Recombinant microorganism for producing adipic acid and hexamethylenediamine and application thereof

Abstract

The invention relates to the technical field of genetic engineering and biological fermentation, and particularly discloses a recombinant microorganism for producing adipic acid and hexamethylenediamine and application of the recombinant microorganism. Compared with an original strain, the recombinant microorganism disclosed by the invention has the advantages that beta-ketoadipyl coenzyme A thiolase paaJ, 3-hydroxyadipyl coenzyme A dehydrogenase paaH, 2, 3-dehydroadipyl coenzyme A hydratase paaF, trans-2-enoyl coenzyme A reductase ter and acyl coenzyme A thioesterase Acot8 are expressed. The recombinant microorganism can be used for producing adipic acid, and an organic carbon source can be efficiently bioconverted into hexamethylenediamine through mixed culture of the recombinant microorganism capable of producing hexamethylenediamine from adipic acid. The hexamethylenediamine can be directly synthesized by using cheap glucose, glycerol and the like as raw materials, and the production process is green and safe.

Description

Technical Field

[0001] The present invention relates to the technical fields of genetic engineering and biological fermentation, and specifically, to a recombinant microorganism for producing adipic acid and hexamethylenediamine and its application. Background Art

[0002] Hexamethylenediamine is an important C6 platform chemical with wide industrial applications. Hexamethylenediamine is a key monomer for the production of high-performance polyamides (such as nylon-66 and nylon-610). Currently, the production of hexamethylenediamine mainly relies on fossil-derived raw materials: hexamethylenediamine is synthesized through the hydrogenation reaction of adiponitrile. However, the chemical process has significant drawbacks, including harsh reaction conditions, toxicity of starting materials or intermediates (such as adiponitrile), high energy consumption, and easy pollution caused by hazardous by-products. These limitations highlight the urgent need to develop sustainable and environmentally friendly alternative methods. Summary of the Invention

[0003] One of the objectives of the present invention is to provide a new recombinant microorganism that can fermentatively produce adipic acid and a method for producing hexamethylenediamine after co-culturing it with a recombinant microorganism that can produce hexamethylenediamine from adipic acid.

[0004] The present invention provides a recombinant microorganism that, compared with the parental strain, expresses β-ketoadipyl-CoA thiolase paaJ, 3-hydroxyadipyl-CoA dehydrogenase paaH, 2,3-dehydroadipyl-CoA hydratase paaF, trans-2-enoyl-CoA reductase ter, and acyl-CoA thioesterase Acot8; The NCBI accession number of β-ketoadipyl-CoA thiolase paaJ is WP_001206197.1; the NCBI accession number of 3-hydroxyadipyl-CoA dehydrogenase paaH is WP_114399327.1; the NCBI accession number of 2,3-dehydroadipyl-CoA hydratase paaF is KPP80590.1; the NCBI accession number of trans-2-enoyl-CoA reductase ter is WP_002681770.1; the NCBI accession number of acyl-CoA thioesterase Acot8 is NP_573503.2.

[0005] Preferably, compared with the parental strain, the recombinant microorganism has a reduced expression level of acylated succinate semialdehyde dehydrogenase sucD, or further, a reduced expression level of acetyl-CoA acetyltransferase atoB; the NCBI accession number of acylated succinate semialdehyde dehydrogenase sucD is WP_012103358.1; the NCBI accession number of acetyl-CoA acetyltransferase atoB is WP_000786547.1.

[0006] The present invention has found through research that acetyl-CoA and succinyl-CoA can be sequentially converted into 3-oxoadipyl-CoA, 3-hydroxyadipyl-CoA, 5-carboxy-2-pentenoyl-CoA, adipyl-CoA and adipic acid by β-ketoadipyl-CoA thiolase, 3-hydroxyadipyl-CoA dehydrogenase, 2,3-dehydroadipyl-CoA hydratase, trans-2-enoyl-CoA reductase and acyl-CoA thioesterase. Furthermore, the present invention uses specific 3-hydroxyadipyl-CoA dehydrogenase and 2,3-dehydroadipyl-CoA hydratase (3-hydroxyadipyl-CoA dehydrogenase paaH derived from Marinitenerispora sediminis and 2,3-dehydroadipyl-CoA hydratase paaF derived from Oceanicaulis sp.), β-ketoadipyl-CoA thiolase paaJ derived from Escherichia coli, ter derived from Treponema denticola, and acyl-CoA thioesterase Acot8 derived from Mus musculus to jointly construct a pathway for producing adipic acid from glucose.

[0007] In the recombinant microorganism of the present invention, the coding nucleic acid sequence of β-ketoadipyl-CoA thiolase paaJ is as shown in SEQ ID NO.3; the coding nucleic acid sequence of 3-hydroxyadipyl-CoA dehydrogenase paaH is as shown in SEQ ID NO.4; the coding nucleic acid sequence of 2,3-dehydroadipyl-CoA hydratase paaF is as shown in SEQ ID NO.5; the coding nucleic acid sequence of trans-2-enoyl-CoA reductase ter is as shown in SEQ ID NO.6; the coding nucleic acid sequence of acyl-CoA thioesterase Acot8 is as shown in SEQ ID NO.7; the coding nucleic acid sequence of acylated succinic semialdehyde dehydrogenase sucD is as shown in SEQ ID NO.1; the coding nucleic acid sequence of acetyl-CoA acetyltransferase atoB is as shown in SEQ ID NO.2.

[0008] In the recombinant microorganism of the present invention, the starting strain is Escherichia coli.

[0009] The present invention also provides the application of the above recombinant microorganism in the fermentation production of adipic acid / adiponitrile or in microbial genetic breeding for the production of adipic acid or in increasing the yield of biological synthesis of adipic acid / adiponitrile.

[0010] The present invention also provides a method for fermentatively producing adipic acid / adiponitrile, which includes the step of culturing the above recombinant microorganism.

[0011] As a specific embodiment, when adipic acid is produced by the present invention, the recombinant microorganism expressing β-ketoadipyl-CoA thiolase paaJ, 3-hydroxyadipyl-CoA dehydrogenase paaH, 2,3-dehydroadipyl-CoA hydratase paaF, trans-2-enoyl-CoA reductase ter and acyl-CoA thioesterase Acot8 (or further reducing the expression levels of acylated succinic semialdehyde dehydrogenase sucD or sucD and acetyl-CoA acetyltransferase atoB) can be inoculated into a fermentation medium (with glucose as the carbon source) for cultivation. When the OD of the bacterial cells reaches 0.6, IPTG is added for induction, and then fermentation continues to achieve the production of adipic acid.

[0012] In the method of the present invention, when producing hexamethylenediamine by fermentation, it includes the step of co-culturing the above-mentioned recombinant microorganism with a recombinant microorganism capable of producing hexamethylenediamine from adipic acid.

[0013] In the method of the present invention, compared with the starting strain, the recombinant microorganism capable of producing hexamethylenediamine from adipic acid expresses adipic acid transporters DcaK and DcaP, acyl-CoA transferases DcaI and DcaJ, acylated succinic semialdehyde dehydrogenase sucD, 4-aminobutyrate aminotransferase gabT, carboxylic acid reductase CAR variant, CAR-activating enzyme sfp and putrescine aminotransferase patA; The NCBI accession number of the adipic acid transporter DcaK is ENV54224.1, and that of DcaP is WP_004926597.1; the NCBI accession number of the acyl-CoA transferase DcaI is WP_004926591.1, and that of DcaJ is WP_004926593.1; the NCBI accession number of the acylated succinic semialdehyde dehydrogenase sucD is WP_012103358.1; the NCBI accession number of the 4-aminobutyrate aminotransferase gabT is WP_010984019.1; the amino acid sequence of the carboxylic acid reductase CAR variant is as shown in SEQ ID NO.55; the NCBI accession number of the putrescine aminotransferase patA is WP_001520281.1; the NCBI accession number of the CAR-activating enzyme sfp is WP_003234549.1; the starting strain is Escherichia coli.

[0014] Hexamethylenediamine is an important C6 platform chemical with wide industrial applications. There is no organism in nature that can directly synthesize hexamethylenediamine, and there is no reported biosynthetic pathway for its de novo synthesis in the literature. The present invention creatively designs an artificial biosynthetic pathway for hexamethylenediamine, which uses adipic acid as an important intermediate metabolite, and enzymes for the artificial pathway that can catalyze the synthesis of adipic acid are screened. By recombining this artificial biosynthetic pathway in microorganisms, the constructed recombinant microorganisms can utilize inexpensive carbon sources such as glucose to produce adipic acid, and then perform co-culture fermentation with Escherichia coli that produces hexamethylenediamine from adipic acid, enabling the production of hexamethylenediamine from glucose, which has important industrial application value. The schematic diagram of the process for producing hexamethylenediamine by fermenting glucose using recombinant microorganisms in the present invention is shown in Figure 1 .

[0015] As a specific embodiment, when producing hexamethylenediamine in the present invention, a recombinant microorganism (adipic acid-producing recombinant microorganism) expressing β-ketoadipyl-CoA thiolase paaJ, 3-hydroxyadipyl-CoA dehydrogenase paaH, 2,3-dehydroadipyl-CoA hydratase paaF, trans-2-enoyl-CoA reductase ter, and acyl-CoA thioesterase Acot8 (or further reducing the expression levels of acylated succinic semialdehyde dehydrogenase sucD or sucD and acetyl-CoA acetyltransferase atoB) and a recombinant microorganism (hexamethylenediamine-producing recombinant microorganism) expressing adipic acid transporter DcaK and DcaP, acyl-CoA transferases DcaI and DcaJ, acylated succinic semialdehyde dehydrogenase sucD, 4-aminobutyrate aminotransferase gabT, carboxylic acid reductase CAR variant, CAR activating enzyme sfp, and putrescine aminotransferase patA are simultaneously inoculated into a fermentation medium (the carbon source is glucose) for cultivation. When the cell OD reaches 0.6, IPTG is added for induction, and then fermentation continues to achieve the production of hexamethylenediamine.

[0016] In the method of the present invention, the carbon source for culturing the recombinant microorganisms can be one or more of glucose and glycerol. The co-culture inoculation ratio of the adipic acid-producing recombinant microorganism and the hexamethylenediamine-producing recombinant microorganism is between 3:1 and 1:3.

[0017] The present invention uses recombinant microorganisms for co-culture to directly convert fermentable organic carbon sources into hexamethylenediamine, with low production costs, providing a new method for the production of hexamethylenediamine.

[0018] In the method of the present invention, the coding nucleic acid sequence of the carboxylic acid reductase CAR variant is as shown in SEQ ID NO. 28; the coding nucleic acid sequence of the CAR activating enzyme sfp is as shown in SEQ ID NO. 31; the coding nucleic acid sequence of the putrescine transaminase patA is as shown in SEQ ID NO. 34; the coding nucleic acid sequences of the adipate transporters DcaK and DcaP are as shown in SEQ ID NO. 37 and 40 respectively; the coding nucleic acid sequences of the acyl-CoA transferases DcaI and DcaJ are as shown in SEQ ID NO. 43 and 46 respectively; the coding nucleic acid sequence of the acylated succinic semialdehyde dehydrogenase sucD is as shown in SEQ ID NO. 49; the coding nucleic acid sequence of the 4-aminobutyrate transaminase gabT is as shown in SEQ ID NO. 52.

[0019] The present invention also provides a method for constructing a recombinant microorganism for producing adipic acid, which includes the steps of making a starting strain express β-ketoadipyl-CoA thiolase paaJ, 3-hydroxyadipyl-CoA dehydrogenase paaH, 2,3-dehydroadipyl-CoA hydratase paaF, trans-2-enoyl-CoA reductase ter, and acyl-CoA thioesterase Acot8; Preferably, it further includes the step of reducing the expression level of the acylated succinic semialdehyde dehydrogenase sucD of the starting strain, or further, reducing the expression level of the acetyl-CoA acetyltransferase atoB of the starting strain; The NCBI accession number of β-ketoadipyl-CoA thiolase paaJ is WP_001206197.1; the NCBI accession number of 3-hydroxyadipyl-CoA dehydrogenase paaH is WP_114399327.1; the NCBI accession number of 2,3-dehydroadipyl-CoA hydratase paaF is KPP80590.1; the NCBI accession number of trans-2-enoyl-CoA reductase ter is WP_002681770.1; the NCBI accession number of acyl-CoA thioesterase Acot8 is NP_573503.2; the NCBI accession number of the acylated succinic semialdehyde dehydrogenase sucD is WP_012103358.1; the NCBI accession number of the acetyl-CoA acetyltransferase atoB is WP_000786547.1; the starting strain is Escherichia coli.

[0020] The beneficial effects of the present invention are at least as follows: The present invention provides a recombinant microorganism that can produce adipic acid using inexpensive carbon sources such as glucose. Mixing and fermenting it with a recombinant microorganism that can convert adipic acid to produce hexamethylenediamine can directly produce hexamethylenediamine using inexpensive carbon sources such as glucose, thereby realizing the green production of bio-based hexamethylenediamine. Brief Description of the Drawings

[0021] Figure 1 This is a schematic flow chart of the production of hexamethylenediamine by fermenting glucose using recombinant microorganisms according to the present invention. Specific Embodiments

[0022] The preferred embodiments of the present invention will be described in detail below in conjunction with examples. It should be understood that the following examples are given only for illustrative purposes and are not intended to limit the scope of the present invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from the spirit and scope of the present invention.

[0023] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial sources or prepared according to conventional methods in the art.

[0024] Example 1 Construction of the Glucose to Adipic Acid Synthesis Module In this example, the genome of Escherichia coli MG1655 (NCBI accession number GCF_000005845.2) was used as a template, and primers paaJ-F (TTTAATAAGGAGATATACCATGCGTGAAGCCTTTATTTGTGACG, SEQ ID NO.8) and paaJ-R (TAAGCATTATGCGGCCGCTCAAACACGCTCCAGAATCATGGC, SEQ ID NO.9) were used for amplification to obtain a paaJ gene fragment of about 1.2 kb (the NCBI accession number of the amino acid sequence of the paaJ gene is WP_001206197.1, and the nucleotide sequence is shown in SEQ ID No.3), and PCR purification was performed.

[0025] 3-Hydroxyadipyl-CoA dehydrogenase paaH was artificially synthesized (the NCBI accession number of the amino acid is WP_114399327.1, and the gene sequence is shown in SEQ ID NO.4). Using this gene fragment as a template and primers paaH-F (CCATCATCACCACAGCCAGATGGTCCAGGAGTTCCAAACGG, SEQ ID NO.10) and paaH-R (TTAAGCATTATGCGGCCGCTTAGCGAAGGATACGTCCACCTG, SEQ ID NO.11) as primers for amplification, a paaH gene fragment of about 1.2 kb was obtained and PCR purification was performed.

[0026] Synthetically produce 2,3-dehydroadipyl-CoA hydratase paaF (the NCBI accession number of the amino acid is KPP80590.1, and the gene sequence is as shown in SEQ ID NO.5), and use this gene fragment as a template with primers paaF-F (CAAAGGAGGCCGCGGCCAAAATGGCATACAAAACGATTCAGACTAAAACAGA, SEQ ID NO.12) and paaF-R (GATGGTGATGGCTGCTGCCTTAACGGTGCCGGAAGTGC, SEQ ID NO.13) for amplification to obtain a paaF gene fragment of approximately 0.8 kb and perform PCR purification.

[0027] Synthetically produce trans-2-enoyl-CoA reductase ter (the NCBI accession number of the amino acid is WP_002681770.1, and the gene sequence is as shown in SEQ ID NO.6), and use this gene fragment as a template with primers ter-F (ATCTTAGTATATTAGTTAAGTATAAGAAGGAGATATACATATGATCGTAAAGCCTATGGTGCGT, SEQ ID NO.14) and ter-R (TATCCAATTGAGATCTGCCATTCAGATGCGATCAAAGCGCTCAAC, SEQ ID NO.15) for amplification to obtain a ter fragment of approximately 1.2 kb and perform PCR purification.

[0028] Synthetically produce acyl-CoA thioesterase Acot8 (the NCBI accession number of the amino acid is NP_573503.2, and the gene sequence is as shown in SEQ ID NO.7), and use this gene fragment as a template with primers Acot8-F (ATCACCATCATCACCACAGCCAGATGTCTGCCCCGGAGGG, SEQ ID NO.16) and Acot8-R (AAGCATTATGCGGCCGCTCACAGTTTCGACTCTGATACTTGGG, SEQ ID NO.17) for amplification to obtain an Acot8 fragment of approximately 1.0 kb and perform PCR purification.

[0029] After separately ligating the above-mentioned purified paaJ fragment and paaH fragment to the double T7 promoters of pRSFDuet-1 using the Gibson Assembly kit (NEB), the obtained recombinant plasmid is named pRSF-paaJ-paaH.

[0030] The pETDuet-1 plasmid was used to ligate the purified paaF fragment and ter fragment obtained above to the double T7 promoters of pETDuet-1 using the Gibson Assembly kit (NEB), and the resulting recombinant plasmid was named pET-paaF-ter.

[0031] The pCDFDuet-1 plasmid was used to ligate the purified Acot8 fragment obtained above to the T7 promoter of pCDFDuet-1 using the Gibson Assembly kit (NEB), and the resulting recombinant plasmid was named pCDF-Acot8.

[0032] pRSF-paaJ-paaH, pET-paaF-ter and pCDF-Acot8 were transformed into Escherichia coli BL21(DE3) by electroporation, and recombinant bacteria were screened on LB plates containing 50 mg / L kanamycin, 100 mg / L ampicillin and 100 mg / L spectinomycin, and named E.c / pRSF-paaJ-paaH / pET-paaF-ter / pCDF-Acot8. At the same time, the empty plasmids pRSFDuet-1, pETDuet- and pCDFDuet-1 were also transformed into Escherichia coli BL21(DE3) to obtain the control strain E.c / pRSF / pET / pCDF. The strains E.c / pRSF-paaJ-paaH / pET-paaF-ter / pCDF-Acot8 and the control strain E.c / pRSF / pET / pCDF were inoculated into the fermentation medium for cultivation. The fermentation temperature was 30 °C and the rotation speed was 250 rpm. When the OD of the bacteria reached 0.6, 0.5 mM IPTG was added for induction, and fermentation continued for 48 h.

[0033] The fermentation medium formula was (g / L): glucose 10, ammonium dihydrogen phosphate ((NH 4 ) 2 HPO 4 ) 4, potassium dihydrogen phosphate (KH 2 PO 4 ) 6.7, magnesium sulfate heptahydrate (MgSO 4 ·7H 2 O) 0.8, yeast extract 2.5, citric acid 0.8, and 5 mL of trace metal solution. The composition of the trace metal solution included (g / L): ferrous sulfate heptahydrate (FeSO 4 ·7H 2 O) 10, calcium chloride dihydrate (CaCl 2 ·2H 2 O) 2, zinc sulfate heptahydrate (ZnSO 4 ·7H2 O) 2.2, manganese sulfate tetrahydrate (MnSO 4 ·4H 2 O) 0.5, copper sulfate pentahydrate (CuSO 4 ·5H 2 O) 1, ammonium molybdate tetrahydrate ((NH 4 ) 6 Mo 7 O 24 ·4H 2 O) 0.1 and borax (Na 2 B 4 O 7 ·10H 2 O) 0.02.

[0034] After 48 hours of fermentation, the products of the strain were detected by high performance liquid chromatography (HPLC). The strain E.c / pRSF-paaJ-paaH / pET-paaF-ter / pCDF-Acot8 could produce 0.16 g / L adipic acid, while the control strain did not produce adipic acid. This indicated that the introduced artificial pathway could successfully achieve the conversion of glucose to adipic acid.

[0035] Example 2 Knockout of the sucD gene in Escherichia coli In this example, the genome of Escherichia coli BL21 (DE3) (NCBI accession number GCA_000022665.2) was used as a template, and primers sucD-up-F (CGAGTCGGTGCTTTTTTTGAATTCCTGTTCCGCCAGCCT, SEQ ID NO.18) and sucD-up-R (GGCTATTTCTTATTACAGATATTATTTCCCCTCCACTGCG, SEQ ID NO.19) were used for PCR to obtain a gene fragment sucD-up of about 0.5 kb and the product was purified. Using the genome of Escherichia coli BL21 (DE3) as a template, primers sucD-down-F (CGCAGTGGAGGGGAAATAATATCTGTAATAAGAAATAGCCCTCG, SEQ ID NO.20) and sucD-down-R (TAACAGGGTAATAGATCTATCTAGATTTTCTTCAGCAACAGCTACAA, SEQ ID NO.21) were used for PCR to obtain a gene fragment sucD-down of about 0.5 kb and the product was purified. GTGATGATTGGTGAGATCGG (SEQ ID NO.22) was used as sucD N20.

[0036] The sucD-up, sucD-down, and sucD N20 fragments were ligated into the plasmid pTargetF (Appl Environ Microbiol 81:2506-2514.) in one step using the Gibson Assembly kit (NEB), and the resulting recombinant plasmid was named pTarget-sucD.

[0037] pCas9 (Appl Environ Microbiol 81:2506-2514.) was electrotransformed into Escherichia coli BL21 (DE3) using an electroporator (Bio-Rad). The electroporation conditions were a voltage of 2.5 KV, a resistance of 200 Ω, and a capacitance of 25 μF (the width of the electroporation cuvette was 2 mm). After electroporation, the cells were recovered at a lower temperature of 30 °C and then spread on LB medium plates containing kanamycin for overnight culture.

[0038] Single colonies with correct colony PCR results were picked into liquid LB medium containing kanamycin resistance, and a 0.4% arabinose solution was added to induce the expression of the recombinant protein. When the culture reached an OD600 of approximately 0.5-0.6 at 30 °C, electrocompetent cells were prepared.

[0039] One tube of the prepared electrocompetent cells was taken out, thawed on ice, 200 ng of the pTarget-sucD plasmid was added and mixed well. The plasmid and electrocompetent cell mixture was transferred to a pre-cooled 2 mm electroporation cuvette. The electroporation conditions were a voltage of 2.5 KV, a resistance of 200 Ω, and a capacitance of 25 μF. After electroporation, the electroporation cuvette was immediately taken out, 1 ml of LB liquid medium without antibiotics was added, and after pipetting several times, it was transferred to a 2 ml centrifuge tube. The cells were recovered and cultured on a shaker at 30 °C and 220 rpm for 2 hours. At room temperature, the cells were centrifuged at 8000 × g for 2 minutes, the supernatant was poured out, and 100 μL of the bacterial suspension was spread on a resistance plate containing kanamycin mixed with streptomycin and cultured overnight at 30 °C.

[0040] Colony PCR was performed for identification. Monoclonal colonies with correct identification were inoculated into liquid LB medium containing kanamycin resistance, and 0.5 mM IPTG was added to eliminate the pTarget-sucD plasmid. After overnight shaking culture at 30 °C, the cells were streaked on a solid plate containing kanamycin resistance and cultured overnight at 30 °C.

[0041] Single colonies were picked and streaked on both kanamycin resistance plates and streptomycin resistance plates, and cultured overnight at 30 °C. Monoclonal colonies that did not grow on the streptomycin resistance plate but grew on the kanamycin resistance plate were selected and inoculated into liquid LB medium without resistance and cultured overnight at 37 °C to eliminate the pCas9 plasmid, and then streaked on a solid plate without resistance and cultured for 12 h.

[0042] Pick monoclonal colonies and streak them on non-resistant plates and kanamycin-resistant plates respectively, and culture them overnight at 37°C. Select the monoclonal colonies that do not grow on the kanamycin-resistant plate but grow on the non-resistant plate to obtain the strain E.c-sucD. The key feature of this recombinant bacterium is the knockout of the sucD gene (SEQ ID No.1, and the NCBI accession number for the encoded amino acid is WP_012103358.1).

[0043] Electrotransform the expression plasmids pRSF-paaJ-paaH, pET-paaF-ter, and pCDF-Acot8 into Escherichia coli E.c-sucD to obtain the strain E.c-sucD / pRSF-paaJ-paaH / pET-paaF-ter / pCDF-Acot8.

[0044] Example 3 Knockout of the atoB gene in Escherichia coli In this example, the genome of Escherichia coli BL21 (DE3) (NCBI number: GCA_000022665.2) was used as a template, and PCR was performed with the primers atoB-up-F (CGAGTCGGTGCTTTTTTTGAATTCTACATAAAACGCCAATGGCTT, SEQ ID NO.23) and atoB-up-R (ATCGGGTGTTTTTATTGATTTATATTCCTTCTGTTTGTAGGGGT, SEQ ID NO.24) to obtain a gene fragment atoB-up of approximately 0.5 kb and purify the product. Using the genome of Escherichia coli BL21 (DE3) as a template, PCR was performed with the primers atoB-down-F (CCCTACAAACAGAAGGAATATAAATCAATAAAAACACCCGATAGCG, SEQ IDNO.25) and atoB-down-R (TAACAGGGTAATAGATCTATCTAGACATCAGCCCGGATGGG, SEQ ID NO.26) to obtain a gene fragment atoB-down of approximately 0.5 kb and purify the product. Use AATACCAGACGCGTTCCCAG (SEQ ID NO.27) as atoB N20.

[0045] Use the Gibson Assembly kit (NEB) to ligate the atoB-up, atoB-down, and atoB N20 fragments into the plasmid pTargetF (Appl Environ Microbiol 81:2506-2514.) in one step, and name the obtained recombinant plasmid pTarget-atoB.

[0046] The pCas9 (Appl Environ Microbiol 81:2506-2514.) was transformed into Escherichia coli E.c-sucD by electroporation (Bio-Rad), and the electroporation conditions were a voltage of 2.5 KV, a resistance of 200 Ω, and a capacitance of 25 μF (the width of the electroporation cuvette was 2 mm). After electroporation, the cells were resuscitated at a lower temperature of 30 °C and then spread on a plate of LB medium containing kanamycin for overnight culture.

[0047] Single colonies with correct colony PCR results were picked and inoculated into liquid LB medium with kanamycin resistance. A 0.4% arabinose solution was added to induce the expression of recombinant proteins. When the culture reached an OD600 of approximately 0.5-0.6 at 30 °C, electrocompetent cells were prepared.

[0048] One tube of the prepared electrocompetent cells was taken out, melted on ice, and 200 ng of the pTarget-atoB plasmid was added and mixed well. The plasmid and electrocompetent cell mixture was transferred to a pre-cooled 2 mm electroporation cuvette. The electroporation conditions were a voltage of 2.5 KV, a resistance of 200 Ω, and a capacitance of 25 μF. After electroporation, the electroporation cuvette was immediately taken out, 1 ml of LB liquid medium without antibiotics was added, and after pipetting several times, it was transferred to a 2 ml centrifuge tube. The cells were resuscitated and cultured on a shaker at 30 °C and 220 rpm for 2 hours. At room temperature, the cells were centrifuged at 8000 × g for 2 minutes. The supernatant was poured out, and 100 μL of the bacterial solution was spread on a resistant plate containing kanamycin and streptomycin and cultured overnight at 30 °C.

[0049] Colony PCR was performed for identification. The correctly identified single colonies were inoculated into liquid LB medium with kanamycin resistance, and 0.5 mM IPTG was added to eliminate the pTarget-atoB plasmid. After overnight shaking culture at 30 °C, the cells were streaked on a solid plate with kanamycin resistance and cultured overnight at 30 °C.

[0050] Single colonies were picked and streaked on both a kanamycin-resistant plate and a streptomycin-resistant plate, and cultured overnight at 30 °C. Monoclonal colonies that did not grow on the streptomycin-resistant plate but grew on the kanamycin-resistant plate were selected and inoculated into liquid LB medium without resistance and cultured overnight at 37 °C to eliminate the pCas9 plasmid, and then streaked on a solid plate without resistance and cultured for 12 h.

[0051] Single colonies were picked and streaked on both a plate without resistance and a kanamycin-resistant plate, and cultured overnight at 37 °C. Monoclonal colonies that did not grow on the kanamycin-resistant plate but grew on the plate without resistance were selected to obtain the strain E.c-sucD-atoB. The key characteristics of this recombinant bacterium are the knockout of the sucD gene and the atoB gene (SEQ ID No.2, and the NCBI accession number for the encoded amino acid is WP_000786547.1).

[0052] The expression plasmids pRSF-paaJ-paaH, pET-paaF-ter and pCDF-Acot8 were electrotransformed into Escherichia coli E.c-sucD-atoB to obtain the strain E.c-sucD-atoB / pRSF-paaJ-paaH / pET-paaF-ter / pCDF-Acot8.

[0053] Example 4 Fermentation production of adipic acid using improved recombinant Escherichia coli E.c / pRSF-paaJ-paaH / pET-paaF-ter / pCDF-Acot8, as well as the recombinant strains E.c-sucD / pRSF-paaJ-paaH / pET-paaF-ter / pCDF-Acot8 and E.c-sucD-atoB / pRSF-paaJ-paaH / pET-paaF-ter / pCDF-Acot8 were inoculated into the fermentation medium for cultivation. The fermentation temperature was 30 °C and the rotation speed was 250 rpm. When the cell OD reached 0.6, 0.5 mM IPTG was added for induction, and fermentation continued for 48 h.

[0054] The fermentation medium formula was (g / L): glucose 10, ammonium dihydrogen phosphate ((NH 4 ) 2 HPO 4 ) 4, potassium dihydrogen phosphate (KH 2 PO 4 ) 6.7, magnesium sulfate heptahydrate (MgSO 4 ·7H 2 O) 0.8, yeast extract 2.5, citric acid 0.8, and 5 mL of trace metal solution. The composition of the trace metal solution included (g / L): ferrous sulfate heptahydrate (FeSO 4 ·7H 2 O) 10, calcium chloride dihydrate (CaCl 2 ·2H 2 O) 2, zinc sulfate heptahydrate (ZnSO 4 ·7H 2 O) 2.2, manganese sulfate tetrahydrate (MnSO 4 ·4H 2 O) 0.5, copper sulfate pentahydrate (CuSO 4 ·5H 2 O) 1, ammonium molybdate tetrahydrate ((NH 4 ) 6 Mo 7 O 24 ·4H 2 O) 0.1 and borax (Na 2 B 4O 7 ·10H 2 O) 0.02

[0055] After 48 hours of fermentation, the products of the strains were detected by high performance liquid chromatography (HPLC). The strains E.c / pRSF-paaJ-paaH / pET-paaF-ter / pCDF-Acot8, E.c-sucD / pRSF-paaJ-paaH / pET-paaF-ter / pCDF-Acot8 and E.c-sucD-atoB / pRSF-paaJ-paaH / pET-paaF-ter / pCDF-Acot8 could produce 0.16 g / L, 0.27 g / L and 0.36 g / L adipic acid respectively. It was shown that increasing the availability of the metabolic precursors succinyl-CoA and acetyl-CoA was an effective strategy to improve the adipic acid production.

[0056] Example 5 Construction of Recombinant Escherichia coli for Fermentative Production of 1,6-Hexanediol The adipic acid diamine-producing strain expresses adipic acid transporter and acyl-CoA transferase DcaKPIJ, acylated succinic semialdehyde dehydrogenase sucD, 4-aminobutyrate aminotransferase gabT, carboxylic acid reductase CAR variant, putrescine aminotransferase patA, and expresses CAR-activating enzyme sfp. The NCBI accession number of the adipic acid transporter DcaK is ENV54224.1, and that of DcaP is WP_004926597.1; the NCBI accession number of the acyl-CoA transferase DcaI is WP_004926591.1, and that of DcaJ is WP_004926593.1; the NCBI accession number of the acylated succinic semialdehyde dehydrogenase sucD is WP_012103358.1; the NCBI accession number of the 4-aminobutyrate aminotransferase gabT is WP_010984019.1; the amino acid sequence of the carboxylic acid reductase CAR variant is shown in SEQ ID NO.55; the NCBI accession number of the putrescine aminotransferase patA is WP_001520281.1; the NCBI accession number of the CAR-activating enzyme sfp is WP_003234549.1.

[0057] The specific construction method is as follows: An optimized gene nucleic acid sequence was artificially designed based on the amino acid sequence of the carboxylic acid reductase CAR variant of Mycobacteroides abscessus (the gene sequence is shown in SEQ ID NO.28). Using this gene fragment as a template, primers CAR-F (TTTGTTTAACTTTAAGAAGGAGATATACCATGACGGAAACTATTTCCACAGCTG, SEQ ID NO.29) and CAR-R (TTTGTTTAACTTTAAGAAGGAGATATACCATGACGGAAACTATTTCCACAGCTG, SEQ ID NO.30) were used for PCR to obtain a CAR fragment of approximately 3.6 kb and perform PCR purification.

[0058] The activating enzyme gene sfp of carboxylic acid reductase was artificially synthesized (the gene sequence is shown in SEQ ID NO.31). Using this gene fragment as a template, primers sfp-F (TTTGTTTAACTTTAAGAAGGAGATATACCATGACGGAAACTATTTCCACAGCTG, SEQ ID NO.32) and sfp-R (CTTAAGCATTATGCGGCCGCTCAAAGTAACTCCTCGTAGGAGACCATC, SEQ ID NO.33) were used for PCR to obtain an sfp fragment of approximately 0.7 kb and perform PCR purification.

[0059] An optimized gene nucleic acid sequence was artificially designed based on the amino acid sequence of the putrescine transaminase patA of Salmonella typhimurium (the gene sequence is shown in SEQ ID NO.34). Using this gene fragment as a template, primers patA-F (ATTAGTTAAGTATAAGAAGGAGATATACATATGAACCGCCTTCCTTCTTCAGC, SEQ ID NO.35) and patA-R (CGGCCGATATCCAATTGAGTCACACCTCTTCCACACTGACTT, SEQ ID NO.36) were used for PCR to obtain a patA fragment of approximately 1.4 kb and perform PCR purification.

[0060] Using the Gibson Assembly kit (NEB), the above-mentioned purified CAR fragment, sfp fragment, and patA fragment were ligated into pETDuet-1 in one step (the CAR and sfp fragments were linked with RBS (AAGAAGGAGATATAC) and linked after the first T7 promoter, while the patA fragment was linked after the second T7 promoter). The obtained recombinant plasmid was named pET-CAR-patA.

[0061] The pET-CAR-patA was transformed into Escherichia coli BL21 (DE3) by thermal transformation method, and the recombinant bacteria were screened on LB plates containing 100 mg / L ampicillin and named E.c / pET-CAR-patA.

[0062] According to the amino acid sequence of adipic acid transporter DcaK of Acinetobacter baylyi, the gene nucleic acid sequence was artificially designed and optimized (the gene sequence is shown in SEQ ID NO.37). Using this gene fragment as a template and primers DcaK-F (TTTAACTTTAATAAGGAGATATACCATGCATATCCTTTCGGAAGATATTGATATGACG, SEQ ID NO.38) and DcaK-R (GAATCAATTTCTTCATGTATATCTCCTTCTTTTAGTCAGCCTTCTGGGGGTTATACA, SEQ ID NO.39), PCR was carried out to obtain a DcaK fragment of about 1.3 kb and purified by PCR.

[0063] According to the amino acid sequence of adipic acid transporter DcaP of Acinetobacter baylyi, the gene nucleic acid sequence was artificially designed and optimized (the gene sequence is shown in SEQ ID NO.40). Using this gene fragment as a template and primers DcaP-F (GCTGACTAAAAGAAGGAGATATACATGAAGAAATTGATTCTGGCGGTTGC, SEQ ID NO.41) and DcaP-R (CCGAGCTCGAATTTTAGAACTTGTACATTGAAACAAAGTTGATTCTCGAG, SEQ ID NO.42), PCR was carried out to obtain a DcaP fragment of about 1.3 kb and purified by PCR.

[0064] According to the amino acid sequence of acyl-CoA transferase DcaI of Acinetobacter baylyi, an optimized gene nucleic acid sequence was artificially designed (the gene sequence is shown in SEQ ID NO.43). Using this gene fragment as a template, primers DcaI-F (TAAGTATAAGAAGGAGATATACATATGATCAACAAAATTATTAATGACATCGAACCTATACTTAAATCG, SEQ ID NO.44) and DcaI-R (ATTGTCATGTATATCTCCTTCTTTTACTTAATATCCCCTAATCTTACCACGTGTTGA, SEQ ID NO.45) were used for PCR to obtain a DcaI fragment of about 0.7 kb and perform PCR purification.

[0065] According to the amino acid sequence of acyl-CoA transferase DcaJ of Acinetobacter baylyi, an optimized gene nucleic acid sequence was artificially designed (the gene sequence is shown in SEQ ID NO.46). Using this gene fragment as a template, primers DcaJ-F (TAGGGGATATTAAGTAAAAGAAGGAGATATACATGACAATTCAAAAGCGGTCAAGAGAG, SEQ IDNO.47) and DcaJ-R (GCCGATATCCAATTTTAGCGAAGTTGAATAAGGGATGAATATGTGC, SEQ ID NO.48) were used for PCR to obtain a DcaJ fragment of about 0.7 kb and perform PCR purification.

[0066] Using the Gibson Assembly kit (NEB), the above-purified DcaK fragment, DcaP fragment, DcaI fragment, and DcaJ fragment were ligated into pRSFDuet-1 in one step (the DcaK and DcaP fragments were linked with RBS (AAGAAGGAGATATAC) behind the first T7 promoter, while the DcaI and DcaJ fragments were linked with RBS (AAGAAGGAGATATAC) behind the second T7 promoter). The obtained recombinant plasmid was named pRSF-DcaKPIJ.

[0067] An optimized gene nucleic acid sequence was artificially designed according to the amino acid sequence of acylated succinic semialdehyde dehydrogenase sucD of Clostridium kluyveri (the gene sequence is shown in SEQ ID NO.49). Using this gene fragment as a template, primers sucD-F (TTGTTTAACTTTAATAAGGAGATATACCATGTCTAATGAGGTTTCCATAAAGGAGTTGATT, SEQ ID NO.50) and sucD-R (TGGTGATGGCTGCTTTAACCCCATATTTCCTCATAAGAAGGAACTTTTG, SEQ ID NO.51) were used for PCR to obtain a sucD fragment of about 1.4 kb and perform PCR purification.

[0068] An optimized gene nucleic acid sequence was artificially designed according to the amino acid sequence of 4-aminobutyrate aminotransferase gabT of Streptomyces avermitilis (the gene sequence is shown in SEQ ID NO.52). Using this gene fragment as a template, primers gabT-F (ATCTTAGTATATTAGTTAAGTATAAGAAGGAGATATACATATGAGCGCACTTCCGCAG, SEQID NO.53) and gabT-R (CGGCCGATATCCAATTGAGTTAGATACGGGAGAACGCCTGC, SEQ ID NO.54) were used for PCR to obtain a gabT fragment of about 1.3 kb and perform PCR purification.

[0069] The purified sucD fragment and gabT fragment obtained above were ligated into pCDFDuet-1 in one step using the Gibson Assembly kit (NEB) (the sucD fragment was ligated after the first T7 promoter, and the gabT fragment was ligated after the second T7 promoter). The resulting recombinant plasmid was named pCDF-sucD-gabT.

[0070] pRSF-DcaKPIJ and pCDF-sucD-gabT were transformed into E.c / pET-CAR-patA step by step by electroporation. Recombinant bacteria were screened on an LB plate containing 100 mg / L ampicillin, 100 mg / L spectinomycin and 50 mg / L kanamycin and named E.c / pET-CAR-patA / pRSF-DcaKPIJ / pCDF-sucD-gabT.

[0071] Example 6 Production of hexamethylenediamine by mixed fermentation of Escherichia coli with glucose The strain E.c-sucD-atoB / pRSF-paaJ-paaH / pET-paaF-ter / pCDF-Acot8 for adipic acid production constructed in Example 4 was co-cultured with the recombinant strain E.c / pET-CAR-patA / pRSF-DcaKPIJ / pCDF-sucD-gabT capable of producing hexamethylenediamine from adipic acid constructed in Example 5.

[0072] To optimize the co-culture system, in this example, two strains (adipic acid-producing strain: hexamethylenediamine-producing strain) were inoculated into the fermentation medium at initial inoculation ratios of 1:3, 1:1, and 3:1 for cultivation. The fermentation temperature was 30 °C, and the rotation speed was 250 rpm. When the cell OD reached 0.6, 0.5 mM IPTG was added for induction, and fermentation continued for 96 h.

[0073] The fermentation medium formula was (g / L): glucose 20, ammonium dihydrogen phosphate ((NH 4 ) 2 HPO 4 ) 4, potassium dihydrogen phosphate (KH 2 PO 4 ) 6.7, magnesium sulfate heptahydrate (MgSO 4 ·7H 2 O) 0.8, yeast extract 2.5, citric acid 0.8, and 5 mL of trace metal solution. The composition of the trace metal solution included (g / L): ferrous sulfate heptahydrate (FeSO 4 ·7H 2 O) 10, calcium chloride dihydrate (CaCl 2 ·2H 2 O) 2, zinc sulfate heptahydrate (ZnSO 4 ·7H 2 O) 2.2, manganese sulfate tetrahydrate (MnSO 4 ·4H 2 O) 0.5, copper sulfate pentahydrate (CuSO 4 ·5H 2 O) 1, ammonium molybdate tetrahydrate ((NH 4 ) 6 Mo 7 O 24 ·4H 2 O) 0.1, borax (Na 2 B 4 O 7 ·10H 2 O) 0.02, and glutamic acid 3.

[0074] After 96 hours of fermentation, the products of the strains were detected by high performance liquid chromatography (HPLC). The production of hexamethylenediamine could be detected in all groups, indicating that the introduced artificial pathway could successfully achieve the production of hexamethylenediamine from glucose. The accumulation amounts of hexamethylenediamine in the experimental groups with inoculation ratios of 1:3, 1:1, and 3:1 were 0.016 g / L, 0.017 g / L, and 0.005 g / L, respectively.

[0075] Although the present invention has been described in detail with general descriptions and specific embodiments above, some modifications or improvements can be made based on the present invention, which are obvious to those skilled in the art. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of the present invention claimed.

Claims

1. A recombinant microorganism, characterized in that Compared with the starting strain, the recombinant microorganism expresses β-ketoadipyl-CoA thiolase paaJ, 3-hydroxyadipyl-CoA dehydrogenase paaH, 2,3-dehydroadipyl-CoA hydratase paaF, trans-2-enoyl-CoA reductase ter and acyl-CoA thioesterase Acot8; The NCBI accession number of β-ketoadipyl-CoA thiolase paaJ is WP_001206197.1; the NCBI accession number of 3-hydroxyadipyl-CoA dehydrogenase paaH is WP_114399327.1; the NCBI accession number of 2,3-dehydroadipyl-CoA hydratase paaF is KPP80590.1; the NCBI accession number of trans-2-enoyl-CoA reductase ter is WP_002681770.1; and the NCBI accession number of acyl-CoA thioesterase Acot8 is NP_573503.

2.

2. The recombinant microorganism according to claim 1, characterized in that Compared with the starting strain, the recombinant microorganism has a reduced expression level of acylating succinic semialdehyde dehydrogenase sucD, or further, a reduced expression level of acetyl-CoA acetyltransferase atoB; The NCBI accession number of acylating succinate semialdehyde dehydrogenase sucD is WP_012103358.1; The NCBI accession number of acetyl-CoA acetyltransferase atoB is WP_000786547.

1.

3. The recombinant microorganism according to claim 2, characterized in that The encoding nucleic acid sequence of β-ketoadipyl-CoA thiolase paaJ is shown in SEQ ID NO.3; the encoding nucleic acid sequence of 3-hydroxyadipyl-CoA dehydrogenase paaH is shown in SEQ ID NO.4; the encoding nucleic acid sequence of 2,3-dehydroadipyl-CoA hydratase paaF is shown in SEQ ID NO.5; the encoding nucleic acid sequence of trans-2-enoyl-CoA reductase ter is shown in SEQ ID NO.6; the encoding nucleic acid sequence of acyl-CoA thioesterase Acot8 is shown in SEQ ID NO.7; the encoding nucleic acid sequence of acylated succinate semialdehyde dehydrogenase sucD is shown in SEQ ID NO.1; the encoding nucleic acid sequence of acetyl-CoA acetyltransferase atoB is shown in SEQ ID NO.

2.

4. The recombinant microorganism according to any one of claims 1 to 3, characterized in that The starting strain is Escherichia coli.

5. Use of the recombinant microorganism according to any one of claims 1 to 4 in fermentation production of adipic acid / hexamethylenediamine or in genetic breeding of microorganisms for producing adipic acid or in increasing the yield of biosynthesized adipic acid / hexamethylenediamine.

6. A method for producing adipic acid / hexamethylenediamine by fermentation, characterized in that: The method comprises the step of culturing the recombinant microorganism according to any one of claims 1 to 4.

7. The method according to claim 6, characterized in that When hexamethylenediamine is produced by fermentation, the method comprises the step of co-culturing the recombinant microorganism according to any one of claims 1 to 4 with a recombinant microorganism capable of producing hexamethylenediamine from adipic acid.

8. The method according to claim 7, characterized in that Compared with the starting strain, the recombinant microorganism capable of producing hexamethylenediamine from adipic acid expresses adipic acid transporters DcaK and DcaP, acyl CoA transferases DcaI and DcaJ, acylating succinic semialdehyde dehydrogenase sucD, 4-aminobutyrate aminotransferase gabT, carboxylic acid reductase CAR variant, CAR activating enzyme sfp and putrescine aminotransferase patA; The NCBI accession number of the adipic acid transporter DcaK is ENV54224.1, and the NCBI accession number of DcaP is WP_004926597.1; the NCBI accession number of the acyl CoA transferase DcaI is WP_004926591.1, and the NCBI accession number of DcaJ is WP_004926593.1; the NCBI accession number of the acylated succinic semialdehyde dehydrogenase sucD is WP_012103358.1; the NCBI accession number of the 4-aminobutyrate aminotransferase gabT is WP_010984019.1; the amino acid sequence of the carboxylic acid reductase CAR variant is shown in SEQ ID NO.55; The NCBI accession number of the putrescine aminotransferase patA is WP_001520281.1; the NCBI accession number of the CAR activating enzyme sfp is WP_003234549.1; and the starting strain is Escherichia coli.

9. The method according to claim 8, characterized in that The encoding nucleic acid sequence of the carboxylic acid reductase CAR variant is shown in SEQ ID NO.28; the encoding nucleic acid sequence of the CAR activating enzyme sfp is shown in SEQ ID NO.31; the encoding nucleic acid sequence of the putrescine transaminase patA is shown in SEQ ID NO.34; the encoding nucleic acid sequences of the adipic acid transporters DcaK and DcaP are shown in SEQ ID NOs.37 and 40, respectively; the encoding nucleic acid sequences of the acyl CoA transferases DcaI and DcaJ are shown in SEQ ID NOs.43 and 46, respectively; the encoding nucleic acid sequence of the acylated succinic semialdehyde dehydrogenase sucD is shown in SEQ ID NO.49; the encoding nucleic acid sequence of the 4-aminobutyrate transaminase gabT is shown in SEQ ID NO.

52.

10. A method for constructing a recombinant microorganism for producing adipic acid, characterized in that: The method comprises the steps of causing the starting strain to express β-ketoadipyl-CoA thiolase paaJ, 3-hydroxyadipyl-CoA dehydrogenase paaH, 2,3-dehydroadipyl-CoA hydratase paaF, trans-2-enoyl-CoA reductase ter and acyl-CoA thioesterase Acot8; Preferably, the method further comprises the step of reducing the expression level of acylating succinic semialdehyde dehydrogenase sucD of the starting strain, or further reducing the expression level of acetyl-CoA acetyltransferase atoB of the starting strain; The NCBI accession number of β-ketoadipyl-CoA thiolase paaJ is WP_001206197.1; the NCBI accession number of 3-hydroxyadipyl-CoA dehydrogenase paaH is WP_114399327.1; the NCBI accession number of 2,3-dehydroadipyl-CoA hydratase paaF is KPP80590.1; the NCBI accession number of trans-2-enoyl-CoA reductase ter is WP_002681770.1; the NCBI accession number of acyl-CoA thioesterase Acot8 is NP_573503.2; the NCBI accession number of acylated succinate semialdehyde dehydrogenase sucD is WP_012103358.1; the NCBI accession number of acetyl-CoA acetyltransferase atoB is WP_000786547.1; and the starting strain is Escherichia coli.

Images