Application of a transcription factor or its encoding gene in regulating plant growth and nitrogen level and / or nitrogen utilization

Abstract

The present invention provides an application of a transcription factor or its encoding gene in regulating plant growth and nitrogen levels and / or nitrogen utilization, belonging to the field of biotechnology. The present invention provides an application of a corn bHLH118 transcription factor or its encoding gene in at least one of the following: 1) regulating plant nitrogen levels and / or nitrogen utilization; 2) regulating plant growth. bHLH118 The expression level of the gene will respond to changes in nitrate nitrogen. bHLH118 The gene inhibits corn growth under high nitrogen conditions, reduces nitrogen levels in corn, and mutates corn bHLH118 The gene promotes maize growth under high nitrogen conditions and increases nitrogen levels in maize. In summary, the maize bHLH118 transcription factor or its encoding gene has important value in regulating plant nitrogen levels and / or nitrogen utilization.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular relates to the application of a transcription factor or a gene encoding the transcription factor in regulating plant growth and nitrogen levels and / or nitrogen utilization. Background Art

[0002] Nitrate nitrogen is the main form of nitrogen absorbed and utilized by plants, and has a crucial impact on plant growth and crop yield. When crops lack nitrogen, it can cause yellowing of leaves, reduced chlorophyll and protein content, and stunted plant growth, resulting in short plants and reduced yields. In agricultural production, excessive nitrogen fertilizer application is often used to ensure food quality. While it is undeniable that nitrogen fertilizer application can increase crop yields to a certain extent, excessive nitrogen fertilizer application can lead to premature growth, delayed maturation, smaller root systems, and environmental pollution such as soil acidification. Therefore, improving nitrogen fertilizer utilization efficiency is crucial for nitrogen management in agricultural ecosystems.

[0003] Nitrogen signal regulatory molecules in plants closely affect the plant's related metabolic processes such as nitrogen absorption, transport, reduction, assimilation and reactivation. Regulating plant nitrogen absorption and utilization through molecular biological pathways is an effective method, but there are currently few reports on signal regulatory molecules that regulate plant nitrogen absorption and utilization. Summary of the Invention

[0004] In view of this, the present invention provides a maize bHLH118 transcription factor or a gene encoding the maize bHLH118 transcription factor ( ZmbHLH118 ) in regulating plant growth and nitrogen levels and / or nitrogen utilization.

[0005] In order to achieve the above object, the present invention provides the following technical solutions:

[0006] The present invention provides a use of a maize bHLH118 transcription factor or a gene encoding the maize bHLH118 transcription factor in at least one of the following:

[0007] 1) Regulating plant nitrogen levels and / or nitrogen utilization;

[0008] 2) Regulate plant growth.

[0009] The present invention provides an application of an agent for promoting overexpression of a corn bHLH118 transcription factor or a gene encoding the corn bHLH118 transcription factor in reducing plant nitrogen levels and / or inhibiting plant growth.

[0010] The present invention provides an application of an agent for inhibiting the biological function of a maize bHLH118 transcription factor or inhibiting the expression level of a gene encoding a maize bHLH118 transcription factor in improving plant nitrogen levels and / or promoting plant growth.

[0011] Preferably, the plant nitrogen level includes the total nitrogen concentration and / or total nitrogen content of the plant.

[0012] Preferably, the plant growth includes one or more of the aboveground fresh weight, aboveground dry weight, belowground fresh weight, and belowground dry weight of the plant.

[0013] The present invention provides a method for regulating plant nitrogen levels and / or regulating plant growth, wherein a gene encoding a maize bHLH118 transcription factor or a derivative comprising a gene encoding a maize bHLH118 transcription factor is introduced into a plant and overexpressed to reduce plant nitrogen levels and / or inhibit plant growth;

[0014] Mutating the gene encoding the maize bHLH118 transcription factor increases plant nitrogen levels and / or promotes plant growth.

[0015] Preferably, the nitrogen concentration in the growth environment of the plant is above 2 mM.

[0016] Preferably, the nitrogen includes ammonium salt and / or nitrate.

[0017] Preferably, the reagent for detecting the expression level of the gene encoding the maize bHLH118 transcription factor comprises a forward primer qF having a nucleotide sequence as shown in SEQ ID NO: 1 and a reverse primer qR having a nucleotide sequence as shown in SEQ ID NO: 2.

[0018] Preferably, the plant comprises corn.

[0019] Compared with the prior art, the present invention has the following advantages:

[0020] The present invention provides a use of a maize bHLH118 transcription factor or a gene encoding the maize bHLH118 transcription factor in at least one of the following: 1) regulating plant nitrogen levels and / or nitrogen utilization; 2) regulating plant growth. The present invention demonstrates that the ZmbHLH118 transcription factor is localized in the cell nucleus and clarifies that ZmbHLH118 Spatiotemporal expression of genes during the seedling stage ZmbHLH118 The gene is highly expressed in roots during the jointing, silking and grain filling stages. ZmbHLH118 The gene was highly expressed in leaves. ZmbHLH118 Gene expression responds to changes in nitrate nitrogen at the transcriptional level, and low nitrogen levels induce ZmbHLH118 Expression, corn bHLH118 Gene expression is transiently induced by high nitrogen treatment. ZmbHLH118 The gene plays an important role in regulating nitrogen levels and growth in maize. ZmbHLH118Under high nitrogen conditions, the gene reduces nitrogen levels in maize, inhibiting growth. Mutating ZmbHLH118, however, increases nitrogen levels and promotes growth. In summary, the maize bHLH118 transcription factor or its encoding gene can regulate plant growth, nitrogen levels, and / or nitrogen utilization, and has potential value in breeding and improvement.

[0021] The present invention provides a method for regulating plant nitrogen levels and / or plant growth. The gene encoding the maize bHLH118 transcription factor or a derivative thereof is introduced into a plant and overexpressed to reduce plant nitrogen levels and / or inhibit plant growth. The gene encoding the maize bHLH118 transcription factor is mutated to increase plant nitrogen levels and / or promote plant growth. The results of the examples of the present invention show that ZmbHLH118 Genes respond to changes in nitrate at the transcriptional level, and ZmbHLH118 Overexpression of the gene can reduce nitrogen levels in corn, inhibit corn growth, and cause mutations ZmbHLH118 The gene increases nitrogen levels in corn and promotes corn growth. The method of the present invention provides a new way to regulate nitrogen levels and / or regulate plant growth. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 for ZmbHLH118 The spatiotemporal expression of ZmbHLH118 and the subcellular localization results are shown in Figure 1, where (A) is the maize seedling stage. ZmbHLH118 The spatiotemporal expression results of ; (B) is the corn silking period ZmbHLH118 The spatiotemporal expression results of ; (C) is the corn jointing stage ZmbHLH118 The spatiotemporal expression results of ; (D) is the maize filling period ZmbHLH118 The spatiotemporal expression results of (A) to (D) R: root; AR: aerial root; T: root tip; B: base; S: aboveground part / stem; L: leaf; H: bract; F: female ear; M: male ear, ZmbHLH118 The expression level in the root at each stage was set as 1; (E) is the subcellular localization result of ZmbHLH118;

[0023] Figure 2 for ZmbHLH118 The results of the transcriptional level analysis of maize under nitrogen deficiency conditions are shown in Figure 2, where (A) shows the transcriptional level of maize under nitrogen deficiency conditions. ZmbHLH118 (B) is the expression level results of maize under nitrogen induction conditions. ZmbHLH118 The expression level results of ZmTUB As an internal reference gene, the expression level of the first column in each figure was set to 1; ns indicates that there is no significant difference in the results, and * indicates that the significance analysis result is P <0.05, ** indicates the significant analysis results are P<0.01, *** indicates the significant analysis results are P <0.001;

[0024] Figure 3 Figure 2 is the result of physiological phenotype analysis of ZmbHLH118 overexpression materials; (A) is the growth phenotype of ZmbHLH118 overexpression materials under low nitrogen conditions; (B) is the growth phenotype of ZmbHLH118 overexpression materials under high nitrogen conditions, and the scale bar in (A) and (B) is 20 cm; (C) is the identification result of ZmbHLH118 overexpression strains; (D) is the fresh weight of the aboveground and underground parts of ZmbHLH118 overexpression materials under high and low nitrogen conditions; (E) is the dry weight of the aboveground and underground parts of ZmbHLH118 overexpression materials under high and low nitrogen conditions; (F) is the total nitrogen concentration of the aboveground and underground parts of ZmbHLH118 overexpression materials under high and low nitrogen conditions; (G) is the total nitrogen content of the aboveground and underground parts of ZmbHLH118 overexpression materials under high and low nitrogen conditions; different letters indicate significant differences at P < 0.05;

[0025] Figure 4 Figure 2 shows the physiological phenotype results of ZmbHLH118 mutant materials under high and low nitrogen conditions, where (A) is the growth phenotype of ZmbHLH118 mutant strains under low nitrogen conditions; (B) is the growth phenotype of ZmbHLH118 mutant strains under high nitrogen conditions, and the scale bar in (A) and (B) is 20 cm; (C) is the fresh weight of the aboveground and underground parts of ZmbHLH118 mutant strains under high and low nitrogen conditions; (D) is the dry weight of the aboveground and underground parts of ZmbHLH118 mutant strains under high and low nitrogen conditions; (E) is the total nitrogen concentration of the aboveground and underground parts of ZmbHLH118 mutant strains under high and low nitrogen conditions; (F) is the total nitrogen content of the aboveground and underground parts of ZmbHLH118 mutant strains under high and low nitrogen conditions; (G) is the identification of ZmbHLH118 mutant strain materials, and different letters represent P <0.05 has significant difference. DETAILED DESCRIPTION

[0026] The present invention provides a use of a maize bHLH118 transcription factor or a gene encoding the maize bHLH118 transcription factor in at least one of the following: 1) regulating plant nitrogen levels and / or nitrogen utilization; 2) regulating plant growth.

[0027] In the present invention, overexpression of the corn bHLH118 transcription factor or the gene encoding the corn bHLH118 transcription factor reduces plant nitrogen levels and / or inhibits plant growth, and inhibiting the biological function of the corn bHLH118 transcription factor or inhibiting the expression level of the gene encoding the corn bHLH118 transcription factor increases plant nitrogen levels and / or promotes plant growth.

[0028] In the present invention, the gene accession number of the corn bHLH118 transcription factor is GRMZM2G061906. ZmbHLH118 The results of spatiotemporal expression showed that ZmbHLH118 It is expressed in different degrees in various growth stages and tissue parts of corn. ZmbHLH118 It is mainly expressed in roots, and is more highly expressed in leaves after the silking stage; the subcellular localization results of the ZmbHLH118 transcription factor show that ZmbHLH118 is localized in the cell nucleus. In the embodiment of the present invention, the skeleton vector used for subcellular localization preferably includes Puc19-GFP; the receptor bacteria of the recombinant bacteria used for subcellular localization include DH5α or GV3101. To illustrate the application of the corn bHLH118 transcription factor or the coding gene of the corn bHLH118 transcription factor in regulating plant growth, plant nitrogen level and / or nitrogen utilization, one embodiment of the present invention detects the effect of nitrogen level in the environment on plant growth, plant nitrogen level and / or nitrogen utilization. ZmbHLH118 The results showed that the effect of gene expression ZmbHLH118 The expression level of nitric nitrogen in the environment responds to changes. ZmbHLH118 The expression of the gene was significantly induced by nitrogen deficiency, increasing to 1.48 times, 1.95 times, and 1.63 times after 1, 2, and 4 days of nitrogen deficiency, respectively. Furthermore, after 4 days of nitrogen deficiency, the supply of nitrate nitrogen was restored. ZmbHLH118 The gene expression level was significantly transiently induced by the restoration of nitrate nitrogen supply, increasing to about 3 times the level before supply 1 hour after the restoration of supply, and then showed a downward trend, returning to the level before supply 12 hours later. ZmbHLH118 Gene expression responds to changes in nitrate nitrogen. ZmbHLH118 Genes can regulate plant nitrogen levels and nitrogen utilization, regulate plant growth, and overexpress corn bHLH118 The gene inhibits corn growth under high nitrogen conditions, reduces nitrogen levels in corn, and mutates corn bHLH118 The gene promotes corn growth under high nitrogen conditions and increases the nitrogen level in corn. ZmbHLH118 Genes can regulate plant growth as well as nitrogen levels and / or nitrogen utilization.

[0029] The present invention provides an application of an agent for promoting overexpression of a corn bHLH118 transcription factor or a gene encoding the corn bHLH118 transcription factor in reducing plant nitrogen levels and / or inhibiting plant growth.

[0030] In one embodiment of the present invention, wild-type plants (ND101) and ZmbHLH118 overexpressing plants (OE1 and OE2) were used as materials to detect ZmbHLH118The effects of the gene on maize plant nitrogen levels and growth were investigated. Results showed that, when the nitrogen source was 4 mM KNO₃, the two ZmbHLH118 transgenic overexpressing plants had aboveground total nitrogen concentrations reduced by 10% and 13%, and total nitrogen contents reduced by 67% and 61% compared to wild-type plants. Furthermore, the two ZmbHLH118 transgenic overexpressing plants exhibited weaker growth and lower fresh and dry weights. These results suggest that overexpression of the maize bHLH118 transcription factor or encoding gene reduces plant nitrogen levels and / or inhibits plant growth.

[0031] The present invention provides an application of an agent for inhibiting the biological function of a maize bHLH118 transcription factor or inhibiting the expression level of a gene encoding a maize bHLH118 transcription factor in improving plant nitrogen levels and / or promoting plant growth.

[0032] In one embodiment of the present invention, wild-type plants (B73) and ZmbHLH118 mutant plants ( zmbhlh118-ems ) for materials, testing ZmbHLH118 The results showed that when the nitrogen source was 4 mM KNO3, zmbhlh118-ems Compared with the wild type (B73), the total nitrogen content of the aboveground part of the strain increased significantly by 26%, and the total nitrogen content of the underground part increased significantly by 35%. The total nitrogen concentration did not change much. At the same time, zmbhlh118-ems The strain grew better than the wild type, with increased fresh and dry weights. These results indicate that inhibiting the biological function of the maize bHLH118 transcription factor or inhibiting the expression level of the gene encoding the maize bHLH118 transcription factor can increase plant nitrogen levels and / or promote plant growth.

[0033] In the present invention, the plant nitrogen level includes the total nitrogen concentration and / or total nitrogen content of the plant. Regulating the plant nitrogen level preferably includes regulating the plant nitrogen level in a low nitrogen concentration environment or a high nitrogen concentration environment, more preferably regulating the plant nitrogen level in a high nitrogen concentration environment. The low concentration is preferably 0.04 mM or less, more preferably 0-0.04 mM. The high concentration is preferably 2 mM or more, more preferably 2-6 mM, and most preferably 4 mM. The nitrogen preferably includes ammonium salts and / or nitrates, more preferably at least one of the following: ammonium chloride, ammonium nitrate, and potassium nitrate.

[0034] In the present invention, the plant growth includes one or more of the aboveground fresh weight, aboveground dry weight, underground fresh weight, and underground dry weight of the plant.

[0035] The present invention provides a method for regulating plant nitrogen levels and / or regulating plant growth, wherein a gene encoding a maize bHLH118 transcription factor or a derivative comprising a gene encoding a maize bHLH118 transcription factor is introduced into a plant and overexpressed to reduce plant nitrogen levels and / or inhibit plant growth;

[0036] Mutating the gene encoding the maize bHLH118 transcription factor increases plant nitrogen levels and / or promotes plant growth.

[0037] In the present invention, the derivative containing the gene encoding the maize bHLH118 transcription factor preferably includes at least one of the following: a recombinant expression vector containing the gene encoding the maize bHLH118 transcription factor, a recombinant strain containing the gene encoding the maize bHLH118 transcription factor, and a gene expression cassette containing the gene encoding the maize bHLH118 transcription factor.

[0038] In an embodiment of the present invention, relying on the Crop Functional Genomics and Molecular Breeding Research Center of China Agricultural University, the maize inbred line ND101 was gene-edited to successfully obtain the ZmbHLH118 transgenic overexpression material, and through field progeny screening, two stable homozygous overexpression genetic lines were finally obtained, named ZmbHLH118-OE1 and ZmbHLH118-OE2. After testing, ZmbHLH118-OE1 and ZmbHLH118-OE2 grew weaker than the wild type (ND101), and the total nitrogen concentration and total nitrogen content were significantly reduced. The ZmbHLH118 mutant material was obtained by the maizeEMSDB platform of the Modern Agricultural Technology Research Institute of Qilu Normal University. The EMS chemical mutagenesis mutant of ZmbHLH118 was obtained with a background of B73. After field progeny screening, a stably inherited ZmbHLH118 mutant transgenic line was finally obtained, named zmbhlh118-ems . After sequencing, zmbhlh118-ems The base C on the fourth exon mutated to the base T. The nucleotide sequence after the mutation is shown in SEQ ID NO: 12 (5'-CTGAACCAGCTGCAGGGCGAGGCCTAGAAGCTTAAGCAATCGAACGAATCG-3', with the underline indicating the mutation site). After the mutation, the protein translation at this site changes from glutamine to a stop codon, resulting in premature termination of ZmbHLH118 protein translation. zmbhlh118-ems The growth vigor was better than that of the wild type (B73), and the total nitrogen content was significantly increased.

[0039] In the present invention, the nitrogen concentration in the plant's growth environment is above 2 mM, more preferably 2-6 mM, and most preferably 4 mM. The nitrogen includes ammonium salts and / or nitrates, more preferably at least one of the following: ammonium chloride, ammonium nitrate, and potassium nitrate.

[0040] In the present invention, the reagents for detecting the expression level of the gene encoding the maize bHLH118 transcription factor preferably include a forward primer qF having a nucleotide sequence as shown in SEQ ID NO: 1 and a reverse primer qR having a nucleotide sequence as shown in SEQ ID NO: 2. The reaction system for detecting the expression level of the gene encoding the maize bHLH118 transcription factor preferably includes the following components: 5 μl of 2×Taq Pro Universal SYBR qPCR Master Mix, 0.2 μl of forward primer qF, 0.2 μl of reverse primer qR, 2 μl of cDNA, and ddH2O to a volume of 10 μl. The reaction procedure for detecting the expression level of the gene encoding the maize bHLH118 transcription factor preferably includes: initial denaturation: 95°C for 30 s; cycling: 95°C for 10 s, 60°C for 30 s, for a total of 40 cycles; and melting curve: 95°C for 15 s, 60°C for 60 s, and 95°C for 15 s.

[0041] In the present invention, the plant preferably includes corn. The present invention does not specifically limit the variety of corn. In the examples of the present invention, ND101 and B73 corn are used as examples to illustrate the application of the bHLH118 transcription factor or its encoding gene in regulating plant growth and nitrogen levels and / or nitrogen utilization.

[0042] In order to further illustrate the present invention, the solutions provided by the present invention are described in detail below with reference to the accompanying drawings and embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0043] Experimental Materials

[0044] 1. Plant Materials

[0045] corn( Zea mays LThe material is the inbred line ND101 (provided by the Crop Functional Genomics and Molecular Breeding Research Center, China Agricultural University). It is described in the prior art (Cao H, Liu Z, Guo J, Jia Z, Shi Y, Kang K, Peng W, Wang Z, Chen L, Neuhaeuser B, Wang Y, Liu X, Hao D, Yuan L. ZmNRT1.1B (ZmNPF6.6) determines nitrogen use efficiency via regulation of nitrate transport and signaling in maize. Plant Biotechnol J. 2023 Oct 2). It is primarily used for gene cloning and transcriptional expression analysis. The maize inbred line B73 was used for spatiotemporal gene expression pattern analysis. The gene overexpression materials ZmbHLH118-OE1 and ZmbHLH118-OE2 were both obtained from the Crop Functional Genomics and Molecular Breeding Research Center, College of Life Sciences, China Agricultural University. The transgenic background is ND101. Gene chemical mutagenesis mutant materials zmbhlh118-ems The transgenic material was provided by the maizeEMSDB platform of the Modern Agricultural Technology Research Institute of Qilu Normal University, and the background of the transgenic material was B73.

[0046] 2. Bacteria

[0047] Escherichia coli strain DH5α was purchased from Beijing Novozymes Co., Ltd., and Agrobacterium tumefaciens GV3101 was purchased from Beijing Bomade Gene Technology Co., Ltd.

[0048] 3. Primers

[0049] The relevant primer synthesis and DNA sequencing were completed by Beijing Ruibo Xingke Biotechnology Co., Ltd.

[0050] 4. Related reagents

[0051] Plant culture-related reagents: Reagents such as macroelements and trace elements required for the preparation of nutrient solution were purchased from Quanta Hengyi; hazardous chemicals such as potassium nitrate were purchased from the China Agricultural University experimental reagent and consumables procurement platform.

[0052] PCR-related reagents: high-fidelity enzyme (2×Phanta Mix) was purchased from Beijing Novozymes; Taq enzyme (2×EsTaq MasterMix) was purchased from Kangwei Century Company; nucleic acid dye and DNA maker were both purchased from Bomade Company.

[0053] RNA extraction and reverse transcription reagents: Trizol reagent and reverse transcription kit were purchased from Beijing Novozymes Co., Ltd.

[0054] Fluorescence quantitative PCR detection related reagents: 2×Taq Pro Universal SYBR qPCR Master Mix was purchased from Beijing Novozymes Co., Ltd.

[0055] Reagents for constructing vectors: restriction endonucleases were purchased from Beijing NEB Co., Ltd.; homologous recombination enzymes were purchased from Beijing Novozymes Co., Ltd.; plasmid miniprep kits and gel recovery kits were purchased from Thermo Fisher Scientific.

[0056] Reagents related to protoplast isolation and transient transformation: Plasmid extraction kit was purchased from Beijing Aidelai Biological Company; Cellulase R-10 and Metase R-10 were products of Yakult Company and purchased from Beijing Langbolid Biological Company.

[0057] The enzymatic solution formula is shown in Table 1:

[0058] Table 1 Enzyme hydrolysate formula

[0059]

[0060] W5 solution: 154 mM NaCl, 125 mM CaCl 2、 5 mM KC1 and 2 mM MES (pH 5.7).

[0061] MMG solution: 0.4 M mannitol, 15 mM MgCl2, and 4 mM MES-Tris (pH 5.7).

[0062] PEG-Ca solution: 0.2 M mannitol, 0.1 M CaCl2, and 40% PEG 4000.

[0063] Bacterial culture-related reagents were purchased from Beijing Langbolid Biological Company.

[0064] Complete nutrient solution: 0.3 mM KH2PO4, 0.6 mM MgSO4, 0.5 mM K2SO4, 0.5 mM CaCl2, 1 μM H3BO3, 0.5 mM MnSO4, 0.5 mM ZnSO4, 0.2 mMCuSO4, 0.07 mM Na2MoO4, 0.05 M EDTA-FeNa.

[0065] Semi-nutrient solution: The components are the same as those of the full nutrient solution, and the concentration of each component is 1 / 2 of the full nutrient solution.

[0066] Nitrogen source: The nitrogen source used in the normal culture stage of the nitrogen induction experiment was 2 mM NH4NO3; the nitrogen source used in the low nitrogen conditions of the hydroponic experiment was 0.04 mM KNO3; the nitrogen source used in the high nitrogen conditions of the hydroponic experiment was 4 mM KNO3.

[0067] Nitrogen deficiency treatment: All components are consistent with the complete nutrient solution, and no nitrogen source is added.

[0068] In the present invention ZmbHLH118 The genomic DNA sequence of (GRMZM2G061906) is SEQ ID NO: 7: GGGGTCCAGCCGTGCAACACATAACACGCGCCCGCGTTGGCGTATT

[0069] ZmbHLH118

[0070] Example 1

[0071] ZmbHLH118 Spatiotemporal expression and subcellular localization of genes

[0072] 1. ZmbHLH118 Spatiotemporal expression of genes

[0073] Real-time fluorescence quantitative PCR was used to analyze the expression of 5-mercaptoethanol in maize inbred line B73. ZmbHLH118 The spatiotemporal expression of genes was detected.

[0074] The experimental samples were taken from corn in the field at the seedling, jointing, silking and grain filling stages. The samples included roots, basals, stems, leaves, tassels, aerial roots, bracts, female panicles and male panicles at various stages.

[0075] Total RNA was extracted from corn tissue using the Novozymes RNA isolater Total RNA Extraction Reagent. The experimental method is as follows:

[0076] (1) Grind the fresh tissue sample into powder with liquid nitrogen, take an appropriate amount of sample powder into a centrifuge tube (RNA-free), add 1 ml of RNA lysis buffer, vortex to mix, and let it stand at room temperature for 5 minutes;

[0077] (2) Add 200 μl of chloroform to the above lysate, vortex for 15 s to form an emulsion, let it stand at 4°C for 5 min, and then centrifuge at 12,000 g for 15 min at 4°C;

[0078] (3) After centrifugation, the solution is divided into three layers: a colorless upper aqueous phase, a white middle layer, and a red lower organic phase. Pipette 600 μl of the upper aqueous phase into a new centrifuge tube; add 600 μl of pre-chilled isopropanol, mix by inverting, and let stand at 4°C for 10 minutes;

[0079] (4) Centrifuge at 12000 g for 10 min at 4°C to obtain a white precipitate.

[0080] (5) Carefully discard the supernatant and add 1 ml of 75% ethanol (RNase-free ddH2O). Gently flick the bottom of the tube to suspend the precipitate, invert it several times, and let it stand at room temperature for 3 min.

[0081] (6) Centrifuge at 12000 g for 5 min at 4°C and discard the supernatant. Place the centrifuge tube open on a clean bench to dry the precipitate for 3 min. Add an appropriate amount of RNase-free water to dissolve the precipitate to obtain RNA, and store it in a -80°C refrigerator.

[0082] (7) Using HiScript reverse transcription kit ® Immediately reverse transcribe the above RNA into cDNA using III 1st Strand cDNA Synthesis Kit and store at -20℃ until use.

[0083] Real-time fluorescence quantification ZmTUB The gene was used as the internal reference gene, and 2 -△△CT The relative expression levels of the target genes were calculated using the real-time fluorescence quantitative PCR method. The nucleotide sequences of the real-time fluorescence quantitative PCR primers are shown in Table 2, the reaction system is shown in Table 3, and the reaction procedure is shown in Table 4.

[0084] Table 2 Real-time fluorescence quantitative PCR primers

[0085]

[0086] Table 3 Real-time fluorescence quantitative PCR system

[0087]

[0088] Table 4 Real-time fluorescence quantitative reaction program

[0089]

[0090] Real-time fluorescence quantitative results Figure 1 As shown in A~D, ZmbHLH118 The gene is expressed to varying degrees in all growth stages and tissues of corn. ZmbHLH118 It is mainly expressed in roots, while its expression is higher in leaves after the silking stage.

[0091] 2. Subcellular localization of ZmbHLH118 transcription factor

[0092] The subcellular localization of ZmbHLH118 transcription factor was determined by transient transformation of maize protoplasts. First, maize cDNA was used as template and primers ZmbHLH118 -GFP-F and ZmbHLH118 -GFP-R amplified with restriction enzyme cutting sites and linker sequences ZmbHLH118 CDS sequence and connected it to Puc19-GFP Carrier Kpn I and Sal I multiple cloning site, successfully constructed Puc::ZmbHLH118::GFP carrier.

[0093] ZmbHLH118 -GFP-F: gacgagctcggtaccATGAGCTGCGCGGGGC (SEQ ID NO: 5)

[0094] ZmbHLH118 -GFP-R:tttgcccatgtcgacGGCGACCGGCGGCC (SEQ ID NO: 6)

[0095] The amplification system for vector construction is shown in Table 5, and the reaction procedure is shown in Table 6. The vector linearization system is shown in Table 7. PCR product purification and digestion product recovery were performed using Thermo kits. The system for constructing recombinant vectors using homologous recombination is shown in Table 8.

[0096] Table 5 Amplification system of vector construction

[0097]

[0098] Table 6 Reaction procedures for vector construction

[0099]

[0100] Table 7 Vector enzyme linearization system

[0101]

[0102] Table 8 shows the system of homologous recombination

[0103]

[0104] After obtaining the recombinant vector, transform Escherichia coli. The specific method is as follows:

[0105] (1) Thaw competent DH5α cells on ice.

[0106] (2) Add 5 μl of the ligation product to the competent medium, gently tap the tube wall to mix, and incubate on ice for 30 min.

[0107] (3) Heat shock at 42°C for 90 seconds, then immediately place on ice for 3-5 minutes.

[0108] (4) Add 1 ml of antibiotic-free LB medium and shake the culture in a 37°C shaker at 180-220 rpm for 1 h.

[0109] (5) Centrifuge at 4000 g for 2 min, discard the supernatant and spread the remaining 100 μl on a plate with the corresponding resistance, and incubate inverted at 37°C for 12-16 h.

[0110] After transformation into E. coli, pick 1 / 4 of the single clones on the plate for positive clone screening. The amplification system for screening positive clones is shown in Table 9, and the reaction procedure is shown in Table 10.

[0111] Table 9 Amplification system for screening positive clones

[0112]

[0113] Table 10 Reaction procedures for screening positive clones

[0114]

[0115] After molecular identification, the positive clones were extracted and the plasmids were obtained. Puc::ZmbHLH118::GFP carrier. Puc-GFP No-load and Puc::ZmbHLH118::GFP The vectors were transformed into protoplasts respectively, and then their fluorescence signals were observed using a laser confocal microscope using dual channels of GFP and chloroplast autofluorescence.

[0116] The methods for corn protoplast isolation and PEG-Ca-mediated protoplast transformation are as follows:

[0117] (1) After disinfecting the corn seeds, soak them in a saturated CaSO4 solution for 16 h, then culture them in the dark and water them regularly. When the second leaf of the yellowed seedlings is 10-15 cm longer than the first leaf, they can be used.

[0118] (2) Add 20 ml of enzymatic hydrolysate (prepared immediately before use) to a 50 ml crystallizing dish and cover the crystallizing dish with tin foil;

[0119] (3) Select the middle part of the second leaf of a well-growing yellow corn seedling (6-8 cm) and cut it into 0.5-1 mm thin strips;

[0120] (4) Immerse the cut filaments immediately in the enzymatic hydrolysis solution and draw vacuum three times with a vacuum pump until most of the leaves sink into the solution; then perform dark enzymatic hydrolysis at 28°C and 40 rpm for 4 h. Gently shake the enzymatic hydrolysis solution until the corn leaf filaments are basically dissolved.

[0121] (5) Place a 35 μm ultrafiltration membrane in a culture dish and wet it with W5 solution. Remove the ultrafiltration membrane and place it at the mouth of a 50 ml centrifuge tube. Pour all the liquid in the crystallization dish into the membrane and slowly wash it with W5 solution. The centrifuge tube contains the filtered protoplasts.

[0122] (6) Use a swing-out rotor and centrifuge at room temperature at 100 g (speed 2, speed 2) for 2 min, and carefully remove the supernatant. Use a 1 ml pipette to slowly add 6 ml of W5 solution (pre-cooled on ice), gently invert the centrifuge tube to mix, and centrifuge to remove the supernatant; add 6 ml of W5 solution again, ice bath for 30 min, and centrifuge to remove the supernatant; add an appropriate amount of MMG according to the amount of protoplasts, mix gently, and observe the state and number of protoplasts under a microscope;

[0123] (7) Pipette 15 μg of plasmid into a 2 ml round-bottom centrifuge tube, then add 100 μl of protoplasts to the centrifuge tube, mix gently, add 110 μl of 35% PEG-Ca, and gently tap the bottom of the tube to mix;

[0124] (8) Incubate in the dark at room temperature for 18 min, add 1 ml of W5 solution to the centrifuge tube, mix gently, and terminate the transformation.

[0125] (9) Centrifuge at 100 g (speed 2, speed 2) for 2 min at room temperature, carefully remove the supernatant, add 1 ml of W5 solution to resuspend and wash once, and discard the supernatant after centrifugation;

[0126] (10) Add 1 ml of W5 solution to the centrifuge tube and mix gently. After induction in the dark at room temperature for 12 to 18 hours, centrifuge and discard the supernatant. Leave about 100 μl of W5 in the centrifuge tube for resuspending and observation under a laser confocal microscope and taking pictures.

[0127] The results showed that compared with Puc-GFP , expressed Puc::ZmbHLH118::GFP The protoplasts showed obvious GFP green fluorescence only in the nucleus, which fully proved that ZmbHLH118 was localized in the nucleus ( Figure 1 Middle E).

[0128] Example 2

[0129] ZmbHLH118 Expression patterns in response to nitrogen

[0130] For analysis ZmbHLH118 The response pattern of nitrogen was studied. Wild-type corn was subjected to nitrogen deficiency and nitrogen induction treatments, and the expression of nitrogen in corn samples at different treatment time points was analyzed by fluorescence quantitative PCR. ZmbHLH118 The expression levels were analyzed.

[0131] 1. Seed disinfection and germination: Take three times the amount of corn seeds required for the experiment and disinfect them by soaking them in 2% sodium hypochlorite for 30 minutes. Discard the sodium hypochlorite and rinse three times with deionized water. Add a saturated CaSO₄ solution to completely submerge the seeds and soak them in the dark for 12–16 hours. Discard the saturated CaSO₄ solution and rinse three times with deionized water. Spread the seeds flat on moistened filter paper, with the endosperm touching the filter paper, and place them in a 28°C incubator in the dark for 2–3 days. After germination, roll them up with filter paper and place them vertically in deionized water in the dark for 2–3 days, then incubate them in the light until they have one leaf and one heart. Remove the endosperm, select seedlings with consistent growth, and transfer them to a half-nutrient solution for 2 days. Then, continue incubating with a full nutrient solution, changing the nutrient solution every two days. The artificial climate chamber conditions were set as follows: 14 h light / 10 h dark, 28°C / 25°C, and 300 μmol m -2 s -1Light intensity, 60% humidity.

[0132] 2. Nitrogen deficiency treatment group: Corn seedlings cultured in full nutrient solution were first cultured with 2 mM NH4NO3 as the nitrogen source for 8 days, then treated with nitrogen deficiency, and samples were taken at 0h, 24h, 48h and 96h respectively.

[0133] The results showed that after 1 day, 2 days and 4 days of nitrogen deficiency, ZmbHLH118 The expression of α, β and β were significantly higher than those before nitrogen deficiency treatment, increasing to 1.48 times, 1.95 times and 1.63 times respectively ( Figure 2 A), description ZmbHLH118 The expression of the gene was significantly induced by nitrogen deficiency.

[0134] 3. Nitrogen induction treatment group: Corn seedlings cultured in full nutrient solution were first cultured with 2 mM NH4NO3 as the nitrogen source for 8 d, then nitrogen-deficient for 4 d, and then cultured with 4 mM KNO3 as the nitrogen source. Samples were taken at 0h, 1h, 3h, 6h, 12h, 24h and 72h after the KNO3 supply treatment was restored.

[0135] After 4 days of nitrogen deficiency, 4 mM nitrate was restored and samples were taken at different time points for fluorescence quantitative PCR analysis. The results showed that the induction factor was about 3 times after 1 hour of nitrate restoration. ZmbHLH118 The expression of α-glucose ... ZmbHLH118 There was no significant difference in the expression of nitric acid before the restoration of nitrate nitrogen supply ( Figure 2 Middle B).

[0136] The above results show that after nitrate nitrogen treatment, ZmbHLH118 The expression level increased in the short term, and gradually decreased with the extension of treatment time, indicating that ZmbHLH118 It responds to changes in nitrate nitrogen at the transcriptional level.

[0137] Example 3

[0138] Verification of ZmbHLH118 transgenic overexpression materials ZmbHLH118 Gene function

[0139] 1. Preparation of Transgenic Materials

[0140] Relying on the Crop Functional Genomics and Molecular Breeding Research Center of China Agricultural University, gene editing was performed on the maize inbred line ND101, successfully obtaining transgenic overexpression materials of ZmbHLH118. Through field progeny screening, two stable homozygous overexpression genetic lines were finally obtained, named ZmbHLH118-OE1 and ZmbHLH118-OE2. These two overexpression lines were identified by real-time fluorescence quantitative PCR. Figure 3C shows that compared with the wild type, the two overexpression lines ZmbHLH118 The expression of genes was significantly increased, with ZmbHLH118-OE1 gene expression upregulated by 97 times and ZmbHLH118-OE2 gene expression upregulated by 103 times. Quantitative results showed that both overexpression strains can be used for subsequent physiological experiments.

[0141] 2. For further explanation ZmbHLH118 In response to the physiological function of nitrate nitrogen, high- and low-nitrogen hydroponic experiments were carried out using ND101, ZmbHLH118-OE1, and ZmbHLH118-OE2 corn materials.

[0142] High and low nitrogen hydroponic experiments:

[0143] Low nitrogen (LN) treatment: corn seedlings were cultured in a complete nutrient solution according to the method in Example 2, using 0.04 mM KNO3 as the sole nitrogen source for 14 days;

[0144] High nitrogen (HN) treatment: corn seedlings cultured in full nutrient solution were obtained according to the method in Example 2, and 4 mM KNO3 was used as the sole nitrogen source for 14 days.

[0145] 3. Physiological phenotype analysis of corn seedlings after 14 days of culture

[0146] The growth of the seedlings was statistically analyzed. The results showed that under high nitrogen conditions, the growth of the ZmbHLH118 overexpression strain was significantly weaker than that of the wild type, while under low nitrogen conditions, the growth of the overexpression strain was comparable to that of the wild type ( Figure 3 A and B).

[0147] The aboveground and underground parts of the seedlings were sampled separately, and their fresh weight and dry weight were counted. The results showed that under high nitrogen conditions, the fresh weight and dry weight of the aboveground and underground parts of the ZmbHLH118-OE1 and ZmbHLH118-OE2 lines were significantly lower than those of the wild type ( Figure 3 D and E).

[0148] In order to further illustrate the changes in nitrogen levels in the ZmbHLH118-OE1 and ZmbHLH118-OE2 strains, the total nitrogen concentration of the dried samples was determined. The total nitrogen concentration was determined using a carbon-nitrogen analyzer. Specifically, the aboveground parts and roots of hydroponic corn seedlings for two weeks were harvested separately, and the samples were dried in a 65°C oven to constant weight. After weighing the dry weight, they were ground into powder using a fully automatic high-throughput grinder. 100 mg of powder was weighed for each sample and the total nitrogen concentration was determined using a carbon-nitrogen analyzer. The results showed that the aboveground total nitrogen concentration of the ZmbHLH118-OE1 and ZmbHLH118-OE2 strains was significantly reduced by 10% and 13% compared with the wild type, and the underground total nitrogen concentration was significantly reduced by 22% and 21% compared with the wild type ( Figure 3 Compared with the wild type, the total nitrogen content in the aboveground part was significantly reduced by 67% and 61%, and the total nitrogen content in the underground part was significantly reduced by 43% and 41%, respectively ( Figure 3 Middle G).

[0149] The above results fully demonstrate that ZmbHLH118 It plays a very important regulatory role in corn growth, nitrogen levels and corn nitrogen utilization.

[0150] Example 4

[0151] Verification of ZmbHLH118 mutant materials ZmbHLH118 Gene function

[0152] 1. Obtaining ZmbHLH118 mutant material

[0153] The EMS chemical mutagenesis mutant of ZmbHLH118 was obtained by the maizeEMSDB platform of the Modern Agricultural Technology Research Institute of Qilu Normal University, with a B73 background. After field progeny screening, a stable genetically modified ZmbHLH118 mutant line was finally obtained and named zmbhlh118-ems The identification method of ZmbHLH118 mutant material is as follows:

[0154] DNA was extracted from plant tissues using the CTAB method.

[0155] (1) Grind fresh tissue samples using liquid nitrogen and place 100-200 mg of the ground powder sample in a 2 ml centrifuge tube;

[0156] (2) Add 700 μl of CTAB extract to the centrifuge tube and incubate in a 65°C water bath for 30 min, inverting and mixing several times.

[0157] (3) Remove the sample and cool it to room temperature. Add 700 μl of chloroform, vortex for 5 min, and centrifuge at 12,000 g for 5 min.

[0158] (4) Pipette 600 μl of supernatant, add an equal volume of isopropanol, gently invert to mix, and let stand for 10 min;

[0159] (5) Centrifuge at 12,000 g for 10 min, discard the supernatant, add 700 μl of 75% ethanol, invert the tube to suspend the precipitate, centrifuge at 12,000 g for 2 min, discard the supernatant, and repeat twice;

[0160] (6) Open the centrifuge tube and place it on a clean bench to dry the precipitate. Add an appropriate amount of ddH2O to dissolve the precipitate to obtain DNA.

[0161] (7) The extracted DNA should be used immediately for identification of transgenic materials or stored at -20°C.

[0162] The preparation of CTAB extraction solution is shown in Table 11.

[0163] Table 11 Formula of CTAB extraction solution

[0164]

[0165] Mutant identification primers:

[0166] ZmbHLH118-EMS-F: 5'-TCAACGAGCTCTGTGCCATC-3' (SEQ ID NO:10)

[0167] ZmbHLH118-EMS-R: 5'-CTTGGTCGTGTCGAGGGAC-3' (SEQ ID NO:11)

[0168] Amplify the target gene according to the reaction system in Table 12:

[0169] Table 12 Target gene amplification system

[0170]

[0171] The reaction procedure is shown in Table 13:

[0172] Table 13 Reaction procedure

[0173]

[0174] 10 μl of the reaction product was taken for electrophoresis detection, and the remaining reaction product was sequenced. zmbhlh118-ems In the fourth exon, a base C was successfully mutated into a base T, causing the protein translation at this site to change from glutamine to a stop codon, resulting in the premature termination of ZmbHLH118 protein translation. zmbhlh118-ems An effective mutation occurred, ensuring the credibility of the mutant strain's physiological phenotype (Figure 4 Middle G).

[0175] 2. Physiological phenotype of transgenic materials

[0176] To further verify ZmbHLH118 Physiological functions in response to nitrate nitrogen, using B73 and zmbhlh118-ems The corn material was subjected to high and low nitrogen hydroponic culture experiments according to the method in Example 3.

[0177] The results showed that under high nitrogen conditions, zmbhlh118-ems The growth of the mutant strain was significantly better than that of the wild type ( Figure 4 A and B). The aboveground and underground parts of these seedlings were sampled separately, and their fresh weight and dry weight were counted. The results showed that under high nitrogen conditions, zmbhlh118-ems The fresh weight and dry weight of the aboveground and underground parts of the strain were significantly higher than those of the wild type ( Figure 4 C and D).

[0178] To further explore zmbhlh118-ems The changes in nitrogen levels in the strains were studied and the total nitrogen concentration of the dried samples was determined. zmbhlh118-ems The total nitrogen concentration of the strain did not change much compared with the wild type ( Figure 4 Compared with the wild type, the total nitrogen content in the aboveground part increased significantly by 26%, and the total nitrogen content in the underground part increased significantly by 35% ( Figure 4 Middle F).

[0179] The growth and nitrogen level indicators of the ZmbHLH118 mutant plants showed opposite results to those of the ZmbHLH118 overexpression line, which fully demonstrated that ZmbHLH118 It plays a very important regulatory role in corn growth and nitrogen levels in the body or corn nitrogen utilization.

[0180] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. Other embodiments can be obtained based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. Use of a maize bHLH118 transcription factor or a gene encoding the maize bHLH118 transcription factor in at least one of the following: 1) Regulating plant nitrogen levels and / or nitrogen utilization; 2) Regulate plant growth; The amino acid sequence of the maize bHLH118 transcription factor is shown in SEQ ID NO: 8; The nucleotide sequence of the gene encoding the maize bHLH118 transcription factor is shown in SEQ ID NO: 9; The plant is corn.

2. The use according to claim 1, characterized in that The plant nitrogen level includes the total nitrogen concentration and / or total nitrogen content of the plant.

3. The use according to claim 1, characterized in that The plant growth includes one or more of the aboveground fresh weight, aboveground dry weight, belowground fresh weight, and belowground dry weight of the plant.

4. A method for regulating plant nitrogen levels and / or regulating plant growth, characterized in that Overexpressing a gene encoding a maize bHLH118 transcription factor or a derivative comprising the gene encoding a maize bHLH118 transcription factor into a plant to reduce plant nitrogen levels and / or inhibit plant growth; Mutating the gene encoding the maize bHLH118 transcription factor to increase plant nitrogen levels and / or promote plant growth; The amino acid sequence of the maize bHLH118 transcription factor is shown in SEQ ID NO: 8; The nucleotide sequence of the gene encoding the maize bHLH118 transcription factor is shown in SEQ ID NO: 9; The mutation is a mutation of the base C in the fourth exon of the gene encoding the corn bHLH118 transcription factor to a base T, and the nucleotide sequence after the mutation is shown in SEQ ID NO: 12; The plant is corn.

5. The method according to claim 4, characterized in that The nitrogen concentration in the growth environment of the plant is above 2 mM.

6. The method according to claim 5, characterized in that The nitrogen includes ammonium salts and / or nitrates.

7. The method according to claim 4, characterized in that: The reagents for detecting the expression level of the gene encoding the corn bHLH118 transcription factor include a forward primer qF having a nucleotide sequence as shown in SEQ ID NO: 1 and a reverse primer qR having a nucleotide sequence as shown in SEQ ID NO: 2.

Images