTACGGAAACGGAAAGGCCCGCTCGGCTGTTCTCCGGCGGCTCCCCGATCGATAACCGTGG-CATGGAACAGATGTCAATTACATCACTCCCGCGTAAACGAACCATAGTTATCGAACCACAGTTATCGAACCACAGAGCCAGCCCATGGGAACGTCTGAACAGCTCGGAG-GATGCAACCGA-TATTGCAATGCAAAACGTCACCCATGCTACAATTAATTCCCTGCACAACTACTTGTAAGCCGCGAGGCCTAGAACACAGTTGCAGAACCTGGG-TATCGTGCCTGTGGTCTGATGCAGA-TATGTGTCACCACTCAAGACCCCGCCAACACGCCGCTTCGAGGCCCTGAACAGTACAAAGGGCGCTTCAAATTCGTACAAGCCCCCCCGAGGCCGTTTTCAAGTCTTTGTATGAC-CATCTATTTTCCGATTGACGTCCCTCACGGATTCTCTTTCGTTGCTGACCTCCTTGTGACCACAAACATCGCCAACAACAGAC
[0122] SEQ ID No.38:
[0123] CCGAGTGTACTCCGTAAGGAGGGTTGGTCTCATGCCTCTTGGCGGGAGCCGCCCGA-TAACTAGTATAACTAGTTGTAACTCCGTATCCGGTTACGGAAACGGAAAGGCCCGCTCGGCTGTTCTCCGGCGGCTCCCCGATCGCTGATCAGAG-CATGGAACAGATGTCAATTACATCACTCCCGCGTAAACGAACCATAGTTATCGAACCACAGTTATCGAACCACAGAGCCAGCCCATGGGAACGTCTGAACAGCTCGGAG-GATGCAACCGA-TATTGCAATGATAACCGTGACCCATGCTACAATTAATTCCCTGCACAACTACTTGTAAGCCGCGAGGCCTAGAACACAGTTGCAGAACCTGGG-TATCGTGCCTGTGGTCTGATGCAGA-TATGTGTCACCACTCAAGACCCCGCCAACACGCCGCTTCGAGGCCCTGAACAGTACAAAGGGCGCTTCAAATTCGTACAAGCCCCCCCGAGGCCGTTTTCAAGTCTTTGTATGAC-CATCTATTTTCCGATTGACGTCCCTCACGGATTCTCTTTCGTTGCTGACCTCCTTGTGACCACAAACATCGCCAACAACAGAC
[0124] SEQ ID No.39:
[0125] CCGAGTGTACTCCGTAAGGAGGGTTGGTCTCATGCCTCTTGGCGGGAGCCGCCCGA-TAACTAGTATAACTAGTTGTAACTCCGTATCCGGTTACGGAAACGGAAAGGCCCGCTCGGCTGTTCTCCGGCGGCTCCCCGATCGCTGATCAGAG-CATGGAACAGATGTCAATTACATCACTCCCGCGTAAACGAACCATAGTTATCGAACCACAGTTATCGAACCACAGAGCCAGCCCATGGGAACGTCTGAACAGCTCGGAG-GATGCAACCGA-TATTGCAATGCAAAACGTCACCCATGCTACAATTAATTCCCTGCACAACTACTTGTAAGCCGCGAGGCCTAGAACACAGTTGCAGAACCGATAAC-CGTGGCCTGTGGTCTGATGCAGA-TATGTGTCACCACTCAAGACCCCGCCAACACGCCGCTTCGAGGCCCTGAACAGTACAAAGGGCGCTTCAAATTCGTACAAGCCCCCCCGAGGCCGTTTTCAAGTCTTTGTATGAC-CATCTATTTTCCGATTGACGTCCCTCACGGATTCTCTTTCGTTGCTGACCTCCTTGTGACCACAAACATCGCCAACAACAGAC
[0126] SEQ ID No.40:
[0127] CCGAGTGTACTCCGTAAGGAGGGTTGGTCTCATGCCTCTTGGCGGGAGCCGCCCGA-TAACTAGTATAACTAGTTGTAACTCCGTATCCGGTTACGGAAACGGAAAGGCCCGCTCGGCTGTTCTCCGGCGGCTCCCCGATCGCTGATCAGAG-CATGGAACAGATGTCAATTACATCACTCCCGCGTAAACGAACCATAGTTATCGAACCACAGTTATCGAACCACAGAGCCAGCCCATGGGAACGTCTGAACAGCTCGGAG-GATGCAACCGA-TATTGCAATGCAAAACGTCACCCATGCTAGATAACCGTGCCTGCACAACTACTTGTAAGCCGCGAGGCCTAGAACACAGTTGCAGAACCTGGG-TATCGTGCCTGTGGTCTGATGCAGA-TATGTGTCACCACTCAAGACCCCGCCAACACGCCGCTTCGAGGCCCTGAACAGTACAAAGGGCGCTTCAAATTCGTACAAGCCCCCCCGAGGCCGTTTTCAAGTCTTTGTATGAC-CATCTATTTTCCGATTGACGTCCCTCACGGATTCTCTTTCGTTGCTGACCTCCTTGTGACCACAAACATCGCCAACAACAGAC
[0128] SEQ ID No.41:
[0129] CCGAGTGTACTCCGTAAGGAGGGTTGGTCTCATGCCTCTTGGCGGGAGCCGCCCGA-TAACGA-TAACCGTGAGTTGTAACTCCGTATCCGGTTACGGAAACGGAAAGGCCCGCTCGGCTGTTCTCCGGCGGCTCCCCGATCGCTGATCAGAGCATGGAACAGATGTCAATTACATCAC-TCCCGCGTAAACGAACCATAGTTATCGAACCACAGTTATCGAACCACAGAGCCAGCCCATGGGAACGTCTGAACAGCTCGGAGGATGCAACCGATATTGCAATGCAAAAC-GTCACCCATGCTACAATTAATTCCCTGCACAACTACTTGTAAGCCGCGAGGCCTAGAACACAGTTGCAGAACCTGGGTATCGTGCCTGTGGTCTGATGCAGATATGTGTCACCAC-TCAA-GACCCCGCCAACACGCCGCTTCGAGGCCCTGAACAGTACAAAGGGCGCTTCAAATTCGTACAAGCCCCCCCGAGGCCGTTTTCAAGTCTTTGTATGAC-CATCTATTTTCCGATTGAC-GTCCCTCACGGATTCTCTTTCGTTGCTGACCTCCTTGTGACCACAAACATCGCCAACAACAGAC
[0130] SEQ ID No.42:
[0131] CCGAGTGTACTCCGTAAGGAGGGTTGGTCTCATGCCTCTTGGCGG-GAGCCGCCCGA-TAACTAGTATAACTAGTTGTAACTCCGTATCCGGTTACGGAAACGGAAAGGCCCGCTCGGCTGTTCTCCGGCGGCTCCCCGATCGCTGATCAGAG-CATGGAACAGATGTCAATTACATCACTCCCGCGTAAACGAACCATAGTTATCGAACCACAGTTATCGAACCACAGAGCCAGCCCATGGGAACGTCTGAACAGCTCGGAG-GATGCAACCGA-TATTGCAATGCAAAACGTCACCCATGCTACAATTAATTCCCTGCACAACTACTTGTAAGCCGCGAGGCCTAGAACACAGTTGCAGAACCTGGG-TATCGTGCCTGTGGTCTGATGCAGA-TATGTGTCACCACTCAAGACCCCGCCAACACGCCGCTTCGAGGCCCTGAACAGTACAAAGGGCGCTTCAAATTCGTACAAGCCCCCCCGAGGCCGTTTTCAAGTCTTTGTATGAC-CATCTATTTTCCGATTGACGTCCCTCACGGATTCTCTTTCGTTGCTGACCTCCTTGGATAACCGTGCATCGCCAACAACAGAC
[0132] The present invention further relates to nucleic acid molecules or vectors comprising the promoter variants according to the present invention.
[0133] The nucleic acid molecules of the present invention can be operably linked to a nucleic acid sequence encoding a polypeptide or protein. These nucleic acid molecules or promoter variants of the present invention can be part of a vector, including plasmids, cosmids or yeast artificial chromosomes (YACs) and modified viruses or virus particles.
[0134] These nucleic acid molecules, particularly these vectors, may contain other elements required for the expression or replication of the protein in a host cell. Such elements are well known to those skilled in the art.
[0135] According to a particularly preferred embodiment of the present invention, the promoter variant of the present invention is operably linked to a nucleic acid sequence encoding a polypeptide or protein.
[0136] The present invention also relates to host cells comprising the nucleic acid molecules or promoter variants according to the present invention.
[0137] The nucleic acid molecule and / or promoter of the present invention can be incorporated into a host cell. The host cell can serve as a vector for the nucleic acid and / or promoter or can have functional activity therein. If the nucleic acid molecule and / or promoter of the present invention has functional activity, the host cell can be used to express a protein or polypeptide of interest under the control of the promoter of the present invention.
[0138] According to a particularly preferred embodiment of the present invention, the host cell is a fungal cell preferably from the Ascomycota phylum, more preferably from the genus Komagataella or Myceliophthora, even more preferably Komagataella phaffii or Myceliophthora thermophila cells, and even more preferably Myceliophthora thermophila C1.
[0139] The present invention also relates to a method for producing a polypeptide or protein of interest, which comprises the step of culturing a host cell according to the present invention. Methods for culturing cells and for activating the promoter variants of the present invention for overexpressing proteins and polypeptides are well known to those skilled in the art and depend on the modified promoter.
[0140] The present invention is further illustrated by the following examples, but the present invention is not limited thereto.
[0141] Example
[0142] In Examples 1 to 4, two promoters, namely the catalase promoter PCTA1 (SEQ ID No. 3) of Komagataella phaffii and the heat shock protein 12 promoter PDH (SEQ ID No. 4), were modified using the method of the present invention to identify promoter variants that showed a higher expression rate or product titer than the wild-type promoter (“original promoter”).
[0143] The promoter sequences have been modified by insertion, substitution, or deletion. The respective types and positions of the modifications are indicated.
[0144] Example 1: Effect of a single mutation on expression under derepressed conditions
[0145] Promoter PCTA1
[0146] Two different 10-bp long “neutral” sequences (designated A (5’-ATCCTTTTAG-3’; SEQ ID No. 1) and B (5’-GATAACCGTG-3’; SEQ ID No. 2)) were used to systematically scan the entire promoter sequence. A total of 100 so-called “scanning variants”, named 1A / B to 50A / B, were generated by systematically swapping every ten base pairs for these two A and B sequences, numbered starting from the 5′ end of the promoter.
[0147] To assess the promoter strength of the scanning variants, the promoter and promoter variants were operably linked to a nucleic acid sequence encoding enhanced green fluorescent protein (eGFP) (GenBank accession number ADL66923) (Vogl et al. ACS Synth. Biol. 5 (2016): 172-186). After carbon source depletion (indicated as derepression) or methanol induction (indicated as induction), promoter activity was determined as relative fluorescence units (RFU) normalized to cell density (OD 600 ) at different time points in the culture. The RFU was then set relative to the corresponding value of the original (i.e., unmodified) promoter sequence. Cultures were performed at the microscale using 96-well culture plates. For transformation, electrocompetent CBS7435Δku70 cells were transformed with 1 μg of small linearized DNA, and after initial selection on YPD Zeo , microcultures were inoculated with single colonies.
[0148] Cultures of yeast cells harboring the promoter PCTA1 and its (scanning) variants were performed following Weis et al. (FEMS Yeast Res 5 (2004): 179-89) using 1% glucose as the carbon source in buffered minimal medium at 28 °C, 320 rpm for 60 h, followed by methanol induction to 0.5% MeOH for 38 h.
[0149] Cultures of yeast cells harboring the promoter PDH and its (scanning) variants were performed using 1% glycerol as the carbon source in buffered minimal medium at 28 °C, 320 rpm for 48 h, followed by a glycerol pulse to 0.25% for 96 h.
[0150] In the table below, the derepression and induction activities of the variants are given as RFU normalized to OD 600 relative to the RFU obtained by using the original promoter sequence.
[0151] Table 1: The original promoter sequence is SEQ ID No. 3 [PCTA1]
[0152]
[0153] SEQ ID No.25:
[0154] TAATCGAACTCCGAATGCGGTTCTCCTGTAACCTTAATTGTAGCATAGATCACTTAAA-TAAACTCATGGCCTGACATCTGTACACGTTCTTATTGGTCTTTTAGCAATCTTGAAGTCTTTCTATTGTTCCGGTCGGCATTACCTAATAAATTCGAATCGAGATTGCTAGTAC-CTGA-TATCATATGAAGTAATCATCACATGCAAGTTCCATGATACCCTCTACTAATGGAATTGAACAAAGTTTAAGCTTCTCGCACGAGACCGAATCCATACTATGCACCCCTCAAAGTT-GG-GATTAGTCAGGAAAGCTGAGCAATTAACTTCCCTCGATTGGCCTGGACTTTTCGCTTAGCCTGCCGCAATCGGTAAGTTTCATTATCCCAGCGGGGTGATAGCCTCTGATAAC-CGTGAGGCCAAAATCATATATAAGCTGTAGACCCAGCACTTCAATTACTTGAAATTCACCATAACACTTGCTCTAGTCAAGACTTACAATTAAA
[0155] Table 1 clearly shows that the substituted variants according to the invention have a higher promoter activity than the original Pichia farinosa PCTA1 promoter. It can also be recognized from the measurements that the modifications within the preferred regions according to the invention result in an even higher promoter activity than those outside these regions. The changes under derepression conditions are higher than those under induction conditions. In addition to these substituted variants, the PCTA1 promoter was also modified by deleting putative TFBS. For these variants, the changes in activity are not as obvious as those of the "scanning variants" because most of them show fluorescence levels within 20% of the parental promoter. Under derepression and induction conditions, compared with the parental PCTA1, only three variants reached higher values of about 140% to 180% respectively. The following variants can be used in combination methods together with the "scanning variants": #1, #4 and #53* (see Table 2).
[0156] Table 2: Deletion variants of PCTA1 (SEQ ID No. 3)
[0157]
[0158] 53* contains an additional randomly introduced A to T exchange at position 408.
[0159] SEQ ID No.26:
[0160] TGCGGTTCTCCTGTAACCTTAATTGTAGCATAGATCACTTAAA-TAAACTCATGGCCTGACATCTGTACACGTTCTTATTGGTCTTTTAGCAATCTTGAAGTCTTTCTATTGTTCCGGTCGGCATTACCTAATAAATTCGAATCGAGATTGCTAGTAC-CTGA-TATCATATGAAGTAATCATCACATGCAAGTTCCATGATACCCTCTACTAATGGAATTGAACAAAGTTTAAGCTTCTCGCACGAGACCGAATCCATACTATGCACCCCTCAAAGTT-GG-GATTAGTCAGGAAAGCTGAGCAATTAACTTCCCTCGATTGGCCTGGACTTTTCGCTTAGCCTGCCGCAATCGGTAAGTTTCATTATCCCAGCGGGGTGATAGCCTCTGTT-GCTCATCAGGCCAAAATCATATATAAGCTGTAGACCCAGCACTTCAATTACTTGAAATTCACCATAACACTTGCTCTAGTCAAGACTTACAATTAAA
[0161] SEQ ID No.27:
[0162] TAATCGAACTCCGAATGCGGTTCTCCTTAGCATAGATCACTTAAA-TAAACTCATGGCCTGACATCTGTACACGTTCTTATTGGTCTTTTAGCAATCTTGAAGTCTTTCTATTGTTCCGGTCGGCATTACCTAATAAATTCGAATCGAGATTGCTAGTAC-CTGA-TATCATATGAAGTAATCATCACATGCAAGTTCCATGATACCCTCTACTAATGGAATTGAACAAAGTTTAAGCTTCTCGCACGAGACCGAATCCATACTATGCACCCCTCAAAGTT-GG-GATTAGTCAGGAAAGCTGAGCAATTAACTTCCCTCGATTGGCCTGGACTTTTCGCTTAGCCTGCCGCAATCGGTAAGTTTCATTATCCCAGCGGGGTGATAGCCTCTGTT-GCTCATCAGGCCAAAATCATATATAAGCTGTAGACCCAGCACTTCAATTACTTGAAATTCACCATAACACTTGCTCTAGTCAAGACTTACAATTAAA
[0163] SEQ ID No.28:
[0164] TAATCGAACTCCGAATGCGGTTCTCCTGTAACCTTAATTGTAGCATAGATCACTTAAA-TAAACTCATGGCCTGACATCTGTACACGTTCTTATTGGTCTTTTAGCAATCTTGAAGTCTTTCTATTGTTCCGGTCGGCATTACCTAATAAATTCGAATCGAGATTGCTAGTAC-CTGA-TATCATATGAAGTAATCATCACATGCAAGTTCCATGATACCCTCTACTAATGGAATTGAACAAAGTTTAAGCTTCTCGCACGAGACCGAATCCATACTATGCACCCCTCAAAGTT-GG-GATTAGTCAGGAAAGCTGAGCAATTAACTTCCCTCGATTGGCCTGGACTTTTCGCTTAGCCTGCCGCAATCGGTAAGTTTCATTATCCCAGCGGGGTGATAGCCTCTGTT-GCTCTTCAGGCCAAAATCATATATAAGCTGTAGACCCAGCACTTAACACTTGCTCTAGTCAAGACTTACAATTAAA
[0165] SEQ ID No.29:
[0166] TAATCGAACTCCGAATGCGGTTCTCCTGTAACCTTAATTGTAGCATAGATCACTTAAA-TAAACTCATGGCCTGACATCTGTACACGTTTAGCAATCTTGAAGTCTTTCTATTGTTCCGGTCGGTTACCTAATAAATTCGAATCGAGTTGCTAGTACCTGTATCAT-ATGAAGTAATCATCACATGCAAGTTCCATGATACCCTCTACTAATGGAATTGAACAAAGTTTAAGCTTCTCGCACGAGACCGAATCCATACTATGCACCCCTCAAAGTTGG-GATTAG-TCAGGAAAGCTGAGCAATTAACTTCCCTCGATTGGCCTGGACTTTTCGCTTAGCCTGCCGCAATCGGTAAGTTTCATTATCCCAGCGGGGTGATAGCCTCTGTT-GCTCATCAGGCCAAAATCATATATAAGCTGTAGACCCAGCACTTCAATTACTTGAAATTCACCATAACACTTGCTCTAGTCAAGACTTACAATTAAA
[0167] The results obtained by screening for replacement variants using the HSP12 promoter PDH are shown in Table 3.
[0168] Table 3: The original promoter sequence is SEQ IDNo. 4 [PDH]
[0169]
[0170]
[0171] SEQ ID No.30:
[0172] CTTCAGTAAGAGAAGGAAGCTTGGTGACGATCACAGCTATGATAACCGTGAAATT-GCTAA-GCAATTGTGAGGTGTGATGTATTTTGCAGAGCAATTGTGCGGTACAACGGGGTGTTATTGTCTTCACAAGGCATTTATTGCGAATTTCGTAGTTGAAAGAATATTTTAG-CACAGGGTGCTTGACCCCTATTGTTGCTCGCTAAACCATGATTGCTAAATGATGACATAGCAATCACTTTACTAAGATTGCTATAAGGACACCTTTCTTAGTATAAATGGACAC-TCTTTTCCCCTGCTAAACTTCTTTTATTTTTCACACTTAAACAGTTACAAAACACAAACACAACTAGAA
[0173] SEQ ID No.31:
[0174] CTTCAGTAAGAGAAGGAAGCTTGGTGACGATCACAGCTATGATGTAATAGAAATT-GCTAA-GCAATTGTGAGGTGTGATGTATTTTGCAGAGCAATTGTGCGGTACAACGGGGTGTTATTGTCTTCACAAGGCATTTATTGCGAATTTCGTAGTTGAAAGAATATTTTAGCACAGGG-TAAATGACCCCTATTGTTGCTCGCTAAACCATGATTGCTAAATGATGACATAGCAATCACTTTACTAAGATTGCTATAAGGACACCTTTCTTAGTATAAATGGACAC-TCTTTTCCCCTGCTAAACTTCTTTTATTTTTCACACTTAAACAGTTACAAAACACAAACACAACTAGAA
[0175] As can be seen from Table 3, the single mutant variant according to the present invention using SED ID No.4 [PDH] also results in higher promoter activity than the original promoter sequence. In addition, higher activity can be obtained when mutations are made within the preferred region.
[0176] Example 2: Effect of multiple mutations on expression under derepressed conditions
[0177] Multiple mutant variants are generated as described above. Cultivation using the catalase promoter SEQ ID No. 3 [PCTA1] is carried out at 28 °C, 320 rpm for 60 hours with 1% glucose as the carbon source for double and triple mutant variants, and at 28 °C, 320 rpm for 60 hours with 0.5% glucose as the carbon source for quadruple and sextuple mutant variants.
[0178] Cultivation using the heat shock protein promoter SEQ ID No. 4 [PDH] is carried out at 28 °C, 320 rpm for 48 hours with 1% glycerol as the carbon source, followed by a glycerol pulse to 0.25% for 94 hours.
[0179] By normalizing to OD relative to the original promoter sequence 600 The activities of the variants given by RFU are shown in the table below.
[0180] Table 4: The original promoter sequence is SEQ IDNo. 3 [PCTA1]
[0181]
[0182]
[0183] SEQ ID No. 32:
[0184] TAATCGAACTCCGAATGCGGTTCTCCTGTAACCTTAATTGTAGCATAGATCACTTAAA-TAAACTCATGGCCTGACATCTGTACACGTTCTTATTGGTCTTTTAGCAATCTTGAAGTCTTTCTATTGTTCCGGTCGGCATTACCTAATAAATTCGAATCGAGATTGCTAGTAC-CTGA-TATCATATGAAGTAATCATCACATGCAAGTTCCATGATACCCTCTACTAATGGAATTGAACAAAGTTTAAGCTTCTCGCACGAGACCGAATCCATACTATGCACCCCTCAAAGTT-GG-GATTAGTCAGGAAAGCTGAGCAATTAACTTCCCTCGATTGGCCTGGACTTTTCGCTTAGCCTGCCGCAATCGGTAAGGATAACCGTGCCAGCGGGGTGATAGCCTCTGATAAC-CGTGAGGCCAAAATCATATATAAGCTGTAGACCCAGCACTTCAATTACTTGAAATTCACCATAAGATAACCGTGAGTCAAGACTTACAATTAAA
[0185] Table 4 shows that multiple mutant variants have higher promoter activity than the original promoter. Generally, multiple mutations result in higher expression than single mutations. For single mutant variants, the change in eGFP expression is greater under derepressed conditions.
[0186] Table 5: The original promoter sequence is SEQ ID No. 4 [PDH]
[0187]
[0188]
[0189] It can be inferred from Table 5 that the multiple mutations according to the present invention result in higher expression / promoter activity than the original promoter. Multiple mutations further increase the activity compared to single mutations. In particular, under derepressed conditions, changes in expression activity can be observed. Even higher expression activity can be achieved when the promoter sequence is modified multiple times at particularly preferred positions.
[0190] Further experiments were performed using lipase (CalB), human growth hormone (HGH), or peroxidase from Candida antarctica as secreted model proteins to analyze the expression activity. The results were consistent with those of the experiments with eGFP, and thus similar expression activities were found for those proteins.
[0191] Example 3: Scaling up promoter variants with the secreted model protein CalB
[0192] The performance of the two promoter variants of Example 2 was evaluated in shake flask cultures at a medium scale. The promoter variants tested had SEQ ID No.12 [1A, 14B, 26B] and SEQ ID No.11 [14B, 26B, 48B]. Hereinafter, SEQ ID No.12 [1A, 14B, 26B] is named #19, and SEQ ID No.11 [14B, 26B, 48B] is named #26. As a control, the parental Pichia pastoris catalase promoter and a negative control were included. For each promoter representative, an average performing strain was selected.
[0193] Cultivation was carried out in two ways, once induced with 0.5% BMD and methanol, and once with 0.5% BMG and glycerol-fed trays to establish a derepressed state. Cultivation was performed in biological replicates and samples were taken after 4 h, 17 h, 24 h, 42 h, and 65 h. The process was monitored online using the SFR vario system (PreSens Precision Sensing GmbH, Regensburg, Germany) such that methanol induction and addition of the fed trays could be carried out when the initial carbon source was consumed after 20 h. For each time point, enzyme activity was set relative to the corresponding value of the parental promoter.
[0194] Before lipase activity could be measured, only the supernatants at the sampling points at 24 h and later showed lipase activity.
[0195] The results of the activity measurements are listed in the table below. The volume units were normalized to wild type and plotted according to the variants.
[0196] Time [h] NA derepressed #19 NA derepressed #26 NA induced #19 NA induced #26 24 1.40 1.05 4.45 3.00 42 2.10 1.45 2.50 1.60 65 2.90 1.70 2.30 1.50
[0197] As can be seen from the above table, under both cultivation conditions, the two variants showed even better performance in medium-scale cultivation than in micro-scale cultivation.
[0198] Example 4: Determination of the expression level of multiple mutant variants using qPCR
[0199] The expression level of mutant variant #19 from Example 3 was further characterized using qPCR (Abad S et al. Biotechnol J 5 (2010): 413 - 20). For this purpose, cell material was harvested at different time points (16 h, 20 h, 22 h, 44 h, 46 h, and 68 h) in shake-flask cultures, lipase activity was measured and RNA was isolated and used for qPCR. By using the comparative ΔΔCT method, the relative changes in gene expression of the analyzed Pichia pastoris reporter strain were calculated. The results were expressed as fold changes in gene expression normalized to an internal reference gene (housekeeping gene) and relative to an untreated control (calibrator). ACT1 was used as the housekeeping gene to normalize the input amount of target RNA, and variant #19 was used as the calibrator after 16 h.
[0200] Figure 1 The fold changes in lipase activity (A) and target gene (CalB) (B) of variant #19, the original promoter, and the reference promoter PDF with two different cultivation strategies, namely MeOH induction and derepression via glycerol-fed beads, are shown (Vogl et al. MB Expr 10 (2020): 38) (HpFMD promoter fragment).
[0201] Lipase activity measurements (11A) confirmed the performance of variant #19 observed previously. Under methanol-induced conditions, variant #19 showed higher activity than the native promoter and the PDF promoter. For extended derepression using glycerol feed beads, variant #19 and PDF performed equally well.
[0202] Under derepression conditions using glycerol, variant #19 showed slightly higher amounts of RNA compared to PDF. Variant #19 showed the overall highest fold change after 68 hours, meaning that even higher CalB activity might be achieved in further experiments than that measured after 68 hours.
[0203] Example 5: Promoter engineering using Myceliophthora thermophila ATCC42464
[0204] Filamentous fungi can be used as industrial protein production hosts for the production of heterologous and homologous proteins. Myceliophthora thermophila is a thermophilic fungus that is commonly used for the production of thermostable enzymes. The high secretion rate of proteins makes it an interesting expression host for biotechnological applications.
[0205] Efficient protein expression depends on several factors, such as regulatory sequences, such as promoters, which have a great impact on the expression level. Therefore, promoter engineering can be an effective tool to positively influence gene expression levels and increase protein titers. For Myceliophthora thermophila, there are various published constitutive promoters and promoters of pyruvate decarboxylase-like genes, P PDC (MYCTH_112121; Gene ID: 11511210) was selected as the target for promoter engineering to identify potential regulatory regions and generate optimized promoter variants.
[0206] Materials and methods
[0207] Cloning
[0208] Twenty-nine different promoter variants were synthesized and cloned into a vector of Myceliophthora thermophila. The HspUPO gene from Hypoxylon sp. EC38 was used as a reporter gene (UPO: non-specific peroxygenase). The plasmid consisted of the codon-optimized HspUPO gene with a signal peptide for promoting secretion fused to the N-terminus, namely the signal peptide of MYCTH_66729. All plasmids had an ampicillin resistance gene (bla) for selection in Escherichia coli and a hygromycin resistance gene (hph) for selection in Myceliophthora thermophila. The expression of the ampicillin resistance gene was driven by the promoter P_EM72, and the hph gene was under the control of the elongation factor 1-α promoter derived from the Myceliophthora thermophila genome. The HspUPO gene was under the control of different constitutive PDC promoter variants. The terminator of PDC was used as the terminator of the HspUPO gene. The cellobiose hydrate II terminator (MYCTH_51545) was used as the terminator of the hph gene. The plasmids were linearized and used for the transformation of the Myceliophthora thermophila ATCC42464 wild-type strain.
[0209] Protoplast-mediated transformation protocol
[0210] This protocol was adapted from Gruber et al. (Current Genetics, Springer Verlag 71 - 76 (1990)). 10 8 Ten spores were used to inoculate into 50 mL of potato dextrose medium and cultured at 50 °C, shaken at 110 rpm overnight to obtain mycelia. The next day, the method was filtered through a miracloth layer and the mycelia were washed with cold solution A. For 1 g of mycelia, 0.5 g of lyticase was added to 10 mL of solution A, the lyticase solution was dissolved and filter-sterilized. The lyticase solution was added to the mycelia in a Petri dish, mixed well and incubated at 37 °C for 1 hour to 5 hours. After 90 minutes to 5 hours, the efficiency of protoplast formation was examined under a microscope. When there were sufficient protoplasts, the suspension was aspirated using a cut tip to remove large mycelial fragments. The protoplasts were filtered through a miracloth layer on ice into a 50 mL tube and rinsed with cold solution A. After centrifugation at 600 g for 10 minutes in a swing-out rotor at 4 °C, the supernatant was carefully decanted and the precipitated protoplasts were resuspended in 4 mL of cold solution B. The protoplasts were centrifuged again, the supernatant was decanted and the protoplasts were resuspended in 600 μL of solution B.
[0211] For transformation, the following components were combined in a 15 mL tube:
[0212] ● 10 μL of purified DNA fragment (must be linearized), using approximately 1 μg - 10 μg of DNA
[0213] ● 200 μL protoplast suspension
[0214] ● 50 μL PEG
[0215] Mix it gently by tapping the tube and incubate on ice for 20 minutes. Then add 2 mL of PEG and incubate again at room temperature for 5 minutes. Add 4 mL of Solution B. Add 2 mL of the solution to 10 mL of pre-warmed overlay medium, mix simply by pipetting up and down and pour onto the bottom medium plate (145 mm); three plates are required for one transformation (3 times, 2 mL of the solution combined with 10 mL of overlay medium). Incubate the plates at 37 °C for 4 to 5 days. Count the transformants and transfer them to small selection plates and let them grow for 3 to 5 days until spores are formed at 37 °C.
[0216] Single spore isolation
[0217] Pick a few spores from the transformants from the plate with a drop of spore solution and spread them on a MEX-Triton agar plate to obtain colonies from single spores. Incubate the plate at 37 °C for 2 days. Then cut out the single colonies and transfer them to new small selection plates and grow again for 3 to 5 days until spores are formed. Repeat these steps three times and then start further analysis.
[0218] For 23 transformants of each variant, three rounds of single spore isolation were performed, and the variants with the highest activity during the first cultivation (1, 3, 7, 15, 29, 31, 37, 47, 55, 57 and the PDC original sequence) were cultured and the UPO activity was determined.
[0219] Cultivation in 24-well plates
[0220] For cultivation in a sterile 24-well plate, inoculate 10 6 spores per well with 2.5 mL of medium. The cultivation is carried out at 40 °C, 110 rpm for about 75 hours. At the end of the cultivation, take the supernatant and store it at -20 °C. For each variant, about 23 transformants were analyzed.
[0221] Determination of UPO activity - ABTS assay
[0222] All activity assays were performed in 96-well clear crystal bottom microtiter plates, and the supernatant had been spotted on the plates. The assay solution was always freshly prepared in 50 mL Falcon tubes and kept on ice. Use a Picus electronic 8-channel 50 μL - 1200 μL pipette to add H 2 O 2For the initial reaction. After applying the reaction mixture, the plates were immediately measured at room temperature. Before the initial measurement, all plate wells were oscillated for 30 seconds. The slope of the linear increase was used to calculate the initial rate of activity in milli-absorbance units / mL (mAU / mL), V. mean At least 6 data points within the linear range of the reaction were used to calculate the initial rate of activity (slope, mAU / min).
[0223] The ABTS (2,2'-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid)) assay solution for approximately 96 reactions was freshly prepared as follows: Sodium acetate buffer (50 mM, pH 4.5) containing 1 mL of 20× ABTS stock solution (16 mM), 19 mL of sodium citrate buffer (0.2 M, pH = 4.5), 6 μL of H 2 O 2 (3% w / w). Then, 140 μL of the ABTS solution was added to 15 μL of the culture supernatant. Absorbance was measured at 405 nm for 10 minutes.
[0224] Medium
[0225] Solution A
[0226] 0.1 M KH 2 PO 4 and 1.2 M sorbitol
[0227] Dissolve 1.261 g of KH 2 PO 4 and 21.864 g of sorbitol in 100 mL of dH 2 O; adjust to pH 5.6 (diluted KOH); autoclave and store at room temperature.
[0228] Solution B
[0229] 50 mM CaCl 2 ·2H 2 O, 1 M sorbitol, 10 mM Tris HCl pH 7.5
[0230] Dissolve 0.735 g of CaCl 2 ·2H 2 O and 18.22 g of sorbitol in 99 mL of dH 2 O; add 1 mL of 1 M TrisHCl pH 7.5; adjust to pH 7.5. (HCl); autoclave and store at room temperature.
[0231] PEG
[0232] 25% PEG, 50 mM CaCl 2 ·2H 2 O, 10 mM Tris HCl pH 7.5
[0233] Dissolve 12.5 g of PEG and 0.368 g of CaCl 2 ·2H 2 O in 40 mL of dH 2 O, and add 500 μL of 1 M TrisHCl pH 7.5; fill up to 50 mL with dH 2 O; autoclave and store at room temperature.
[0234] Bottom medium
[0235] 3% malt extract (MEX), 2% agar-agar, 1 M sorbitol, hygromycin
[0236] Dissolve 30 g of MEX, 20 g of agar, and 180 g of sorbitol in 1 L of TAP water, autoclave, add the selection reagent after autoclaving, and pour as thinly as possible.
[0237] Overlay medium
[0238] 3% malt extract (MEX), 2% agarose, 1 M sorbitol, hygromycin
[0239] Dissolve 30 g of MEX, 20 g of agarose, and 182.2 g of sorbitol in 1 L of TAP water, autoclave, add the selection reagent after autoclaving, and pour as thinly as possible.
[0240] MEX agar plate
[0241] 3% malt extract (MEX), 2% agar, hygromycin
[0242] Dissolve 30 g of MEX and 20 g of agar in 1 L of TAP water; autoclave, then add the selection reagent and pour.
[0243] MEX-Triton agar plate
[0244] 3% malt extract (MEX), 2% agar, 0.1% Triton X-100, hygromycin
[0245] Dissolve 30 g of MEX, 20 g of agar, and 1 g of Triton X-100 in 1 L of TAP water, autoclave, then add the selection reagent and pour.
[0246] Spore solution
[0247] 0.8% NaCl, 0.05% Tween 80
[0248] Dissolve 0.4 g of NaCl in 50 mL of dH 2 O, add 25 μL of Tween 80, filter sterilize, and store at room temperature.
[0249] Promoter engineering method
[0250] Use the following 10-bp-long sequence 5ˊ-GATAACCGTG-3ˊ to establish a P PDC sequence library. For the entire promoter sequence, first replace bps 1-10 with this sequence to generate variant 1 (V1), then replace bp 21-30 with this sequence to accommodate variant 3 (V3), and so on, generating 29 different promoter variants.
[0251] Use the non-specific cyclase HspUPO from the species EC38 of the genus Hypoxylon as a reporter gene for P PDC variant screening. Use 2,2'-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) as a substrate and measure promoter activity by colorimetric assay. Use the P PDC original sequence as a benchmark and control to discover improved promoter sequences applying the method mentioned.
[0252] A total of two rounds of screening were carried out. In the first screening, five transformants were cultured for each variant, and the supernatant was taken for enzyme activity measurement. Only one round of single spore isolation (SSI) was performed on these transformants.
[0253] In the second screening, approximately 23 transformants were cultured and analyzed for each variant. Three rounds of single spore isolation were performed on these transformants to minimize the possibility of using spore combinations instead of single spores. In the second culture, promoter variants with increased enzyme activity compared to the original P PDC sequence in the first round were screened.
[0254] First screening - SSI1
[0255] Measure the highest enzyme activities of variants 7, 47, 37, and 1, where the expression is up to 2-fold that of the original promoter PDC.
[0256] Second screening - SSI3
[0257] In the second screening, the best 10 variants obtained from the first screening were cultured again and their ABTS activities were determined. After three rounds of single spore isolation, approximately 23 transformants were cultured for each variant. For variant 1, only five transformants were analyzed because only these transformants had the ability to regrow on the selection medium after two rounds of transformation.
[0258] The results of the second culture are shown in Figure 3. The highest enzyme activities of PDC variants 1 (SEQ ID No. 35) and 47 (SEQ ID No. 34) reached a three-fold increase compared to the original PDC sequence (SEQ ID No. 33). Variants 3 (SEQ ID No. 36) and 15 (SEQ ID No. 37) showed a two-fold increase, and the activities of variants 31 (SEQ ID No. 40), 37 (SEQ ID No. 39), and 29 (SEQ ID No. 38), as well as variants 7 (SEQ ID No. 41) and 57 (SEQ ID No. 42), increased compared to the original sequence.
[0259] The results indicate that some sequence variants containing the sequence 5ˊGATAACCGTG 3 of P PDC seem to have a positive effect on promoter activity. These new sequence variants showed activity as high as or even two to three times that of the original PDC sequence.
Claims
1. A method for modifying a promoter to obtain a promoter variant, the method comprising the following steps: a. Providing a promoter, b. Modifying the promoter by the following process: - Insert at least one nucleic acid sequence selected from the group consisting of GATAX 1 X 2 X 3 X 4 X 5 X 6 (X 7 ) m , ATCCTTTTAG (SEQ ID No.1) and AAA into the promoter, and / or - replacing the nucleotides of the promoter sequence to introduce at least one nucleic acid sequence selected from the group consisting of GATAX 1 X 2 X 3 X 4 X 5 X 6 (X 7 ) m , ATCCTTTTAG (SEQ ID No. 1) and AAA into the promoter wherein X 1 , X 2 , X 3 , X 4 , X 5 , X 6 and X 7 are independently nucleotides selected from the group consisting of A, C, G, and T, and wherein m is an integer between 0 and 10.
2. The method according to claim 1, wherein X 1 is A, X 2 is C, X 3 is C, X 4 is G, X 5 is T and X 6 is G.
3. The method according to claim 1 or 2, wherein the at least one nucleic acid sequence consists of GATAACCGTG (SEQ ID No. 2).
4. The method according to any one of claims 1 to 3, wherein the promoter is a eukaryotic promoter, preferably a fungal promoter, more preferably a yeast promoter, and even more preferably a methylotrophic yeast promoter.
5. The method according to any one of claims 1 to 4, wherein the promoter comprises or consists of a nucleic acid sequence having at least 80% identity, preferably at least 90% identity, more preferably at least 95% identity with SEQ ID No. 3, SEQ ID No. 4 or SEQ ID No.
33.
6. The method according to claim 5, wherein the promoter comprising or consisting of a nucleic acid sequence having at least 80% identity with SEQ ID No. 3 is modified within at least one promoter region selected from the group consisting of positions 1 to 20, positions 131 to 150, positions 251 to 270, positions 371 to 390, positions 401 to 410 and positions 461 to 480 of SEQ ID No.
3.
7. The method according to claim 5 or 6, wherein the promoter comprising or consisting of a nucleic acid sequence having at least 80% identity to SEQ ID No. 3 is modified within at least one promoter region selected from the group consisting of positions 1 to 10, positions 131 to 140, positions 251 to 260, positions 371 to 380, positions 401 to 410, and positions 471 to 480 of SEQ ID No. 3, wherein positions 1 to 10 of SEQ ID No. 3 are preferably modified with ATCCTTTTAG (SEQ ID No. 1), and positions 131 to 140, 251 to 260, 371 to 380, 401 to 410, and 471 to 480 of SEQ ID No. 3 are preferably modified with GATAX 1 X 2 X 3 X 4 X 5 X 6 (X 7 ) m modified.
8. The method according to any one of claims 5 to 7, wherein the promoter comprising or consisting of a nucleic acid sequence having at least 80% identity with SEQ ID No. 3 is modified at the following positions: positions 1 to 10, 131 to 140 and 251 to 260 of SEQ ID No. 3; or 131 to 140, 251 to 260 and 401 to 410; or 131 to 140, 251 to 260 and 471 to 480; or 1 to 10, 131 to 140, 251 to 260 and 371 to 380; or 1 to 10, 131 to 140, 251 to 260 and 471 to 480; or 1 to 10, 131 to 140, 251 to 260, 371 to 380, 401 to 410 and 471 to 480, preferably positions 1 to 10, 131 to 140 and 251 to 260 or 1 to 10, 131 to 140, 251 to 260, 371 to 380, 401 to 410 and 471 to 480 of SEQ ID No.
3.
9. The method according to any one of claims 5 to 8, wherein one or more, preferably all, of the nucleotides within positions 89 to 101, 137, 138, 162, 176 and / or 448 to 468 of the promoter comprising or consisting of a nucleic acid sequence having at least 80% identity with SEQ ID No. 3 are deleted.
10. The method according to claim 5, wherein the promoter comprising or consisting of a nucleic acid sequence having at least 80% identity to SEQ ID No. 4 is modified within at least one promoter region selected from the group consisting of positions 1 to 20, positions 151 to 170, preferably positions 161 to 170 and positions 171 to 190, preferably positions 171 to 180.
11. The method according to claim 5 or 10, wherein the promoter comprising or consisting of a nucleic acid sequence having at least 80% identity to SEQ ID No. 4 is modified at positions 161 to 170 and 171 to 180; or at positions 11 to 20, 161 to 170 and 171 to 180.
12. The method according to claim 5, 10 or 11, wherein the promoter comprising or consisting of a nucleic acid sequence having at least 80% identity to SEQ ID No. 4 is modified with the nucleic acid AAA within at least one promoter region selected from the group consisting of positions 37 to 39, positions 103 to 105, positions 109 to 111, positions 178 to 180, positions 235 to 237 and positions 349 to 351 of SEQ ID No.
4.
13. The method according to claim 5, wherein the promoter comprising or consisting of a nucleic acid sequence having at least 80% identity to SEQ ID No. 33 is modified within at least one promoter region selected from the group consisting of positions 1 to 10, positions 21 to 30, positions 141 to 150, positions 461 to 470, positions 61 to 70, positions 281 to 290, positions 361 to 370, positions 301 to 310 and positions 561 to 570 of SEQ ID No. 33, preferably within positions 1 to 10 and / or positions 461 to 470 of SEQ ID No.
33.
14. The method according to claim 13, wherein said promoter comprising or consisting of a nucleic acid sequence having at least 80% identity to SEQ ID No. 33 is modified with GATAX 1 X 2 X 3 X 4 X 5 X 6 (X 7 ) m modified.
15. A promoter variant obtainable by the method according to any one of claims 1 to 14.
16. The promoter variant according to claim 15, wherein the promoter variant comprises a nucleic acid sequence selected from the group consisting of SEQ ID No.5, SEQ ID No.6, SEQ ID No.7, SEQ ID No.8, SEQ ID No.9, SEQ ID No.10, SEQ ID No.11, SEQ ID No.12, SEQ ID No.13, SEQ ID No.14, SEQ ID No.15, SEQ ID No.16, SEQ ID No.17, SEQ ID No.18, SEQ ID No.19, SEQ ID No.20, SEQ ID No.21, SEQ ID No.22, SEQ ID No.23, SEQ ID No.24, SEQ ID No.34, SEQ ID No.35, SEQ ID No.36, SEQ ID No.37, SEQ ID No.38, SEQ ID No.39, SEQ ID No.40, SEQ ID No.41 and SEQ ID No.42 or consists of the same.
17. A nucleic acid molecule or vector, comprising the promoter variant according to claim 15 or 16.
18. The nucleic acid molecule or vector according to claim 17, wherein the promoter variant is operably linked to a nucleic acid sequence encoding a polypeptide or protein.
19. A host cell, comprising the nucleic acid molecule or promoter variant according to any one of claims 15 to 18.
20. The host cell according to claim 19, wherein the host cell is preferably a fungal cell from the phylum Ascomycota, more preferably from the genus Komagataella or Myceliophthora, and even more preferably Komagataella phaffii or Myceliophthora thermophila cell.
21. A method for producing a polypeptide or protein, comprising culturing the host cell according to claim 19 or 20.