An engineered protein glutaminase mutant and its method for active secretion expression in Pichia pastoris

By mutation of FBPG amino acid sequence and building an expression system in Pichia cerevisiae, the problem of low specific activity of protein glutaminease is solved, efficient active secretion and expression are achieved, and the needs of the food industry are met.

CN120082540BActive Publication Date: 2025-07-22SOUTH CHINA UNIV OF TECH
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510570932.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-06
Publication Date
2025-07-22
Estimated Expiration
2045-05-06

AI Technical Summary

Technical Problem

The existing protein glutamineases on the market have low specific activity and relatively low yield, which is difficult to meet the needs of the food industry, and the expression form exists in the form of zymogen, so further improvement is needed.

Method used

By mutations on the amino acid sequence of FBPG, the Kex2 cleavage site was introduced, and the expression system was constructed in Pichia cerevisiae, and the active secretion expression of engineered protein glutaminease was achieved using CRISPR/cas9 manipulation vector and Sko1 overexpression transcription factor.

Benefits of technology

The specific activity of mutant F3 was increased to 9.43 times that of wild type, achieving efficient secretion and expression in Pichia yeast, with a yield of 2610 U/L, providing a feasible application solution for the food industry.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120082540B_ABST
    Figure CN120082540B_ABST
Patent Text Reader

Abstract

The present invention discloses an engineered protein glutaminase mutant and its method for active secretion expression in Pichia pastoris. The present invention successfully improves the catalytic activity of FBPG through surface charge modification, and the specific activity of mutant F3 reaches 9.43 times that of the wild type. The secreted expression of FBPG is achieved in Pichia pastoris, and under the regulation of the P DH promoter, the active expression of FBPG is achieved by introducing the Kex2 cleavage site. After overexpressing the transcription factor Sko1, the yield of active FBPG reaches 2610 U / L in a 7 L bioreactor, providing a feasible technical solution for the application of FBPG in the food industry, and also providing new ideas and methods for the active expression of similar enzymes.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of enzyme engineering, and particularly relates to an engineered protein glutaminase mutant and a method for active secretion expression thereof in Pichia pastoris. Background Art

[0002] Protein glutaminase (PG, EC 3.5.1.44) can specifically hydrolyze glutamine groups on the side chains of proteins or peptides to generate L-glutamic acid and ammonia, and is widely used in the field of modification and processing of plant proteins. After deamidation treatment with PG, the functional properties such as solubility, emulsifying property and foaming property of various plant proteins, such as α-zein, wheat gluten protein, oat protein and coconut protein, are improved. However, the protein glutaminase on the current market has problems such as low specific activity, relatively low yield, and expression in the form of zymogen.

[0003] FBPG is a novel protein glutaminase derived from Flavobacterium sp., and shows stronger deamidation activity towards plant proteins under weakly acidic and high temperature conditions compared with commercially available protein glutaminase (CPPG), and has good industrial application potential. Research shows that the charge properties between an enzyme and a substrate will affect their binding and thus affect the catalytic activity. Therefore, increasing the charge intensity of FBPG may improve its deamidation efficiency.

[0004] Pichia pastoris is the second most commonly used protein expression system after Escherichia coli, and belongs to generally recognized as safe microorganisms (GRAS). Because of its excellent post-translational modification ability and high yield, it is widely used in recombinant protein production. Compared with Saccharomyces cerevisiae, the heterologous protein expression level of Pichia pastoris is 10-100 times higher, and it can carry out N-glycosylation modification on secreted proteins. The metabolic process of Pichia pastoris does not produce by-products such as ethanol, and it is an ideal host for methanol biotransformation and chemical synthesis. Summary of the Invention

[0005] The purpose of the present invention is to overcome the disadvantages and deficiencies of the prior art, and to provide an engineered protein glutaminase mutant.

[0006] Another purpose of the present invention is to provide a method for active secretion expression of the above-mentioned engineered protein glutaminase mutant in Pichia pastoris.

[0007] The purpose of the present invention is achieved by the following technical solutions:

[0008] An engineered protein glutaminase mutant is a protein obtained by mutating on the basis of the amino acid sequence shown in SEQ ID NO.1, and the mutation on its sequence is A203H or A203K.

[0009] The engineered protein glutaminase mutant described above has a Kex2 cleavage site sequence inserted between Q121 and K122 in its amino acid sequence.

[0010] The amino acid sequence of the Kex2 cleavage site sequence is KR*AEA, where * represents any amino acid; preferably, the amino acid sequence of the Kex2 cleavage site sequence is KRNAEA.

[0011] The nucleotide sequence of the coding gene of the engineered protein glutaminase mutant described above is obtained according to the codon coding rule.

[0012] The coding gene of the engineered protein glutaminase mutant described above is a nucleotide sequence obtained by mutating the nucleotide sequence shown in SEQ ID NO.2 using mutant primers.

[0013] The amino acid sequence of the engineered protein glutaminase mutant described above is as shown in SEQ ID NO.3.

[0014] The nucleotide sequence of the engineered protein glutaminase mutant described above is as shown in SEQ ID NO.4.

[0015] The application of the engineered protein glutaminase mutant described above in hydrolyzing proteins.

[0016] A method for constructing an engineered bacterium for active secretion and expression of an engineered protein glutaminase mutant, comprising the following steps:

[0017] Construct the expression cassette of the engineered protein glutaminase mutant onto a vector, and co-transfer it with the CRISPR / cas9 operating vector pCR-Tg into Pichia pastoris X33-Sko1 to obtain an engineered bacterium for active secretion and expression of the engineered protein glutaminase mutant.

[0018] The expression cassette of the engineered protein glutaminase mutant is assembled in sequence by a promoter DH, an α-factor secretion signal, the coding gene of the engineered protein glutaminase mutant, and a terminator AOX1T.

[0019] The nucleotide sequence of the coding gene of the engineered protein glutaminase mutant described above is as shown in SEQ ID NO.4.

[0020] The promoter DH is derived from the Pichia pastoris genome, and its nucleotide sequence is located at chromosome 4: 1221312 - 1222312 bp on the chromosome.

[0021] The nucleotide sequence of the α-factor secretion signal is as shown in the NCBI database sequence accession number AY694418.1.

[0022] The nucleotide sequence of the terminator AOX1T is as shown from position 1 to position 354 of the NCBI database sequence accession number Z46231.1.

[0023] The nucleotide sequence of the CRISPR / cas9 operating vector pCR-Tg is as shown in SEQ ID NO.17;

[0024] The nucleotide sequence of the gRNA contained in the CRISPR / cas9 operating vector pCR-Tg is:

[0025] GCAAGATGGTTAAAAGGTGA.

[0026] The Pichia pastoris X33-Sko1 is obtained by co-transforming the fragment containing the Sko1 gene expression cassette and the CRISPR / cas9 operating vector pCR-Int6 into Pichia pastoris X33, and integrating the Sko1 gene expression cassette into the genomic Int6 locus.

[0027] The Sko1 gene expression cassette is composed of the AOX1 promoter, the Sko1 gene, and the terminator AOX1T assembled in sequence.

[0028] The promoter AOX1 is derived from the Pichia pastoris genome, and its nucleotide sequence is located at chromosome 4: 1549745 - 1550681 bp.

[0029] The nucleotide sequence of the Sko1 gene is as shown in the sequence with locus_tag labeled as PAS_chr1-3_0232 in the NCBI database sequence accession number SAMEA2272385.

[0030] The CRISPR / cas9 operating vector pCR-Int6 is obtained by replacing the gRNA of pCR-Tg with gRNA-Int6.

[0031] The nucleotide sequence of the gRNA-Int6 is:

[0032] CAACTCGAATTATAGTGGCG.

[0033] The nucleotide sequence of the Pichia pastoris genome is as shown in the NCBI database sequence accession number SAMEA2272385.

[0034] An engineered bacterium for active secretion and expression of the engineered protein glutaminase mutant is constructed by the above construction method.

[0035] Use of the engineered bacterium for actively secreting and expressing the engineered protein glutaminase mutant in the production of the engineered protein glutaminase mutant.

[0036] A method for actively secreting and expressing an engineered protein glutaminase mutant, comprising the following steps:

[0037] Inoculate the engineered bacterium for actively secreting and expressing the engineered protein glutaminase mutant in a fermenter, induce fermentation, separate and purify to obtain the engineered protein glutaminase mutant.

[0038] The specific conditions for the fermentation are as follows:

[0039] The fermentation temperature is controlled at 30 °C, the ventilation rate is 6 L / min, and the dissolved oxygen is controlled at 30% by adjusting the rotation speed; after 20 h of fermentation, glycerol containing 12 mL / L PMT1 is added at a rate of 25 mL / h until the wet weight reaches 180 g / L; subsequently, the Pichia pastoris is starved for 0.5 h and the temperature is reduced to 25 °C. Then, methanol containing 12 mL / L PMT1 is added for induced fermentation for 120 h, and the flow rate from 0 to 4 h is 5 mL / h, and the flow rate from 4 to 120 h is 12 mL / h.

[0040] The present invention has the following advantages and effects compared with the prior art:

[0041] The present invention successfully improves the catalytic activity of FBPG through surface charge modification, and the specific activity of mutant F3 reaches 9.43 times that of the wild type. The secretory expression of FBPG is achieved in Pichia pastoris, and under the regulation of the P DH promoter, the active expression of FBPG is achieved by introducing the Kex2 cleavage site. After overexpressing the transcription factor Sko1, the yield of active FBPG reaches 2610 U / L in a 7 L bioreactor, providing a feasible technical solution for the application of FBPG in the food industry, and also providing new ideas and methods for the active expression of similar enzymes. Description of the Drawings

[0042] Figure 1 It is the experimental results of the expression and identification of the mutant in Example 2; wherein A and B are the wild type WT, and the SDS-PAGE analysis of the zymogen and mature peptide of mutants R225K, F3 and F4; C is the SDS-PAGE analysis of mutants F1, F2, F5 and F6; D is the specific enzyme activity of the mutants with increased positive charge.

[0043] Figure 2It shows the effects of different promoters on the expression of mutant F3 in Pichia pastoris in Example 3; where A is the expression level of mutant F3 under different promoters; B is the SDS-PAGE analysis; C is the Western blot analysis.

[0044] Figure 3 It is a schematic diagram of the integration of the CRISPR / Cas9 system gene expression cassette into the Pichia pastoris genome.

[0045] Figure 4 It is the result diagram of the experiment for optimizing the Kex2 cleavage site in Example 4; where A is the cleavage site of Kex2; B is the effect of the P1' residue of the Kex2 cleavage site on the expression of active mutant F3. Indigestive means not activated with trypsin; Digestive means activated with trypsin; Control means FBPG-F3 without the introduction of the Kex2 cleavage site.

[0046] Figure 5 It shows the effects of overexpressing different regulatory factors on the expression of FBPG-F3 in Example 5.

[0047] Figure 6 It is the growth and FBPG-F3 production curves of strain X33-Sko1 / F3-Kex2-E124 in a 7 L bioreactor in Example 6. Detailed implementation manners

[0048] The present invention will be further described in detail below in conjunction with examples and the accompanying drawings, but the implementation manners of the present invention are not limited thereto.

[0049] If the specific test conditions are not indicated in the following implementation manners, they are usually in accordance with the conventional test conditions or the test conditions recommended by the reagent company. The materials, reagents, etc. used, unless otherwise specified, are all reagents and materials obtained from commercial channels.

[0050] Example 1 Experimental materials and methods

[0051] 1.1 Experimental materials

[0052] Plasmids, strains and media: The Pichia pastoris X33 strain was purchased from Invitrogen; the plasmid pET22b(+)-FBPG / R205K was derived from the literature (Long, Y., Peng, S., Zhou, Y., Zhang, H., Zhao, G., & Wang, Y. (2024). Structural analysis of marine flavobacterium protein glutaminase reveals a “gatekeeper” residue affecting its catalytic activity. Journal of Agricultural and Food Chemistry, 72(49), 27504-27512. https: / / doi.org / 10.1021 / acs.jafc.4c04471), the pCR-Tg (gRNA: 5’-GCAAGATGGTTAAAAGGTGA-3’) for gRNA-Cas9 expression and the donor DNA plasmid pDTEF have been disclosed in the literature “Shi, X. N. One-step integration method of multiple genes in Pichia pastoris based on CRISPR technology [D]. East China University of Science and Technology, 2019. DOI: 10.27148 / d.cnki.ghagu.2019.000117.”, corresponding to pPIC3.5K-PTEF1up-gRNA1 and pDGG-PTg1 therein respectively; the Escherichia coli TOP10 / BL21 competent cells were purchased from Shanghai Sangon Biotech Co., Ltd. The media used in the experiments included LB medium, LLB medium, YPD medium, BMMY medium, BSM medium, etc., and their specific formulations are as follows:

[0053] LB medium: It contains 10 g of tryptone, 5 g of yeast extract and 10 g of NaCl per liter.

[0054] LLB medium: The NaCl content in LB medium is halved.

[0055] YPD medium: It contains 20 g of tryptone, 10 g of yeast extract and 10 g of glucose per liter.

[0056] BMMY medium: It contains 20 g of peptone, 10 g of yeast extract, 3.4 g of YNB, 10 g of (NH4)2SO4 per liter. The solid medium is supplemented with 15 g / L of agar on the basis of the above medium.

[0057] BSM medium: per liter contains 26.7 mL of H3PO4, 0.93 g of CaSO4, 18.2 g of K2SO4, 14.9 g of MgSO4・7H2O, 4.13 g of KOH, 40 g of glycerol, 4.35 mL of PTM1. The PTM1 formula is: per liter contains 6 g of CuSO4・5H2O, 0.08 g of NaI, 3 g of MnSO4・H2O, 0.2 g of Na2MoO4・2H2O, 0.02 g of H3BO3, 0.5 g of CoCl2, 20 g of ZnCl2, 65 g of FeSO4・7H2O, 0.2 g of biotin and 5 mL of H2SO4.

[0058] 1.2 Molecular biology techniques

[0059] Primers for cloning construction were designed using SnapGene software. When performing PCR amplification with plasmid as the template, PrimeSTAR® Max DNA Polymerase (Takara) was used; when using genomic DNA as the template, PrimeSTAR® HS DNA Polymerase (Takara) was used. The PCR products were treated with QuickCut™ DpnI (TaKaRa) to remove the template and recovered using the SanPrepColumn PCR Product Purification Kit (Shanghai Sangon Biotech Co., Ltd.). The target fragments were ligated to the vector using the Hipro DNA Assembly Cloning Kit (EnzyValley).

[0060] 1.3 Protein expression and purification methods

[0061] The method for protein expression and purification in Escherichia coli refers to the method in Chinese Patent CN118109442A. For Pichia pastoris shake flask fermentation, 0.5 mL of the bacterial solution was inoculated into 50 mL of BMMY medium and cultured at 30 °C and 220 rpm for 24 h, then the temperature was lowered to 25 °C, and 0.5 mL of methanol was added every 12 h to induce fermentation for 48 h.

[0062] 1.4 FBPG enzyme activity assay method

[0063] The activity assay of purified FBPG enzyme refers to the method in Chinese invention patent CN118109442A. The fermentation broth needs to be pretreated before detection. Take 10 mL of fermentation supernatant and add it to a 10 kDa ultrafiltration tube, centrifuge at 4000×g for 25 min, and wash three times with Buffer A (20 mM Na2HPO4 / NaH2PO4, pH 7) to fully remove the interference of residual NH4⁺ in the fermentation broth. When FBPG is directly secreted and expressed in an active form, no trypsin activation is required.

[0064] 1.5 SDS - PAGE and Western blotting analysis experimental methods

[0065] Use a 12.5% SDS - PAGE Color Preparation kit (Shanghai Sangon Biotech Co., Ltd.) to prepare the gel for electrophoresis analysis, and perform electrophoresis at 120 V for 80 min. Western blotting analysis uses a Western detection kit (Beyotime). The specific operation refers to the kit instruction manual, and finally use a DAB Horseradish Peroxidase Color Development Kit (Beyotime) for color development.

[0066] Example 2 Construction and expression of mutants

[0067] 2.1 Construction of mutant plasmids

[0068] In previous studies, our research group constructed a mutant FBPG enzyme R205K, which improved its enzyme activity to a certain extent. To further enhance its performance, in this example, experiments were conducted on other different mutation sites. Based on the constructed mutant R205K, three sites D161, A203, and Y206 were selected for mutation to construct mutants D161K / R205K (F1), D161H / R205K (F2), A203H / R205K (F3), A203K / R205K (F4), R205K / Y206H (F5), and R205K / Y206K (F6); The primer design and molecular biology experimental methods refer to the steps in 1.2 of Example 1. Using pET22b(+) - FBPG / R225K as the template, mutants F1 - F6 were obtained by PCR amplification with mutant primers.

[0069] Table 1 Correspondence table of mutants, their mutant amino acids, and mutant codons

[0070]

[0071] 2.2 Expression and Identification of Mutants

[0072] Referring to the method in 1.3 of Example 1, the mutant plasmid constructed in 2.1 was transferred into Escherichia coli for expression. The fermentation broth was purified and identified to obtain enzyme solution. The SDS-PAGE identification results are as shown in Figure 1 A; after digestion with trypsin, the leader peptide was removed, as shown in Figure 1 B. The experimental results showed that mutants F3 and F4 were successfully expressed to obtain mutant proteins, while mutants F1, F2, F5, and F6 formed inclusion bodies ( Figure 1 C), and the target protein could not be obtained.

[0073] Referring to the method in 1.4 of Example 1, the enzyme activity of the expressed enzyme solution was detected. The experimental results are as shown in Figure 1 D. The experimental results showed that the specific enzyme activity of mutant F3 reached 15.18 U / mg, which was 9.43 times that of the wild type.

[0074] Example 3 Improving the Expression Level of Mutants by Optimizing Promoters in Pichia pastoris

[0075] 3.1 Construction of Promoter-Related Plasmids

[0076] The promoter sequence was amplified from the Pichia pastoris genome (SAMEA2272385) using primers, and fused by overlap extension PCR in the order of promoter, α-factor secretion signal (AY694418.1), FBPG-F3 (the gene of mutant F3 in Example 2), and AOX1T terminator (Z46231.1:1-354) to construct the FBPG expression cassette. Then the expression cassette was inserted between the upstream and downstream homologous arms of 1000 bp in plasmid pDTEF at the Spe Ⅰ and Apa Ⅰ restriction sites to obtain the expression cassette donor plasmid with different promoters fused to FBPG-F3.

[0077] Table 2 Gene Information of Promoters

[0078]

[0079] 3.2 Shake Flask Fermentation

[0080] Using the promoter donor plasmid prepared in 3.1 as a template, the inserted fragment was amplified using primers DTFX-F and DTFX-R, mixed with the gRNA-Cas9 plasmid pCR-Tg, and then transferred into Pichia pastoris by electroporation to integrate the FBPG expression cassette into the Pichia pastoris genome. Then, the expression and detection were carried out referring to the method in Example 1.

[0081] DTFX-F: 5'-CTATGACCATGATTACGAATTCGAGCT-3';

[0082] DTFX-R: 5'- TGCCTGCAGGTCGACTCTAG-3'.

[0083] The experimental results showed that P DH The driving mutant F3 had the highest expression level, reaching 0.25 U / mL ( Figure 2 in A), and SDS-PAGE and Western blotting analyses also proved that P DH regulated the highest expression level of mutant F3 ( Figure 2 in B and C in 2). These results indicated that the expression effect of P DH was better than that of P AOX1 , P GAP and other common promoters in Pichia pastoris.

[0084] Example 4 Optimizing the residue at the P1' position of the Kex2 cleavage site to improve enzyme activity

[0085] 4.1 Construction of plasmids related to the Kex2 cleavage site

[0086] The FBPG enzyme usually needs to remove the leader peptide with trypsin to activate its activity. To simplify this step, in this example, by introducing the Kex2 cleavage site, its activity can be activated without trypsin treatment after expression. The specific steps are as follows:

[0087] Using the donor plasmid pDTEF-DH-F3 with the DH promoter obtained in Example 3 as the starting plasmid, the Kex2 cleavage site (KREAEA) was inserted between Q121 and K122 of FBPG through the primers Kex2-F / Kex2-R. Then, using this plasmid pDTEF-DH-F3-Kex2 as the template, a mutant primer pair was designed to perform saturation mutagenesis on the P1' site to construct the Kex2 mutant plasmid. The specific mutant amino acids and codons are shown in Table 3.

[0088] Kex2-F: CAGAAACGTGAAGCGGAGGCGAAAGCGAGCAGCTTCGATTTCA;

[0089] Kex2-R: TTTCGCCTCCGCTTCACGTTTCTGGGTGGACACTTTGCGG.

[0090] Table 3 Corresponding table of mutant amino acids and mutant codons at the P1' position of the Kex2 cleavage site

[0091]

[0092] 4.2 Shake flask fermentation

[0093] Referring to the method in 3.2 of Example 3, the Kex2 mutant plasmid constructed in 4.1 was transformed into Pichia pastoris by electroporation, and positive clones were screened for shake flask fermentation and enzyme activity detection. The experimental results are as Figure 4 shown. By introducing a Kex2 cleavage site between the FBPG propeptide and the mature peptide, the expression of active FBPG was successfully achieved. In addition, the results of saturation mutagenesis showed that when the residue at the P1' position of the Kex2 cleavage site was N, the expression level of active FBPG was the highest, reaching 0.16 U / mL. Therefore, the optimal Kex2 cleavage site for FBPG is KRNAEA.

[0094] Example 5 Overexpression of regulatory factors to increase expression level

[0095] 5.1 Construction of regulatory factor overexpression plasmid

[0096] The highly efficient integration site Int6 in Pichia pastoris reported in the reference (J. Gao, J. Xu, Y. Zuo, C. Ye, L. Jiang, L. Feng, L. Huang, Z. Xu, J. Lian, Synthetic biology toolkit for marker-less integration of multigene pathways into Pichia pastoris via CRISPR / Cas9, ACS Synth. Biol. 11 (2022) 623–633. https: / / doi.org / 10.1021 / acssynbio.1c00307.) was used as a template for pCR-Tg, and primers were designed to amplify by PCR to replace the gRNA, obtaining the gRNA-Cas9 plasmid pCR-Int6 (gRNA: 5’-CAACTCGAATTATAGTGGCG-3’). Primers were used to PCR amplify the coding genes of Pbs2 (locus_tag: PAS_chr1-3_0267), Sko1 (locus_tag: PAS_chr1-3_0232), Hot1 (locus_tag: PAS_chr1-1_0149), Hot2 (locus_tag: PAS_chr1-1_0105), and Hog1 (locus_tag: PAS_chr1-1_0165) from the Pichia pastoris genome respectively, and the corresponding regulatory factor expression cassettes were constructed with the AOX1 promoter and the AOX1T terminator. The upstream and downstream 1000 bp of the Int6 integration site were amplified from the Pichia pastoris genome as homologous arms by primers Int6up-F / Int6up-R and Int6down-F / Int6down-R respectively. They were constructed onto the pDTEF vector linearized by primers pDTFX-F / pDTFX-R PCR in the order of upstream homologous arm, regulatory factor expression cassette, and downstream homologous arm by seamless cloning to obtain a series of corresponding regulatory factor donor plasmids.

[0097] Table 4 Primers related to the construction of regulatory factor expression cassettes

[0098]

[0099] 5.2 Expression and identification

[0100] Using the regulatory factor donor plasmid prepared in 5.1 as a template, the insertion fragment was amplified using primers DTFX-F and DTFX-R. After mixing with the gRNA-Cas9 plasmid pCR-Int6, it was transferred into Pichia pastoris by electroporation. The FBPG expression cassette was integrated into the Pichia pastoris genome, and Pichia pastoris with overexpressed transcription factors was screened. Subsequently, it was made into competent cells, and then the FBPG-F3-Kex2-E124N expression cassette was integrated into the Pichia pastoris genome according to the method described in 3.1, and expression and detection were carried out according to the method in Example 1.

[0101] The experimental results showed that overexpression of Sko1, Pbs2, and Hot1 promoted the expression of FBPG-F3. When Sko1 was overexpressed, the expression level of F3 increased by 1.5 times, and the proportion of active F3 increased to 60% ( Figure 5 ). Therefore, the strain X33-Sko1 / F3-Kex2-E124N corresponding to Sko1 overexpression was selected as the optimal strain for FBPG production.

[0102] Example 6 Bioreactor Cultivation

[0103] Pichia pastoris was amplified in a 7 L fermenter to produce FBPG. The seed liquor cultured for 16 h was inoculated into a 7 L fermenter containing 3 L of BSM medium at an inoculation amount of 10% (v / v). The fermentation temperature was controlled at 30 °C, the aeration rate was 6 L / min, and the dissolved oxygen was controlled at 30% by adjusting the rotation speed. After 20 h of fermentation, glycerol containing 12 mL / L PMT1 was added at a rate of 25 mL / h until the wet weight reached 180 g / L. Subsequently, Pichia pastoris was starved for 0.5 h and the temperature was reduced to 25 °C. Then, methanol containing 12 mL / L PMT1 was added for induced fermentation for 120 h, with a flow rate of 5 mL / h from 0 to 4 h and a flow rate of 12 mL / h from 4 to 120 h. Samples were taken every 24 h for OD 600 、wet weight, and enzyme activity analysis.

[0104] The experimental results showed that when the strain X33-Sko1 / F3-Kex2-E124N was fermented in a 7 L bioreactor, the cell wet weight reached 443 g / L after 144 h, the OD 600 value reached 431, the expression level of active F3 was 2610 U / L, and FBPG-F3 in the bioreactor was completely expressed in the active form ( Figure 6 ).

[0105] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement methods and are all included in the protection scope of the present invention.

Claims

1. An engineered protein glutaminase mutant, characterized in that: It is a protein obtained by mutating on the basis of the amino acid sequence shown in SEQ ID NO.1, and the mutation on the sequence is A203H or A203K.

2. An engineered protein glutaminase mutant, characterized in that: It is a protein obtained by mutating on the basis of the amino acid sequence shown in SEQ ID NO.1, and the mutation on the sequence is A203H or A203K; A Kex2 cleavage site sequence is inserted between Q121 and K122 in its amino acid sequence; The amino acid sequence of the Kex2 cleavage site sequence is KRNAEA.

3. The engineered protein glutaminase mutant according to claim 1, characterized in that: The coding gene of the engineered protein glutaminase mutant is a nucleotide sequence obtained by mutating using a mutant primer on the basis of the nucleotide sequence shown in SEQ ID NO.

2.

4. The engineered protein glutaminase mutant according to claim 2, characterized in that: The amino acid sequence of the engineered protein glutaminase mutant is as shown in SEQ ID NO.3; The nucleotide sequence of the engineered protein glutaminase mutant is as shown in SEQ ID NO.

4.

5. Use of the engineered protein glutaminase mutant according to any one of claims 1 to 4 in hydrolyzing proteins.

6. A method for constructing an engineered bacterium that actively secretes and expresses an engineered protein glutaminase mutant, characterized in that Comprising the following steps: Construct the engineered protein glutaminase mutant expression cassette onto a vector, and co-transfer it into Pichia pastoris X33-Sko1 together with the CRISPR / cas9 operating vector pCR-Tg to obtain an engineered bacterium that actively secretes and expresses the engineered protein glutaminase mutant; The engineered protein glutaminase mutant expression cassette is assembled in sequence by a promoter DH, an α-factor secretion signal, the coding gene of the engineered protein glutaminase mutant, and a terminator AOX1T; The nucleotide sequence of the coding gene of the engineered protein glutaminase mutant is as shown in SEQ ID NO.

4.

7. The construction method of the engineered bacterium that actively secretes and expresses the engineered protein glutaminase mutant according to claim 6, characterized in that: The promoter DH is derived from the Pichia pastoris genome, and its nucleotide sequence position on the chromosome is chromosome4: 1221312 - 1222312 bp; The nucleotide sequence of the α-factor secretion signal is as shown in the NCBI database sequence accession number AY694418.1; The nucleotide sequence of the terminator AOX1T is as shown from the 1st to the 354th position of the NCBI database sequence accession number Z46231.1; The nucleotide sequence of the CRISPR / cas9 operating vector pCR-Tg is as shown in SEQ ID NO.17; The nucleotide sequence of the gRNA contained in the CRISPR / cas9 operating vector pCR-Tg is: GCAAGATGGTTAAAAGGTGA.

8. The method for constructing an engineered bacterium for active secretion and expression of an engineered protein glutaminase mutant according to claim 6, wherein: The Pichia pastoris X33-Sko1 is obtained by co-transforming a fragment containing the Sko1 gene expression cassette and the CRISPR / cas9 operation vector pCR-Int6 into Pichia pastoris X33, and integrating the Sko1 gene expression cassette into the genomic Int6 locus. The Sko1 gene expression cassette is composed of an AOX1 promoter, an Sko1 gene, and a terminator AOX1T assembled in sequence. The promoter AOX1 is derived from the Pichia pastoris genome, and its nucleotide sequence is located at chromosome 4: 1549745 - 1550681 bp on the chromosome. The nucleotide sequence of the Sko1 gene is as shown in the sequence with locus_tag labeled PAS_chr1-3_0232 in the NCBI database sequence accession number SAMEA2272385. The nucleotide sequence of the terminator AOX1T is as shown from the 1st to the 354th position in the NCBI database sequence accession number Z46231.

1. The CRISPR / cas9 operation vector pCR-Int6 is obtained by replacing the gRNA of pCR-Tg with gRNA-Int6. The nucleotide sequence of the gRNA-Int6 is: CAACTCGAATTATAGTGGCG.

9. An engineered bacterium for active secretion and expression of an engineered protein glutaminase mutant, characterized in that Obtained by the construction method according to any one of claims 6 to 8.

10. Use of the engineered bacterium for active secretion and expression of an engineered protein glutaminase mutant according to claim 9 in the production of an engineered protein glutaminase mutant.

Citation Information

Patent Citations

  • Protein glutaminase mutant and application thereof

    CN118109442A