Monoclonal antibody targeting rift valley fever virus Gn protein and application thereof in virus detection

Abstract

The invention discloses monoclonal antibodies C8 and A4 targeting rift valley fever virus Gn protein and application of the monoclonal antibodies C8 and A4 in virus detection. The monoclonal antibodies C8 and A4 are used for constructing double-antibody sandwich ELISA detection, the rift valley fever virus Gn antigen can be specifically detected, the monoclonal antibodies have no cross reaction with other bunyavirus viruses such as severe fever with thrombocytopenia syndrome virus Gn antigens, the sequences of the monoclonal antibodies are clear, the used monoclonal antibodies can be cultured and prepared on a large scale, the sensitivity is high, and the detection limit is 781 pg / mL.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to a monoclonal antibody targeting the Gn protein of Rift Valley fever virus and its application in virus detection. Background Art

[0002] Rift Valley fever is a zoonotic mosquito-borne infectious disease. Clinically, Rift Valley fever is manifested as fever, headache and muscle and joint pain. Severe cases can involve multiple organs and have a high fatality rate. Currently, there are no marketed human vaccines and specific therapeutic drugs.

[0003] The pathogen of Rift Valley fever is Rift Valley fever virus (RVFV). The RVFV genome is a single-stranded negative-sense RNA virus, which consists of three segments, namely L, M, and S. The L segment encodes RNA polymerase. The M segment encodes the envelope glycoproteins Gn and Gc. Gn is mainly responsible for the binding of the virus to host cells, while Gc plays a key role in membrane fusion. After the virus enters the body, it first replicates in the invaded local tissues, transfers to local lymph nodes through the lymphatic system for further replication, and then enters the bloodstream to form viremia, which generally lasts for 4-7 days. Subsequently, infection and intoxication symptoms such as fever may appear, and focal infections of multiple organs can be caused.

[0004] Currently, the laboratory diagnostic methods for virus infection mainly include virus isolation, nucleic acid detection, antigen detection, serological detection, etc. Among them, virus isolation is the gold standard for the diagnosis of virus infection, but this method has relatively high requirements for laboratory conditions and requires a long time for cultivation. Although the virus nucleic acid detection method is more sensitive and rapid than the traditional virus isolation and culture method, it has relatively high requirements for equipment and personnel. Serum IgM detection starts to appear 5-6 days after virus infection, and IgG appears 14 days after virus infection, so rapid detection cannot be achieved. It is imperative to establish a simple and easy diagnostic reagent that can specifically detect the early stage of Rift Valley fever virus infection, which is of significance for the rapid detection of suspected infected people.

[0005] The Gn protein of Rift Valley fever virus is a relatively conserved envelope glycoprotein, which is mainly highly expressed in infected cells, has strong antigenicity, and exists in the early peripheral blood of virus-infected patients or animals. Therefore, detecting the Gn antigen in the serum of acute-phase patients can be used for the early diagnosis of Rift Valley fever virus infection.

[0006] The Gn protein of Rift Valley fever virus is encoded by the M gene of Rift Valley fever virus and mediates the receptor recognition process of the virus. The Gn protein is a type I transmembrane protein and is anchored to the membrane surface of the virus particle through a helical structure at the C-terminus. The extracellular region of the Gn protein can be divided into a head region (154-469aa) and a stem region (470-582aa). Research reports show that the neutralizing epitopes of the Gn protein are mainly concentrated in the head region, which consists of three regions, namely domain I, domain II, and domain III. Currently, the main binding regions of known Rift Valley fever virus neutralizing antibodies are domain I and domain III.

[0007] The methods for detecting the virus by antigen capture ELISA can be divided into two categories. One category uses polyclonal antibodies as capture antibodies or detection antibodies. Such methods have significant differences in different batches of antiserum, making it difficult to repeat and achieve laboratory standardization. The other category uses monoclonal antibodies to detect the virus. Currently, there is no commercial kit for detecting Rift Valley fever virus using monoclonal antibodies against Gn.

[0008] The invention application with the publication number CN114409770A discloses a human monoclonal antibody against Rift Valley fever virus and its application, which discloses 8 human monoclonal antibodies that can effectively treat mice infected with RVFV and prevent the infection of mice by RVFV. However, when used for treatment, it is not disclosed that it can be used for ELISA detection. Summary of the Invention

[0009] The present invention provides a kit for detecting Gn antigen of Rift Valley fever virus based on a double antibody sandwich ELISA method. In the kit of the present invention, the monoclonal antibodies C8 and A4 are both immunoglobulins of the human IgG1 subclass, and both monoclonal antibodies can specifically bind to the Gn antigen of Rift Valley fever virus. The monoclonal antibodies are obtained by immunizing rhesus monkeys with an adenovirus vector Rift Valley fever candidate vaccine and recombinant Gn antigen, screening for monoclonal antibody variable region genes with high binding activity from peripheral blood using flow sorting - single cell PCR technology, and obtaining two recombinant monoclonal antibodies C8 and A4 of the human IgG1 subclass through genetic engineering techniques.

[0010] The present invention first provides monoclonal antibodies targeting the Gn protein of Rift Valley fever virus, which are monoclonal antibody C8 and / or monoclonal antibody A4. Among them, the amino acid sequences of the CDR1, CDR2, and CDR3 regions of the heavy chain variable region of monoclonal antibody C8 are shown as the amino acid sequences at positions 26-33, 51-58, and 97-111 of the sequence shown in SEQ ID NO:1; the amino acid sequences of the CDR1, CDR2, and CDR3 regions of the light chain variable region are shown as the amino acid sequences at positions 27-32, 50-52, and 89-97 of the sequence shown in SEQ ID NO:2. The amino acid sequences of CDR1, CDR2 and CDR3 regions of the heavy chain variable region of monoclonal antibody A4 are shown as the amino acid sequences at positions 26-33, 51-58, and 97-101 of the sequence shown in SEQ ID NO:3; the amino acid sequences of CDR1, CDR2 and CDR3 regions of the light chain variable region are shown as the amino acid sequences at positions 27-38, 56-58, and 95-103 of the sequence shown in SEQ ID NO:4.

[0011] Wherein, monoclonal antibody C8 and / or monoclonal antibody A4 represents one or a combination of both of monoclonal antibody C8 and monoclonal antibody A4.

[0012] Preferably, the amino acid sequence of the heavy chain of monoclonal antibody C8 is shown in SEQ ID NO:1, and the amino acid sequence of the light chain is shown in SEQ ID NO:2; The amino acid sequence of the heavy chain of monoclonal antibody A4 is shown in SEQ ID NO:3, and the amino acid sequence of the light chain is shown in SEQ ID NO:4.

[0013] The present invention also provides a gene encoding the monoclonal antibody targeting the Gn protein of Rift Valley fever virus. The gene sequence encoding the heavy chain of monoclonal antibody C8 is shown in SEQ ID NO:5, and the gene sequence encoding the light chain of monoclonal antibody C8 is shown in SEQ ID NO:6; The gene sequence encoding the heavy chain of monoclonal antibody A4 is shown in SEQ ID NO:7, and the gene sequence encoding the light chain of monoclonal antibody A4 is shown in SEQ ID NO:8.

[0014] The present invention also provides the application of the monoclonal antibody targeting the Gn protein of Rift Valley fever virus in the preparation of a detection kit for detecting the Gn antigen of Rift Valley fever virus.

[0015] The present invention also provides a detection kit for detecting the Gn antigen of Rift Valley fever virus, including the monoclonal antibody targeting the Gn protein of Rift Valley fever virus. When the monoclonal antibody is one of monoclonal antibody C8 or monoclonal antibody A4, detection methods such as Western Blotting can be directly used, or it can be additionally combined with a secondary antibody that specifically binds to the constant region of the antibody for detection methods such as ELISA. When the monoclonal antibody is a combination of monoclonal antibody C8 and monoclonal antibody A4, a double-antibody sandwich ELISA detection method can be used.

[0016] Preferably, the detection kit is a double-antibody sandwich ELISA detection kit, wherein the monoclonal antibody is monoclonal antibody C8 and monoclonal antibody A4, one of monoclonal antibody C8 and monoclonal antibody A4 is used as a capture antibody, and the other is used as a detection antibody, and the detection antibody is labeled.

[0017] The capture antibody is used to bind to the antigen to capture the antigen to be detected; the detection antibody is used to detect the antigen after the antigen is captured by the captured antigen, and then the detection antibody binds to the antigen and is used for detection by means such as color development or fluorescence. It can be monoclonal antibody C8 as the capture antibody and monoclonal antibody A4 as the detection antibody, or vice versa, monoclonal antibody C8 as the detection antibody and monoclonal antibody A4 as the capture antibody.

[0018] Preferably, the label for labeling the monoclonal antibody in the detection antibody is peroxidase, phosphatase or luciferase.

[0019] More preferably, the peroxidase is horseradish peroxidase.

[0020] The present invention also provides the application of the detection kit in detecting Rift Valley fever virus Gn antigen for non-diagnostic purposes.

[0021] The present invention also provides a double-antibody sandwich ELISA detection method for detecting Rift Valley fever virus Gn antigen for non-diagnostic purposes. Using the detection kit, the double-antibody sandwich ELISA detection method includes the following steps: S1, coating the enzyme-labeled plate with the capture antibody; S2, blocking with the blocking solution; S3, discarding the blocking solution, washing with the buffer solution, then adding the sample to be detected, and incubating; S4, washing with the buffer solution, then adding the detection antibody, and incubating; S5, developing color and detecting.

[0022] Preferably, the double-antibody sandwich ELISA detection method includes the following steps: (1) Coating: Dilute monoclonal antibody C8 to 2 μg / mL with the coating buffer and coat it on the enzyme-labeled plate, 100 μL / well, overnight at 4°C; (2) Blocking: Wash the plate 4 times with PBST, add 5% skim milk powder prepared with PBS, 100 μL / well, block at 37°C for 2 h; (3) Sampling: Discard the blocking solution, wash the plate 4 times with PBST, add the sample to be tested, incubate at 37°C for 60 min; (4) Adding the enzyme-labeled antibody: Wash the plate 4 times with PBST, add the diluted horseradish peroxidase-labeled monoclonal antibody A4 (0.25 μg / mL), 100 μL / well, react at 37°C for 60 min; (5) Developing color: Wash the plate 4 times with PBST, add the single-component TMB color developing solution, 100 μL / well, develop color in the dark at 37°C for 10 min; (6) Termination: Add 2 M H 2 SO 4 to terminate the reaction, 50 μL / well; (7) Reading value: The OD value is measured by an enzyme-linked immunosorbent assay (ELISA) reader. 450-630nm .

[0023] Result determination criterion: The ratio of the OD value of the sample to be tested 450-630nm (S) and the OD value of the negative control 450-630nm (N) is used as the criterion for determining positivity. When S / N ≥ 2.1, it is determined as positive, indicating that the sample to be tested contains Rift Valley fever virus; otherwise, it is determined as negative, indicating that the sample to be tested does not contain Rift Valley fever virus.

[0024] The capture antibody C8 and the detection antibody A4 described in the present invention are screened from a group of monoclonal antibodies targeting the Gn protein of Rift Valley fever virus, which can specifically bind to Rift Valley fever virus and have no cross-reaction with other viruses of the Bunyaviridae family such as severe fever with thrombocytopenia syndrome virus. Moreover, they have a high sensitivity to Rift Valley fever virus, which is beneficial for the early diagnosis of Rift Valley fever virus. At the same time, the monoclonal antibody sequences in this method are clear and can be obtained through large-scale fermentation, without the need for animal breeding and ascites extraction processes, and the cost is low.

[0025] Compared with the prior art, the present invention has the following advantages and beneficial effects: The present invention provides a kit for detecting Rift Valley fever virus Gn antigen based on a double-antibody sandwich ELISA method. When using this kit for double-antibody sandwich ELISA detection, it can specifically detect Rift Valley fever virus Gn antigen, has no cross-reaction with the Gn antigens of other viruses of the Bunyaviridae family such as severe fever with thrombocytopenia syndrome virus, the monoclonal antibody sequences are clear, the monoclonal antibodies used can be prepared by large-scale culture, have high sensitivity, and the detection limit is 781 pg / mL. Brief description of the drawings

[0026] Figure 1 It is the SDS-PAGE result of the truncated RVFV-Gn protein.

[0027] Figure 2 It is the SDS-PAGE result of the RVFV-Gn specific binding antibodies C8 and A4.

[0028] Figure 3 It is the ELISA result curve (EC 50 measurement) of the specific binding activity of C8 and A4 to RVFV-Gn.

[0029] Figure 4 It is the ELISA result curve of the C8-A4 antibody pair for detecting RVFV-Gn protein.

[0030] Figure 5ELISA binding diagrams of two monoclonal antibodies with recombinant Rift Valley fever virus Gn antigen (RVFV-Gn) and severe fever with thrombocytopenia syndrome virus Gn antigen (SFTSV-Gn), respectively.

[0031] Figure 6 Detection calibration curves of the two antibodies at their optimal concentrations in the present invention. Detailed implementation methods

[0032] Example 1: Obtaining truncated RVFV-Gn protein In this study, the head region (154-469aa) of the Gn protein was intercepted for eukaryotic expression and purification, laying a foundation for subsequent booster immunization of rhesus monkeys, sorting of Gn protein-specific memory B cells, and screening of Gn protein-binding antibodies.

[0033] The open reading frame (MORF) corresponding to the M gene (GenBank: DQ380208.1) of the Rift Valley fever virus MP-12 strain was codon-synthesized by Shanghai Sangon Biotech Co., Ltd., and primers were designed based on this template to amplify the gene of the truncated Gn protein. At the same time, the tPA signal peptide (ATGGACGCCATGAAGCGGGGCCTCTGCTGTGTTCTGCTGCTCTGCGGCGCCGTGTTCGTGAGTAACTCG) and Strep II tag (TTACTTTTCGAACTGCGGGTGGCTCCAGGCAGATCCTCCAGATCCTCCTCCAGATCCTCCTCCCTTTTCGAACTGCGGGTGGCTCCAAGCGGA) were added to the N-terminus and C-terminus of the truncated Gn protein respectively by PCR. Restriction enzyme cleavage sites Eco R I and Not I and the homologous arms of the pCAGGs vector were added to both ends of the upstream and downstream primers, and then the target gene was ligated to the linear pCAGGs vector digested with double enzymes ( Eco R I and Not I) by homologous recombination method. After obtaining the recombinant plasmid containing the truncated Gn protein, it was transfected into Expi293F cells, and the truncated Gn protein was purified using an affinity chromatography column (Strep Trap XT). Its expression and purity were identified by SDS-PAGE. The purified Gn protein is as Figure 1 shown, with a size of about 40 kDa.

[0034] Example 2: Obtaining monoclonal antibodies that bind to RVFV-Gn protein Obtaining of RVFV-Gn binding monoclonal antibodies: First, a recombinant human adenovirus type 4 expressing RVFV-Gn protein was constructed. The specific method was as follows: The open reading frame (MORF) of the M gene of the Rift Valley fever virus MP-12 strain (GenBank: DQ380208.1) synthesized after codon optimization was cloned into the plasmid pUC57 to obtain pUC57-opMORF. Using this as a template, restriction enzyme cleavage sites Swa I and homologous arms of the pAd4 vector were added to both ends of the target gene by PCR. Then, the plasmid pAd4 digested with the restriction enzyme Swa I alone was homologously recombined with the target gene to obtain a recombinant human adenovirus type 4 expressing the Gn protein of the Rift Valley fever virus.

[0035] The truncated Gn protein obtained by purification was used to immunize rhesus monkeys twice. The immunization protocol was as follows: At the first immunization, 1×10 8 IFUs of the recombinant human adenovirus type 4 expressing the Gn protein of the Rift Valley fever virus were used to immunize rhesus monkeys by intramuscular injection; at 28 days after immunization, the rhesus monkeys were immunized again in the same way and with the same dose. Finally, at 56 days and 182 days after the first immunization, 0.25 mg of Gn protein and 0.25 mg of aluminum adjuvant (purchased from Invivogen, vac-alu-50) were fully mixed and used to boost the immunization of rhesus monkeys by intramuscular injection.

[0036] Blood was collected from the vein at 210 days after the first immunization. The antibody titer in the serum was detected by ELISA. Peripheral blood was collected, and Gn-specific B cells were sorted by flow cytometry. The antibody genes were cloned by single-cell PCR technology, and a linear expression cassette was constructed. The heavy and light chains were co-transfected into 293T cells. After culturing for 48 h, the supernatant was collected. Then, ELISA was used to detect whether the supernatant contained binding antibodies against the Gn protein. The full-length genes of the heavy and light chains of the positive antibodies screened were cloned into the eukaryotic expression plasmid pCDNA3.4 by homologous recombination and transfected into the suspension cells Expi293F for large-scale expression, and purified by Protein A affinity column (HiTrapTM Protein A HP). Finally, 2 monoclonal antibodies C8 and A4 with good binding activity against the Gn protein were obtained. Their expression and purity were identified by SDS-PAGE, and the results were as Figure 2 shown.

[0037] The amino acid sequence of the heavy chain of monoclonal antibody C8 is shown in SEQ ID NO:1, and the amino acid sequence of the light chain is shown in SEQ ID NO:2. The gene sequence encoding the heavy chain of monoclonal antibody C8 is shown in SEQ ID NO:5, and the gene sequence encoding the light chain of monoclonal antibody C8 is shown in SEQ ID NO:6. The amino acid sequences of CDR1, CDR2, and CDR3 regions of the heavy chain variable region of monoclonal antibody C8 are shown as the amino acid sequences at positions 26-33, 51-58, and 97-111 of the sequence shown in SEQ ID NO:1, and the amino acid sequences of FR1, FR2, FR3, and FR4 regions are shown as the amino acid sequences at positions 1-25, 34-50, 59-96, and 112-122 of the sequence shown in SEQ ID NO:1; the amino acid sequences of CDR1, CDR2, and CDR3 regions of the light chain variable region are shown as the amino acid sequences at positions 27-32, 50-52, and 89-97 of the sequence shown in SEQ ID NO:2, and the amino acid sequences of FR1, FR2, FR3, and FR4 regions are shown as the amino acid sequences at positions 1-26, 33-49, 53-88, and 98-107 of the sequence shown in SEQ ID NO:2; The amino acid sequences of CDR1, CDR2, and CDR3 regions of the heavy chain variable region of monoclonal antibody A4 are shown as the amino acid sequences at positions 26-33, 51-58, and 97-101 of the sequence shown in SEQ ID NO:3, and the amino acid sequences of FR1, FR2, FR3, and FR4 regions are shown as the amino acid sequences at positions 1-25, 34-50, 59-96, and 102-112 of the sequence shown in SEQ ID NO:3; the amino acid sequences of CDR1, CDR2, and CDR3 regions of the light chain variable region are shown as the amino acid sequences at positions 27-38, 56-58, and 95-103 of the sequence shown in SEQ ID NO:4, and the amino acid sequences of FR1, FR2, FR3, and FR4 regions are shown as the amino acid sequences at positions 1-26, 39-55, 59-94, and 104-113 of the sequence shown in SEQ ID NO:4. The amino acid sequence of the heavy chain of monoclonal antibody A4 is shown in SEQ ID NO:3, and the amino acid sequence of the light chain is shown in SEQ ID NO:4. The gene sequence encoding the heavy chain of monoclonal antibody A4 is shown in SEQ ID NO:7, and the gene sequence encoding the light chain of monoclonal antibody A4 is shown in SEQ ID NO:8.

[0038] Example 3: Determination of the binding activity of monoclonal antibodies C8 and A4 1. Coat an enzyme-linked immunosorbent assay (ELISA) plate with purified RVFV-Gn protein (2 μg / mL, 100 μL / well) overnight at 4 °C. After washing 4 times with PBST, block it with 5% skim milk powder at 37 °C for 2 h; 2. After washing 4 times with PBST, monoclonal antibodies C8 and A4 against Gn protein antigen with an initial concentration of 9 μg / mL were added respectively, and serially diluted at a ratio of 1:3, and incubated at 37 °C for 1 h; 3. After washing 4 times with PBST, HRP-labeled goat anti-human IgG antibody (Sigma, AP113P) was added, and the antibody dilution ratio was 1:5000, 100 μL / well, and incubated at 37 °C for 1 h; 4. After washing 4 times with PBST, 100 μL of single-component TMB chromogenic solution was added, and chromogenic reaction was carried out at 37 °C for 10 min. Then 50 μL of ELISA stop solution was added, and finally the OD 450-630nm value was read with an enzyme-linked immunosorbent assay reader.

[0039] With the monoclonal antibody concentration as the X-axis and OD 450-630nm as the Y-axis, the binding curves of monoclonal antibodies C8 and A4 to RVFV-Gn were obtained as Figure 3 .

[0040] Table 1 ELISA binding EC of monoclonal antibodies C8 and A4 to RVFV-Gn antigen 50

[0041] Table 1 shows the EC 50 values.

[0042] Example 4: Detection sensitivity experiment of antibody pair C8-A4 To establish a double-antibody sandwich ELISA method for the detection of Gn antigen, it is necessary to perform a detection sensitivity experiment on the screened antibody pair. Monoclonal antibody C8 was used as the capture antibody, and monoclonal antibody A4 was used as the detection antibody (in this application, the detection monoclonal antibody was obtained by the HRP direct labeling method).

[0043] Experimental method: 1. The capture antibody C8 was coated at a concentration of 2 μg / mL on a 96-well ELISA plate, and two replicate wells were set. Incubate overnight at 4 °C. The next day, the plate was washed 4 times with PBST and blocked with 5% skim milk powder at 37 °C for 2 hours.

[0044] 2. After blocking, the plate was washed 4 times with PBST, and RVFV-Gn protein (concentration gradients were 50 ng / mL, 25 ng / mL, 12.5 ng / mL, 6.25 ng / mL, 3.125 ng / mL, 1.562 ng / mL, 0.781 ng / mL, 0.390 ng / mL, 0.195 ng / mL, 97.5 pg / mL, 48.75 pg / mL, 0 ng / mL) was added as the primary antibody, 100 μL / well, and incubated at 37 °C for 1 hour.

[0045] 3. After the incubation with the primary antibody, wash the plate 4 times with PBST, add HRP-labeled A4 as the secondary antibody (concentration: 2 μg / mL), and incubate at 37 °C for 1 hour.

[0046] 4. After the incubation with the secondary antibody, wash the plate 4 times with PBST, add 100 μL of single-component TMB chromogenic solution, develop color at 37 °C for 10 minutes, add 50 μL of stop solution, and measure the OD 450-630nm absorbance at this point to determine the binding activity.

[0047] Table 2 shows the OD 450-630nm values of the antibody pair C8-A4 for detecting RVFV-Gn. Use the ratio of the OD 450-630nm value S of the sample to be tested and the OD 450-630nm value N of the negative control as the standard for determining a positive test. When S / N ≥ 2.1, it is determined as positive, indicating that the sample to be tested contains RVFV-Gn; otherwise, it is determined as negative, indicating that the sample to be tested does not contain RVFV-Gn. It can be seen from Table 2 that the lowest detectable concentration of RVFV-Gn by this antibody pair is 390 pg / mL.

[0048] Table 2 OD 450-630nm values of the antibody pair C8-A4 for detecting RVFV-Gn

[0049] Using the RVFV-Gn concentration as the X-axis and OD 450-630nm as the Y-axis, the binding curve of C8-A4 to RVFV-Gn is Figure 4 .

[0050] Example 5: Specificity of the antibody pair Two monoclonal antibodies C8 and A4 were respectively subjected to a binding test with recombinant Rift Valley fever virus Gn antigen and Severe fever with thrombocytopenia syndrome virus (SFTSV) Gn antigen. The OD 450-630nm value was detected to determine whether C8 and A4 have detection specificity.

[0051] Experimental method: 1. Coat an enzyme-linked immunosorbent assay (ELISA) plate (2 μg / mL, 100 μL / well) with SFTSV-Gn protein (Gn antigen of SFTSV, purchased from ACROBiosystems, GNN-S52H3) overnight at 4 °C. After washing 4 times with PBST, block it with 5% skim milk powder at 37 °C for 2 h; 2. After washing 4 times with PBST, monoclonal antibodies C8 and A4 against RVFV-Gn protein antigen with an initial concentration of 200 ng / mL were added respectively, diluted in a gradient of 1:2, and incubated at 37 °C for 1 h; 3. After washing 4 times with PBST, HRP-labeled goat anti-human IgG antibody (Sigma, AP113P) was added, with the antibody dilution ratio of 1:5000, 100 μL per well, and incubated at 37 °C for 1 h; 4. After washing 4 times with PBST, 100 μL of single-component TMB chromogenic solution was added, developed at 37 °C for 10 min, then 50 μL of ELISA stop solution was added, and finally the OD 450-630nm value was read with an enzyme-linked immunosorbent assay reader.

[0052] The binding experiments of the two monoclonal antibodies C8 and A4 with RVFV-Gn antigen were the same as those in Example 3. The results of Example 3 were integrated and compared with the results of this example. With the monoclonal antibody concentration as the X-axis and OD 450-630nm as the Y-axis, the binding curves of monoclonal antibodies C8 and A4 with RVFV-Gn and SFTSV-Gn were obtained as Figure 5 .

[0053] Figure 5 The binding curves of monoclonal antibodies C8 and A4 with RVFV-Gn antigen and SFTSV-Gn antigen were shown respectively. The results showed that monoclonal antibodies C8 and A4 could specifically bind to RVFV-Gn antigen and did not bind to SFTSV-Gn antigen, indicating detection specificity.

[0054] Example 6: Optimization of the double-antibody sandwich ELISA detection protocol When the antibody pair C8-A4 was used to detect RVFV-Gn, the OD 450-630nm value of the blank well was relatively large, which was related to the concentration of the HRP-labeled antibody added. To establish a double-antibody sandwich ELISA method for the detection of RVFV-Gn antigen, it was necessary to optimize the addition amount of monoclonal antibody during the detection process.

[0055] The specific optimization plan was: reduce the addition amount of HRP-labeled antibody A4.

[0056] Experimental operation: 1. Antibody C8 was coated at a concentration of 2 μg / mL on a 96-well ELISA plate, and two duplicate wells were set. Incubated overnight at 4 °C. The next day, the plate was washed 4 times with PBST and blocked with 5% skim milk powder at 37 °C for 2 hours.

[0057] 2. After completion of the closure, wash the plate 4 times with PBST, add RVFV-Gn protein, dilute with 1% BSA, 100 μL / well, and incubate at 37 °C for 1 hour. The initial concentration of the RVFV-Gn protein after dilution is 50 ng / mL, and it is serially diluted 2-fold to 50 ng / mL, 25 ng / mL, 12.5 ng / mL, 6.25 ng / mL, 3.125 ng / mL, 1.562 ng / mL, 0.781 ng / mL, 0.390 ng / mL, 0.195 ng / mL, 97.5 pg / mL, 48.75 pg / mL, 0 ng / mL.

[0058] 3. After completion of the incubation, wash the plate 4 times with PBST, add HRP-labeled antibody A4 as the secondary antibody, 100 μL / well, and incubate at 37 °C for 1 hour. The concentrations of the secondary antibody are 1 μg / mL, 0.5 μg / mL, 0.25 μg / mL, and 0.125 μg / mL, respectively.

[0059] 4. After completion of the secondary antibody incubation, wash the plate 4 times with PBST, add single-component TMB chromogenic solution, 100 μL / well, develop color at 37 °C for 10 min, add 50 μL of stop solution, and measure the absorbance at OD 450-630nm value.

[0060] Table 3 shows the OD 450-630nm values for detecting RVFV-Gn with different concentrations of HRP-A4. As the concentration of the HRP-labeled antibody decreases, the OD 450-630nm value of the blank well (without adding RVFV-Gn protein) gradually decreases. Generally, it is required that the OD 450-630nm value of the blank well < 0.10.

[0061] It can be seen from Table 3 that as the concentration of HRP-A4 decreases, the OD 450-630nm values at the same Gn protein concentration gradually decrease, but the sensitivity is 0.781 ng / mL in all cases. Therefore, select the concentration of the HRP-labeled antibody under the condition that the blank OD 450-630nm value is less than 0.10 to make the kit, that is, the coating antibody C8 is 2 μg / mL and the detection antibody HRP-A4 is 0.25 μg / mL.

[0062] Table 3 OD 450-630nm values for detecting RVFV-Gn with different HRP-A4 concentrations

[0063] Figure 6 Under the condition that the detection antibody HRP-A4 is 0.25 μg / mL, with the RVFV-Gn concentration as the X value and OD 450-630nmThe value is the Y value, calculated using ELISA calc, and the fitting curve is obtained by selecting a logistic curve (four parameters) for the fitting model.

[0064] Example 7: Sensitivity of double-antibody sandwich ELISA for detecting RVFV-Gn in serum The object of the present invention is to detect whether Rift Valley fever virus is present in human serum. Therefore, it is necessary to determine the detection sensitivity of this double-antibody sandwich ELISA for RVFV-Gn in human serum.

[0065] The specific implementation method is to dilute the RVFV-Gn protein with single-person serum (serum of healthy volunteers) stored in the laboratory and detect the detection range of this double-antibody sandwich ELISA under this condition.

[0066] Table 4 OD values of double-antibody sandwich ELISA for detecting RVFV-Gn in serum 450-630nm value

[0067] Table 4 shows the OD values of double-antibody sandwich ELISA for detecting RVFV-Gn in serum. 450-630nm From Table 4, it can be concluded that the detection sensitivity of this double-antibody sandwich ELISA for detecting RVFV-Gn in human serum has decreased compared to that in 1% BSA, but it can still reach 781 pg / mL.

Claims

1. A monoclonal antibody targeting the Rift Valley fever virus Gn protein, characterized in that: is monoclonal antibody C8 and / or monoclonal antibody A4, The amino acid sequences of CDR1, CDR2 and CDR3 of the heavy chain variable region of monoclonal antibody C8 are shown in the amino acid sequences at positions 26-33, 51-58 and 97-111 of SEQ ID NO: 1; the amino acid sequences of CDR1, CDR2 and CDR3 of the light chain variable region are shown in the amino acid sequences at positions 27-32, 50-52 and 89-97 of SEQ ID NO: 2; The amino acid sequences of CDR1, CDR2 and CDR3 regions of the heavy chain variable region of monoclonal antibody A4 are shown in the amino acid sequences at positions 26-33, 51-58, and 97-101 of SEQ ID NO:3; the amino acid sequences of CDR1, CDR2 and CDR3 regions of the light chain variable region are shown in the amino acid sequences at positions 27-38, 56-58, and 95-103 of SEQ ID NO:

4.

2. The monoclonal antibody targeting the Rift Valley fever virus Gn protein according to claim 1, characterized in that: The amino acid sequence of the heavy chain of monoclonal antibody C8 is shown in SEQ ID NO: 1, and the amino acid sequence of the light chain is shown in SEQ ID NO: 2; The amino acid sequence of the heavy chain of monoclonal antibody A4 is shown in SEQ ID NO:3, and the amino acid sequence of the light chain is shown in SEQ ID NO:

4.

3. The gene encoding the monoclonal antibody targeting the Rift Valley fever virus Gn protein according to claim 2, characterized in that: The gene sequence encoding the heavy chain of monoclonal antibody C8 is shown in SEQ ID NO:5, and the gene sequence encoding the light chain of monoclonal antibody C8 is shown in SEQ ID NO:6; The gene sequence encoding the heavy chain of monoclonal antibody A4 is shown in SEQ ID NO:7, and the gene sequence encoding the light chain of monoclonal antibody A4 is shown in SEQ ID NO:

8.

4. Use of the monoclonal antibody targeting the Rift Valley fever virus Gn protein according to any one of claims 1 to 3 in the preparation of a detection kit for detecting the Rift Valley fever virus Gn antigen.

5. A detection kit for detecting Rift Valley fever virus Gn antigen, characterized in that: The invention comprises the monoclonal antibody targeting the Gn protein of Rift Valley fever virus as described in any one of claims 1 to 3.

6. The detection kit according to claim 5, characterized in that: The detection kit is a double antibody sandwich ELISA detection kit, wherein the monoclonal antibodies are monoclonal antibody C8 and monoclonal antibody A4, one of the monoclonal antibody C8 and the monoclonal antibody A4 is used as a capture antibody, and the other is used as a detection antibody, and the detection antibody is labeled.

7. The detection kit according to claim 6, characterized in that: The markers used to label the monoclonal antibody in the detection antibody are peroxidase, phosphatase or luciferase.

8. The detection kit according to claim 7, characterized in that: The peroxidase is horseradish peroxidase.

9. Use of the detection kit according to any one of claims 6 to 8 for non-diagnostic purposes in detecting Rift Valley fever virus Gn antigen.

10. A double antibody sandwich ELISA detection method for detecting Rift Valley fever virus Gn antigen for non-diagnostic purposes, characterized in that: Using the detection kit according to any one of claims 6 to 8, the double antibody sandwich ELISA detection method comprises the following steps: S1, coating the ELISA plate with capture antibody; S2, blocking with blocking solution; S3, discard the blocking solution, wash with buffer, then add the sample to be tested and incubate; S4, wash with buffer, then add detection antibody and incubate; S5, color development and detection.

Images